2
Security Participants
You are screen sharing
New Share
Pause Share
Annotate
More
Stop Share
CHAPTER 22
Statistics and Central Tendencies
results are shown in the table below.
Number of visits
Number of people
1
6
2 3
119
5
7.
8
6
S
7.
4
(a) Find the median number of visits per person.
(b) Calculate the mean number of visits per person.
[ Jan., paper 1, No. 21
ling between two cities, 3/8 of the passengers ar
Fifty people visiting a museum were asked how many times they had visited the museum​

Answers

Answer 1

Answer:

p

Step-by-step explanation:


Related Questions

A baker Likes to make cookies. The graph shows a proportional relationship between cups of flour used in numbers of cookies made. What does the point (0,0) represent and what does the point (1,26)represent

Answers

Answer:

i cant see the graph if there was a graph with it it would really help lol

Step-by-step explanation:

Answer:

Don't Be mean Online. Be a buddy, Not a Bully

Step-by-step explanation:

Which recursive formula defines the sequence?

f(1) = 6, f(4) = 12, f(7) = 18

Answers

Step-by-step explanation:

if matt's average speed was 8 km/hr how far did he travel in 15 minutes

Answers

Answer:

2km

Step-by-step explanation:

8km/h×15minutes÷60minutes=2km

help pls
What is the solution to this system of equations?
x = 12 − y
2x + 3y = 29

Answers

Answer:

       

Step-by-step explanation:

What is the value of the expression 3/19 7/2

Answers

Answer:

It is 2/15

Step-by-step explanation:

[tex]\frac{3}{19\frac{7}{2} } =\frac{3}{\frac{45}{2} }\\=\frac{2}{15}[/tex]

Dont know if this helps but here you go :)

Can anyone please help with this problem ASAP ?

Answers

Answer:

4 would be $55.00 and 8 would be $75.00

4) 55
8) 75

Hope this helps

How many randomly chosen guests should I invite to my party so that the probability of having a guest with the same birthday as mine is at least 2/3?

Answers

Answer:

At least 401 chosen guests

Step-by-step explanation:

Represent those with same birth day with Same

So:

[tex]P(Same) > \frac{2}{3}[/tex]

Represent number of people with n

There are 365 days in a year and 364 days out of these days is not your birthday.

So, there the probability that n people do not share your birthday is [tex](\frac{364}{365})^n[/tex]

i.e.

[tex]P(none) = (\frac{364}{365})^n[/tex]

Solving further, we have that:

[tex]P(same) + P(none) = 1[/tex]

[tex]P(same) + (\frac{364}{365})^n = 1[/tex]

[tex]P(same) = 1 - (\frac{364}{365})^n[/tex]

We're calculating the probability that [tex]P(Same) > \frac{2}{3}[/tex].

So, we have:

[tex]1 - (\frac{364}{365})^n > \frac{2}{3}[/tex]

Collect Like Terms

[tex]1 - \frac{2}{3}> (\frac{364}{365})^n[/tex]

[tex]\frac{3-2}{3}> (\frac{364}{365})^n[/tex]

[tex]\frac{1}{3}> (\frac{364}{365})^n[/tex]

[tex]3^{-1} > (\frac{364}{365})^n[/tex]

Take natural logarithm (ln) of both sides

[tex]ln(3^{-1}) > ln((\frac{364}{365})^n)[/tex]

[tex]-ln\ 3 > n\ ln\ (\frac{364}{365})[/tex]

Apply laws of logarithm

[tex]-ln\ 3 > n\ (ln(364) - ln(365))[/tex]

Multiply through by -1

[tex]ln\ 3 < n\ (ln(365) - ln(364))[/tex]

Solve for n

[tex]\frac{ln\ 3}{(ln(365) - ln(364))} < n[/tex]

Reorder

[tex]n > \frac{ln\ 3}{(ln(365) - ln(364))}[/tex]

[tex]n > \frac{1.09861228867}{(5.89989735358 - 5.89715386764)}[/tex]

[tex]n> \frac{1.09861228867}{0.00274348594}[/tex]

[tex]n > 400.443928891[/tex]

[tex]n > 400[/tex] (approximated)

This implies that n = 401, 402, 403 .....

i.e

[tex]n \geq 401[/tex]

So, at least 401 people has to be invited

You have 60 ft of fence to make a rectangular vegetable garden alongside the wall of your house. The wall of the house bounds one side of the vegetable garden. What is the largest possible area of the vegetable garden?

Answers

Answer:

400 ft²

Step-by-step explanation:

The maximum area of a rectangle results from it being a square. The rectangle (or square) must have 4 equal sides in order to maximize area. But in this case, one side is a wall. That means that the remaining three sides will be = 60 / 3 = 20 feet long. You formed an square that is 20 ft x 20 ft = 400 ft²

hey I am working on identify slope and intercept​

Answers

Answer:

hey hows ur day

Step-by-step explanation:

mins good

Answer:

Ok, so slope is basically the steepness of the line, and intercept is when it crosses the x or y axis.

Step-by-step explanation:

To identify the slope, find two points on the line, then use this equation to find the slope: [tex]\frac{y2 - y1}{x2 - x1}[/tex], where x1 and y1 are the coordinates of the first point on the line, and x2 and y2 are the coordinates of the second point on the line. y2 - y1 is called the rise, and x2 - x1 is called the run. Then, to find the intercept (commonly the y-intercept), you must find the point at which the line crosses the axis. This is the easiest part because you just need to find a point on the axis. When you need to find the y-intercept, look for where the line crosses the x-axis, and when you need to find the x-intercept, look for where the line crosses the y-axis.

Clara’s school awarded 1900 raffle tickets as incentives. The principal will draw one winning ticket. The winner will receive an iPad pro. Clara received 5 tickets for good attendance, 4 for making the honor roll, and 8 for tutoring other students.
What is the probability that one of Clara’s tickets will be selected by the principal? (write your answer as a %, once it is in % form round to the hundredths place)

Answers

Answer:

0.89%

Step-by-step explanation:

Given that :

Total number of raffle tickets = 1900

Total number of Clara's tickets (5 + 4 + 8) = 17

Probability that one of Clara's tickets will be picked :

Probability = (required outcome / Total possible outcomes)

Required outcome = total number of Clara's ticket

Total possible outcomes = total number of raffle tickets

Hence,

P(picking one of Clara's tickets) = 17 / 1900

17 / 1900 = 0.0089473

0.0089473 * 100%

= 0.8947%

= 0.89%

What is (4-5y) - (2y-16)

Answers

Answer:

4 - 5y - 2y + 16

like terms

20 - 7y

Answer:

4-5y)-(2y-16)=0

Step-by-step explanation:We add all the numbers together, and all the variables

(-5y+4)-(2y-16)=0

We get rid of parentheses

-5y-2y+4+16=0

We add all the numbers together, and all the variables

-7y+20=0

We move all terms containing y to the left, all other terms to the right

-7y=-20

y=-20/-7

y=2+6/7

A quality control expert at LIFE batteries wants to test their new batteries. The design engineer claims they have a variance of 2601 with a mean life of 1191 minutes. If the claim is true, in a sample of 167 batteries, what is the probability that the mean battery life would differ from the population mean by less than 3.5 minutes?

Answers

Answer:

i do not know i will try .

10. A train to New York city leaves a station every 7 minutes. Another train to Boston leaves the
station every 6 minutes. Suppose it is 6:30 am right now. At what time will both trains leave the
station together?

Answers

Answer:

7:00

Step-by-step explanation:

What is the missing value in ___x 1/10=0.27

Answers

should be 2.7 ! i got the answer by multiplying 0.27 by 10 to reset the equation kinda

BROOO HELP what is the slope of the line through (-3,3) and (-1,-1)?

A. 1/2
B. -1/2
C. -2
D. 2

Answers

Answer:

C

Step-by-step explanation:

We are given a line that contains the two points (-3, 3) and (-1, -1) and we want to determine the slope of the line.

To find the slope of a line given any two points, we can consider using the slope formula:

[tex]\displaystyle m=\frac{y_2-y_1}{x_2-x_1}[/tex]

Where (x₁, y₁) and (x₂, y₂) are the two points.

We have the two points (-3, 3) and (-1, -1).

So, let (-3, 3) be (x₁, y₁) and let (-1, -1) be (x₂, y₂).

Substitute and evaluate:

[tex]\displaystyle\begin{aligned} m&=\frac{(-1)-(3)}{(-1)-(-3)}\\ \\ &= \frac{-1 -3 }{-1 + 3} \\ \\ &= \frac{-4}{2} \\ \\ &= -2\end{aligned}[/tex]

So, the slope of the line is -2.

In conclusion, our answer is C.

Answer:

m=-2

Step-by-step explanation:

Its just -2 I cant explain sorry

Help
Find the missing segment

Answers

Answer:

62

because 14 is twice more than 8

so 24 * 2 = 48

and 48 + 14 = 62

most likely 62

62 because they said it ^ F. |

How do you solve this: 2x(3-a)=a(2-b) to find b?

Answers

E = mc^2 get it now
Yea yea

Answer:

b=-2(3x-xa-a)/a

Step-by-step explanation:

2x(3-a)=a(2-b)

6x-2xa=2a-ab

b=-2(3x-xa-a)/a

You can simplified to top because im a little lazy, sorry

what is 3/4 + 1/2 and what is 1/3 + 11/48 in simplest form and a mixed number

Answers

Answer:

1) 5/4 or 1 1/4

2) 9/16

Step-by-step explanation:

3/4+1/2: you multiply 1/2 by 2 to get a common denominator then get 2/4, 3+2=5, 5/4 or 1 1/4

1/3+11/48: you multiply 1/3 by 16 to get common denominator & get 16/48, 16+11= 27/48, divide by 3 & get simplest form of 9/16

Answer:

3/4+1/2= 1 5/8  and 1/3+11/48 is not a mixed number 9/16

Step-by-step explanation:

You have a ribbon that is 7 1/2 inches long you use 1/2 of it on a project how many inches of ribbon are left

Answers

3.75 inches

7.5/2=3.75

Which equation matches the function described in the table?

Answers

Answer:

y = 4x - 1

Step-by-step explanation:

Equation y = 4x - 1 matches the function described in the table.

0.5 (x4 - 3) + 12
WILL MARK BRAINLEST PLEASEEE HURRYYYYY!!!!!!!!

Answers

0.5x^4+10.5 or 12.5 simplified is correct answer. Remove any grouping symbol such as brackets and parentheses by multiplying factors.

Use the exponent rule to remove grouping if the terms are containing exponents.

Combine the like terms by addition or subtraction.

Combine the constants.

A classmate tells you that there are two Fahrenheit temperature that is the same as the Celsius temperature. They tell you it is 50 degrees and -40 degrees. Is your classmate correct or incorrect explain your reasoning.

Answers

Answer:

Step-by-step explanation:

the conversion for farenheit to celsius is to subtract 32 and multiply by 5/9.

-40-32 is -72. multiply that by 5/9 and that is -40

50-32 is 18. multiply that by 5/9 and you get 10. so no she's wrong

A car salesperson earns a 5.8% commission on every car sold. How much commission will the salesperson earn on the sale of a $28,400 car? * PLZZ help!!

Answers

He would earn $1,647.20 in commissions. To calculate this: cost of car * commission rate = his commission. 28,400 * .058 = $1,647.20

I need help on this one

Answers

4. Find the area of each triangle. The formula is A=1/2(bh) so the area of the first triangle is 6, Bc 3•4 is 12, divided by 2 is 6.

The area of the second triangle is 24, because 6•8 is 48, divided by 2 is 24. And 24 is four times the value of 6, making the area scale factor 4.

Hope this helped!

A pizzeria charges $4 per slice of pizza, plus an additional $0.50 per topping. If Erica has at most $13.50 to spend on her pizza, how many toppings could she get on ONE slice of pizza? Write an inequality expression that represents the situation and solve! Explain your reasoning​

Answers

Answer:

19 topings

t=(13.5-4)/.5

Step-by-step explanation:

13.5-4

=9.5

9.5/.5

=19

Suppose that you have $10,000 to invest. Which investment yields the greater return over 6 years:
5.4% compounded monthly or 5.5% compounded quarterly?

Answers

5.5% quarterly would give you slightly more.

Pls answer this I’m begging you I will give a brainless if you answer correctly and professionally

Answers

Answer:

answer big no l

x=-6

y=10

Step-by-step explanation:

answer of 4

x 30

Answer:

Step-by-step explanation:

1) 5x + 4 + 3x - 8 = 180 ( co - interior angles )

8x - 4 = 180

8x = 184

x = 184 / 8

x = 23°

y = 3x - 8 ( vertically opposite angles )

y = 3 × 23 - 8

= 69 - 8

= 61°

4) 5 x + 7 = 2x + 97 ( vertically opposite angles )

5x - 2x = 97 - 7

3x = 90

x = 90 / 3

x = 30°

Hope this helps

plz mark as brainliest!!!!!

Bella is learning to type. She typed a letter to her teacher but misspelled 8 words. If she misspelled 25% of the words she typed. how many words did she type in her letter I'm taking a test I need this ASAP​

Answers

Answer:

She typed 32 words in her letter

Step-by-step explanation:

Assume that the letter has x words

She typed x words in her letter

∵ She misspelled 8 words

∵ She misspelled 25% of the words she typed

She misspelled 25% of x

→ That means 8 is equivalent to 25% of x

∴ 25% of x = 8

25% × x = 8

→ Change 25% to decimal by divide it by 100

∵ 25% = 25 ÷ 100 = 0.25

∴ 0.25 × x = 8

∴ 0.25x = 8

→ Divide both sides by 0.25

∵ [tex]\frac{0.25x}{0.25}[/tex] = [tex]\frac{8}{0.25}[/tex]

x = 32

∵ x represents the number of words that she typed in the letter

She typed 32 words in her letter

Solve the equations:

2^(3x−4) = −2

Answers

Answer:

x=NaN your welcome hehe

hey anyone bother to help

What is the solution to this system of equations?
x = 12 − y
2x + 3y = 29

Answers

Answer:

x=11, y=1 or (11, 1)

Step-by-step explanation:

I used substitution to solve this. Basically wherever there's an x, I would fill it in as 12-y.

2(12-y)+3y=29

24+2y+3y=29

24+5y=29

subtract 24 from both sides

5y=5

divide by 5

y=1

Now substitute y back in to get x.

x=12-1

x=11

You can also graph this into desmos, and wherever they intercept, that's your answer.  I hope this helps!

Other Questions
DUE 10:00 PM HELP ASAP. When Sarah left your house this morning her cell phone was 80% charged and then it started to lose 8% charge for each hour there after write an equation for B in terms of tea representing the charge remaining in series battery as percentage t hours after Sara left her house A news report says that 9% of middle school students are on the track team. There are 600 students in your middle school How many students in your school would you expect to be on the track team? HE Pad SATTE BAR HG West nus SAUNA w 1 PLEASE HELP! THIS A TIMED QUIZ!!Scientists found an artifact that has 25% of Carbon-14 left. Based on how much Carbon-14 is remaining, how old is the artifact that was found?A). 17,100 yearsB). 5,700 yearsC). 22,800 yearsD). 11,400 years Please help asap! Ill give brainliest!What theme does the excerpt convey?It is right to be wary of the unknown.Pride interferes with progress.Manners must be displayed in all situations.Strange animals cannot be trusted. What is your response? Why do u think sunny asks so many questions? anyone out there an expert on dreams?? Estimate 511 x 637 by first rounding each number so that it only has 1 nonzero digit. what would you do when you grow up?*Career* And explain why! During a formal group discussion, participants should be prepared toO lead the conversation and prompt others to speak. O persuade others to agree with their viewpoint. O interrupt other speakers when necessary. O take turns both listening and speaking. This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive How do you do this question? Abdul made $252 for 12 hours of work.At the same rate,how many hours would he have to work to make $105 XYZ Corporation, whose common stock is currently selling for $40 per share, is having a rights offering. The terms of the offering require 10 rights plus $35 to subscribe to one share of stock. Compute the theoretical value of a right before the ex-rights date. Est ce que quelqu'un pourrait bien corriger mon expression ecrite ou donner son avie dessus s'il vous plait A $10,000 bond with 18%/year, compounded semi-annually (interest is paid every six month) is available in the market. The bond matures in 10 years. The closest PW of this bond if the purchaser can earn 12%/year, compounded quarterly is:_____.