10
What type of boundary has plates that slide past each other?
A) convergent
B
transform
C divergent
D
tension

Answers

Answer 1

Answer:

B

Explanation:

Transform. It like slides past eachother and transforms


Related Questions


Question 4
Blood sugar homeostasis plays an important role in our health and well-being. If
blood sugar levels get too low or high, there are serious health complications that
can result. Which two body systems regulate blood sugar levels? Click on the correct
answers.

Select 2 correct answer(s)

A-Nervous System
B-Musculoskeletal System
C-Respiratory System
D-Digestive System

Answers

Nervous and digestive system

what are the two effects of world war one?

Answers

Answer:

1. Loss of almost an entire generation of young men by Europe.

2. Nationalism raised in the colonial empires

Explanation:

The First World War leads to destruction of empires. Numerous new nation-states were created. United States were forced to become a world power that in turn lead to the rise of Hitler and Soviet communism.

Effects of world war one are as follows:

1. Loss of almost an entire generation of young men by Europe.

2. Nationalism raised in the colonial empires

Which sequence shows a correct pathway for the
flow of energy in a food chain?
A) bacteria → grass → fox → owl
B) grass grasshopper → frog - snake
C) fungi - beetle → algae - mouse
D) algae → snake → duck → deer

Answers

I think is B because the grasshopper is eaten by the frog and the frog is eaten by the snake.

The sequence grass →  grasshopper frog →  snake shows a correct pathway for the flow of energy in a food chain (Option B).

In a food chain, primary producers (e.g., plants and algae) generate organic compounds and energy that enter into the chain.

The primary consumers (e.g., herbivores) are organisms that eat primary producers.

Subsequently, secondary consumers (e.g., carnivores) are organisms that eat primary consumers and so successively in all the levels.

In conclusion, the sequence grass →  grasshopper frog →  snake shows a correct pathway for the flow of energy in a food chain (Option B).

Learn more in:

https://brainly.com/question/16065961

Don’t understand need help

Answers

Answer:

I think c

Explanation:

I took the quiz but I m not sure

Question 5
Some human cells can perform anaerobic respiration for limited amounts of time, such as during periods of heavy exercise. Use the results of your experiment to explain how anaerobic respiration could benefit human survival.

Answers

Answer:

My experiment showed that energy production, or respiration, occurred in yeast even when little oxygen was present. During exercise, the lungs must work hard to take in oxygen, which then circulates to the body parts that need it. The ability to preform anaerobic respiration for short periods of time allows humans to sustain activity, even when oxygen is limited in the body.

Explanation: from plato, so change it a bit.

The experiment showed that energy production, or respiration, occurred in yeast even when little oxygen was present. During exercise, the lungs must work hard to take in oxygen, which then circulates to the body parts that need it. The ability to preform anaerobic respiration for short periods of time allows humans to sustain activity, even when oxygen is limited in the body.

What is anaerobic respiration ?

Anaerobic respiration is respiration using electron acceptors other than molecular oxygen (O2). Although oxygen is not the final electron acceptor, the process still uses a respiratory electron transport chain.

In aerobic organisms undergoing respiration, electrons are shuttled to an electron transport chain, and the final electron acceptor is oxygen. Molecular oxygen is an excellent electron acceptor. Anaerobes instead use less-oxidizing substances such as nitrate (NO−3), fumarate (C4H 2O2−4), sulfate (SO2−4), or elemental sulfur (S). These terminal electron acceptors have smaller reduction potentials than O2. Less energy per oxidized molecule is released. Therefore, anaerobic respiration is less efficient than aerobic.

Learn more about  anaerobic respiration

https://brainly.com/question/13943624

#SPJ2

True or False?

It takes about the one million years for
the magma to complete one circular
convection flow.

Answers

Answer:

False, since it takes more than one million years

Explanation:

Speeds can be faster for small-scale convection occurring in low-viscosity regions beneath the lithosphere, and slower in the lowermost mantle where viscosities are larger. A single shallow convection cycle takes on the order of 50 million years, though deeper convection can be closer to 200 million years.

The ecosystem with the greatest sustainability will be the one that has the

Answers

Answer:

Different organisms or animals

Explanation: In a ecosystem, if you have different animals or organisms, it give them a better chance of survival, reason being that they can choose to eat whatever animal or organism they want because there is lots of animals to choose from the ecosystem. Basically the more diversity you have, the better chance you will survive, and the less diversity you have, the less chance of survival.

List and describe three methods of nonpoint pollution control.
1.
2.
3.

Answers

Answer:

1. Protect drinking water by using less pesticides and fertilizers.

2. Reduce soil erosion by using conservation practices and other applicable best management practices.

3. Use planned grazing systems on pasture and rangeland.

how does geosphere effect the rock cycle?​

Answers

Hydrosphere and Atmosphere: The erosion of rocks, a major part of the rock cycle and change in the geosphere over time, turns rock into sediment and then, sometimes, to sedimentary rock. ... Different combinations of sedimentary rocks form in environments with different climate conditions.

Some evidence on the safety of vaccines.

Answers

Answer:

The safety an​d effectiveness of vaccines​ are under constant study. Because vaccines are designed to be given routinely during well-child care visits, they must be extraordinarily safe. Safety testing begins as soon as a new vaccine is contemplated, continues until it is licensed, and is monitored indefinitely after licensure.

Explanation:

Answer:

well

Explanation:

Before a vaccine is ever recommended for use, it’s tested in labs. This process can take several years. FDA uses the information from these tests to decide whether to test the vaccine with people.

During a clinical trial, a vaccine is tested on people who volunteer to get vaccinated. Clinical trials usually start with 20 to 100 volunteers, but eventually include thousands of volunteers. These tests can take several years and answer important questions like:

The energy needed for the changes in the water cycle to take place comes
from__.
A. wind
B.green plants
C.nitrogen
D.the sun

Answers

It’s D. I got it right lol

PLEASEEEE HELPPPPPPPPPPP
Professor Marcus has identified a new species of beetle in the Amazon Rainforest. The professor then investigates the process of gene expression in the cells of the beetle. Which is an expected result of the investigation?

A The processes of transcription and translation are unique in the beetle.

B The process of translation in the beetle is similar to other organisms, but involves a unique genetic code.

C The process of transcription in the beetle is similar to other organisms, but involves a unique set of nucleic acids in mRNA.

D The processes of transcription and translation, including the genetic code, are the same in the beetle as in nearly all other organisms.

Answers

Answer:

D The processes of transcription and translation, including the genetic code, are the same in the beetle as in nearly all other organisms.

Explanation:

Transcription is the cellular process where a specific DNA fragment called 'gene' is used as a template to create a complementary RNA molecule, usually a messenger RNA (mRNA). Subsequently, this mRNA is then used to synthesize a polypeptide chain (i.e., a protein) in the ribosomes. In eukaryotic organisms such as, in this case, beetles, both transcription and translation are essentially the same processes, and the genetic code used in the protein synthesis is also the same. The difference between beetles is the variation among DNA nucleotide sequences (genomes) which are used as templates to synthesize mRNAs, thereby their final products (proteins) are also different.

Which of the following applications of genetic engineering is preventative and helps
individuals fight infection before its onset?

A)Insulin production
B)Vaccine production
C)Stem cell therapy
D)Gene therapy

Answers

B I think(sorry if you get this wrong)
The answer is B very sure

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

Describe Why are trochophores of interest to biologists?

Answers

Answer:

Because it is also one of the larval stages in some other groups of invertebrates, and are used by biologists to deduce evolutionary relationships among different groups of invertebrates

Explanation:

hope it will help you.

Which adaptation is most likely found in tropical trees?

Answers

Answer:

birds and squirrels

Explanation:

Answer:

The leaves of forest trees have adapted to cope with high rainfall. Many tropical rainforest leaves have a drip tip. It is thought that these drip tips enable rain drops to run off quickly.

Hope this helped!!!

Bacteria Natural Selection

Answers

Answer:

Bacterial resistance arises through the simple process of natural selection. Bacteria divide rapidly, but DNA replication is imperfect. In the presence of antibiotics, while most bacteria are killed, a small number of resistant mutants may survive and take over.

Explanation:

When bacteria are initially exposed to an antibiotic, those most susceptible to the antibiotic will die quickly, leaving any surviving bacteria to pass on their resistant features

How might we predict whether their next child will show the trait of albinism?

Answers

Answer:

By taking the baby to a doctor so that they can doi testing to see if you child has problems or heathy

Explanation:

The baby might need some shots

Identify the products of cellular respiration.

Answers

Answer:

Water and carbon (IV) oxide

How is the ocean affected by the releasing of excess carbon?

Answers

Answer:

Explanation:

Because of human-driven increased levels of carbon dioxide in the atmosphere, there is more CO2 dissolving into the ocean. The ocean's average pH is now around 8.1 , which is basic (or alkaline), but as the ocean continues to absorb more CO2, the pH decreases and the ocean becomes more acidic.

Freckles are a dominant trait in humans. Both of the girls have the genotype FF for freckles. If either one marries a man with no freckles, what are the chances that their children will have freckles?
A. 0%
B. 50%
C. 75%
D. 100%
The answer is D. 100%

Answers

Answer: 50%

Explanation: 2 out of 4 of possible offspring will have a genotype (Ff) that results in a dominant phenotype. ff = recessive non-freckled offspring.

Newyork is near 40 degrees N. What general direction is air moving in Newyork

Answers

Answer:

The air in New York moves to the north.  

Explanation:

At a global level, it occurs unequal warming of the atmosphere, which depends on many factors and varies with latitude. These temperature differences occur because solar radiation reaches the earth differently at different latitudes degrees. The result is the formation of convective cells of atmospheric air circulation: Hardley cell, Ferrel cell, and Polar cell.    

The term convective cell refers to air getting warm, expanding, getting less dense, and ascending. During ascension, it gets colder because of the change in high, contracting, becoming thicker. Finally, it descends.

In each hemisphere, warm air ascends at the equator and approximately at 60º latitude. Cold air descends at approximately 30º latitude and the poles. These air masses circulation generates superficial winds that blow toward the equator between 0º-30º, and toward the poles between 30º-60º lat.  

Ferrel cell occurs between 30º and 60º latitude. At 30º lat, the cold air coming from the north in the tropopause meets the cold air coming from 0º, and both descend to lower altitudes due to its density and low temperature. When these air masses reach the ground, they diverge.  One part goes to 0º lat, while the other part goes forward to the north.  As it moves north, it gets warmer for being at lower altitudes. At 60º, this warm air coming from the 30º meets the polar air coming from 90º, and as it is warmer it ascends again. When it ascends to the tropopause, it is pushed by new air and moves to the south again. While doing so, it loses heat and becomes denser, descending again at 30º.  And so the cycle starts all over again. New York is located at 40º latitude approximately, so air goes forward to the north pole near the ground, but at 60º it elevates again. New York is then affected by the Ferrel cell.        

In the attached image you will find the three cells, circulating in different directions.  

PLEASE HELP ITS DUE IN 3 HOURS!! 6. Match the correct definition to each vocabulary term:


Answers

Answer:

In order from top to bottom

C

A

E

D

B

Explanation:

1) Reflection is when a ray hits something reflective then bounces back. For example, light reflects off a mirror, which is why you can see yourself in a mirror.

2) Wavelength measures the size of a wave. It is measured from the crest or trough of one wave to the crest or trough of another.

3) Refraction occurs when waves go through different mediums at different speeds. This is why a straw looks bent when in water.

4) Frequency is a way of measuring the speed of a wave. It shows how many waves pass every unit of time.

5) Absorption means that all of the waves were absorbed into the medium and none of them passed through.

Why is it important for DNA replication to be a
highly regulated process?

Answers

Answer:

Here you go

Explanation:

DNA replication is regulated to ensure all chromosomes replicate once and only once per cell cycle.Cell cycle regulation by protein phosphorylation ensures that pre-RC assembly can only occur in G1 phase, whereas helicase activation and loading can only occur in S phase.

Why do the temperatures change over the months?
O A. Because the Moon is tilted on its axis, it reflects more sunlight on Earth during different times of Earth's yearly orbit.
B. Because the Sun is tilted on its axis, parts of Earth get more sunlight during different times of Earth's yearly orbit.
O C. Because Earth is tilted on its axis, the stars reflect more light during different times of the Earth's yearly orbit.
D. Because Earth is tilted on its axis, parts of Earth get more hours of sunlight during different times of Earth's yearly orbit.

Answers

Answer:

Answer

Explanation:

B because the more the sun is titled the more heat=different season.

Because Earth is tilted on its axis, parts of Earth get more hours of sunlight during different times of Earth's yearly orbit. As Earth orbits around the Sun, its axis is tilted at an angle of about 23.5 degrees. Hence the correct option is D.

Why do the temperatures change over the months?

The temperatures change over the months primarily because of Earth's axial tilt. As the Earth rotates around the sun, the angle at which sunlight hits different parts of the Earth changes.

This is because the Earth's axis is tilted about 23.5 degrees relative to its orbit around the sun. When a particular hemisphere is tilted toward the sun, it receives more direct sunlight, resulting in warmer temperatures.

Conversely, when that hemisphere is tilted away from the sun, it receives less direct sunlight, resulting in cooler temperatures. This cycle repeats itself annually, causing changes in temperatures over the months.

Hence the correct option is D.

To know more about Earth's axis:

https://brainly.com/question/14639935

#SPJ2

state two factors on which the gravitational force between two objects depends.​

Answers

Answer:

Gravitational Force depends on two factors:

1. Product of mass of two object

2. Square of distance between their centers

Mathematically,

  F = G *(m1* m2)/d²

Explnation:

Plants make sugar from sunlight through ______.
A. Phloem

B. photosynthesis

C. Xylem

D. osmosis

Answers

Answer:

B. Photosynthesis

Explanation:

Photosynthesis is the process plants go through to make glucose, also known as sugar.

Scientific research shows that our global climate is changing. The global sea level is rising and ocean temperatures are...

Answers

the global sea level is rising and ocean temperatures are Increasing

How does the large intestine help the body excrete wastes?
It reabsorbs water from filtrate.
It forms urine.
It removes urea from the body.
It processes undigested food into feces.

Answers

Answer:

It processes undigested food into feces.

Explanation:

Answer:

D. It processes undigested food into feces.

Explanation:

Correct on EDGE 2021!

An organism, like a plant, that can make its own food is called (choose all
that are correct)
A. a heterotroph.
B. an autotroph.
C. a producer
D. a decomposer.

Answers

Answer:

B  

Explanation:

B. Autotroph

Explanation: An organism that produces its own nutrients from inorganic substances or from the environment instead of consuming other organisms.
Other Questions
When plates are compressed, they produce: a. Folded mountains b. Fault-block mountains c. Mid-ocean ridges d. Flat land Aerin's friend Fritz gives her a riddle to solve about the ages of the people in his family. There are 5 people in Fritz's family: Mom, Dad, his sisters Adele and Erika, and Fritz. Here are the clues to the puzzle. 1) Mom is 8 years younger than Dad. 2) Dad is 2 times as old as Fritz. 3) Adele is 4 years old. 4) Fritz's age plus Adele's age equals Erika's age. 5) Mom was 24 when Erika was born. 6) In 9 years, Mom will be twice as old as Erika will be. All the ages are whole numbers. Aerin decides to use variable for the unknown ages and write equations to express the information. M (pi) is an unending decimal. Find the Circumference of the circle below using exact (pi). After taking part in a competition, Seth received a silver medal with a diameter of 8 inches. What is the medal's circumference?Use 3.14 for . choose the equation that best describes the following graph. please answer ASAP.a) y=-3/2x+5b) y=-2/3x+5c) y=-3/2x+3 1/2d) y=-2/3x+3 1/2 Explain what happens to the cotyledons of the seeds as the seedling grows dimples (D) is dominant; no dimples (d) a man who is heterozygous for dimples marries a woman who has no dimples. the genotype of the man would be? 3. Output the following:a.21%4 if you had 4 quarters and 8 nickels how much money would you have? 2. whatcomes toyour mind when youpictures and situations like this Which expression is equivalent to 36 + 24? What is the length of side AB did the southern states support national sovereignty? 1 + 2 + 3 + 4 + 5 + 6 + 7 + 8 + 9 = max you answer 24 + 8x + 10(2x)Terms:Constants:Coefficients: How did the Five Intolerable Acts contribute to the tension between the Patriots and the Loyalists? GIVING BRAINLIEST HELP ASAP Chris borrowed $2,000 from the bank. The interest rate was 3.5% for 5 years. How much does he owe the bank? NO LINKS PLEASE Can someone help me please The subjunctive, choose which sentence is written correctly 1. Which sentence is written correctly? A. Es bueno que los estudiantes escuchas a la guiaB. Es bueno que los estudiantes escuchan a la guiaC. Es bueno que los estudiantes escuchen a la guia2. Which sentence is written correctly? A. Es importante que comes un buen desayuno B. Es importante que comas un buen desayuno C. Es importante que comen un buen desayuno 3. Which sentence is written correctly? A. Es mejor que no iras al museo hoy B. Es mejor que no vas al museo hoy C. Es mejor que no vayas al museo hoy 4. Which sentence is written correctly? A. Es necesario que hacas una gira de la ciudad B. Es necesario que haces una gira de la ciudad C. Es necesario que hagas una gira de la ciudad 5. Which sentence is written correctly? A. Es important que tu estudies mucho Es important que tu estudiar mucho C. Es important que tu estudias mucho Create an interview with a character from a favorite book. Incorporate at least five spelling words into your interview. An interview should include questions from the Interviewer and answers provided from the perspective of the character. Spelling words must be spelled correctly, underlined, and used correctly within the context of the interview. no links 1. Select all the equations that have no solution.a. +6=5+b. -2(3)=-2+6c. 44=3+2d. 4(+1)=3(+2)e. 53=-3+4