3. Nicole has $17.50. Her grandmother gave
her $53.12 for her birthday. She then buys
a computer game that costs $37.25. How
much money does she have left?
E

Answers

Answer 1

Answer:

33.37

Step-by-step explanation:

Answer 2

Answer:

Nicole has $33.37 left

Step-by-step explanation:

($17.50+$53.12)-$37.25=$70.62-$37.25=$33.37


Related Questions


Shelly's Boutique had a Labor Day sale featuring 25% off any item. Tammy wanted to buy a blouse that originally sold for $21.99. To the nearest cent,
how much will it cost her before tax to buy the blouse during the sale?

Answers

Answer:

it will cost $19.12

Step-by-step explanation:

Answer: $19.12

Step-by-step explanation:

The line y−6=2(x+4) passes through which point?

A. (−4,−6)

B. (4,−6)

C. (−4,6)

D. (2,6)

show how u got it please lol

Answers

Answer:

4. (−4, 6), slope −2. eSolutions Manual - Powered by Cognero. Page 1. 4-2 Writing ... 4. (−4, 6), slope −2. SOLUTION: Find the y-intercept. Write the equation in ... Write an equation in slope-intercept form to find the total cost C for p people. b. ... b. Plot points and draw a line through them. c. Solve for G when t = 17.

Segment AB has endpoints with coordinates A: (-4, -7) and B: (8, -4). Determine the value of the x-coordinate of the interior point that separates Segment AB into lengths with a ratio of 8:5. Record answer to the nearest tenth.

Answers

Answer:

 ≈ 3.4

Step-by-step explanation:

Coordinates of the point that divide segment with endpoints A( [tex]x_{1}[/tex] , [tex]y_{1}[/tex] ) and B( [tex]x_{2}[/tex] , [tex]y_{2}[/tex] ) in a ratio a : b are

[tex]\frac{bx_{1} +ax_{2} }{a+b}[/tex] , [tex]\frac{by_{1} +ay_{2} }{a+b}[/tex] )

A(- 4, - 7)

B(8, - 4)

Ratio 8 : 5

x-coordinate is [tex]\frac{5(-4)+8(8)}{8+5}[/tex] = [tex]\frac{44}{13}[/tex] ≈ 3.4

if 8 litres of petrol cover's 60km , how many litres of petrol will a car need to cover 50km​

Answers

Answer:

Step-by-step explanation:

8 litres of petrol cover's =60km

For 1km petrol required=8/60 litre

For 50 km petrol required=8x50/60 litre

=6.66 litre is the answer

If A= (0,0) and B= (2,5), what is the approximate length of AB?

Answers

Answer:

have a good night!

Step-by-step explanation:

[tex]AB = \sqrt{ {x}^{2} + y {}^{2} } [/tex]

[tex]AB = \sqrt{ {2}^{2} + {5}^{2} } [/tex]

[tex]AB = \sqrt{4 + 25} [/tex]

[tex]AB = \sqrt{29} [/tex]

What is x and y ?

I’ll give brainliest!

The options are on the side of the screen/triangle..

Answers

Answer:

I'm pretty sure x is 3

Step-by-step explanation:

Help me
Line ℓ is perpendicular to line m. Find the value of x and w.

Answers

138° + w° = 180° (sum of angle on a straight line)
w° = 180° - 138°
w = 42

19° + x° + w° = 90°
sub. in w=42,
19° + x° + 42° = 90°
x° = 90° - 19° - 42°
x° = 29°
x = 29

If Jack wants to retire with $1,000 per month, how much principal is necessary to generate this amount of monthly income if the interest rate is 6% compounded monthly?

Answers

Answer:

He needs to learn the disciplinary principal

Step-by-step explanation:

The principal is necessary to generate this amount of monthly income is $497.

Given that, Jack wants to retire with $1,000 per month.

What is the compound interest?

Compound interest is the interest on savings calculated on both the initial principal and the accumulated interest from previous periods.

The formula used to find the compound interest = [tex]Amount=Principal(1+\frac{R}{100})^{nt}[/tex]

⇒ 1000 =P[tex](1+0.06)^{12}[/tex]

⇒ 1000=P×2.012

⇒ P=1000/2.012

⇒ P=$497

Hence, the principal is necessary to generate this amount of monthly income is $497.

To learn more about the compound interest visit:

https://brainly.com/question/14295570.

#SPJ2

Type the correct answer in the box. Round your answer to the nearest hundredth.

A class consists of 55% boys and 45% girls. It is observed that 25% of the class are boys and scored an A on the test, and 35% of the class are girls and scored an A on the test. If a student is chosen at random and is found to be a girl, the probability that the student scored an A is ​

Answers

if you add 55% and 45% the total is 100% so 45/100 are girls.  35% of the girls scored and A  so 35/45  is the probability that it is a girl chosen or 7/9. the probability is 7 out of 9.

What is the solution to this problem and what did he do wrong? 4(x + 2) = 2 (x – 3) – 5x

Answers

Answer:

-2

Step-by-step explanation:

Answer:

it is wrong because he forgot to subtract the 5x

Step-by-step explanation:

I think this right I really hope it is though :-)

magdalena creates the drawing shown of a rectangular field . (length : 7.2 cm and height : 3 cm)

she increases all the sides by a scale factor of 4 1/2. what is the area of the new figure?​

Answers

Answer:56

Step-by-step explanation:

Answer:

56

Step-by-step explanation:

Find the distance between the points (–1∕2,–8) and (–1∕2,–2). Question 13 options: A) 8 B) 10 C) 1∕2 D) 6

Answers

Answer:

D) 6

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Algebra II

Distance Formula: [tex]d = \sqrt{(x_2-x_1)^2+(y_2-y_1)^2}[/tex]

Step-by-step explanation:

Step 1: Define

Point (-1/2, -8)

Point (-1/2, -2)

Step 2: Find distance d

Substitute:                    [tex]d = \sqrt{(-1/2+1/2)^2+(-2+8)^2}[/tex]Add:                              [tex]d = \sqrt{(0)^2+(6)^2}[/tex]Exponents:                   [tex]d = \sqrt{0+36}[/tex]Add:                              [tex]d = \sqrt{36}[/tex]Evaluate:                       [tex]d = 6[/tex]

Para la reforestación de un terreno por parcela se compraron 150 arboles de cedro y 210 arboles de guayacán para sembrarlos de tal forma que en cada parcela quede la misma cantidad de arboles de cada tipo ¿Cuál es el mayor numero de parcelas? ¿Cuántos arboles de cedro y cuantos arboles de guayaca se sembrar en cada parcela?

Answers

Answer:

a) 30 parcelas

b) Para árboles de cedro: 5 por parcela

Para árboles de Guayacán: 7 por parcela

Step-by-step explanation:

a) ¿Cuál es el mayor número de parcelas?

De la pregunta tenemos:

150 árboles de cedro y 210 árboles de guayacán

Para encontrar la mayor cantidad de parcelas, resolvemos usando los métodos del mayor factor común.

Encontramos los factores de 150 y 210

Los factores de 150 son: 1, 2, 3, 5, 6, 10, 15, 25, 30, 50, 75, 150

Los factores de 210 son: 1, 2, 3, 5, 6, 7, 10, 14, 15, 21, 30, 35, 42, 70, 105, 210

Entonces el máximo común divisor es 30.

Por lo tanto, la mayor cantidad de parcelas que podemos tener es de 30 parcelas.

b) ¿Cuántos árboles de cedro y de guayacán plantar en cada parcela?

Para cedros

Tenemos 150 árboles de cedro

Por lo tanto, la cantidad de árboles de cedro por parcela = 150 ÷ ​​30 = 5 árboles de cedro por lote

Para los árboles de Guayacán

Tenemos 210 árboles de Guayacán

Por lo tanto, el número de árboles de Guayacán por parcela = 210 ÷ 30 = 7 árboles de Guayacán por lote

simplify 8(x+3)^2/2(x+3)

Answers

Answer:

8

I sent you a photo so u understand how

how to graph y=-4x+2​

Answers

Since the graph is linear, just find 3 points
(0,2), (1,-2), (-1,6)
And graph the points than draw a line to connect them

The number of avocados ( a ) (a) a particular tree produces each year can be modeled by the function a ( y ) a(y). What does a ( 12 ) = 364 a(12)=364 mean?

Answers

Answer:

[tex]a(12) = 364[/tex] means that 364 avocados are produced by a particular tree at 12-th year.

Step-by-step explanation:

Let [tex]a[/tex] the number of avocados that a particular tree produces at a year. [tex]a(y)[/tex] is the number of avocados that a particular tree produces at y-th year. Hence, [tex]a(12) = 364[/tex] means that 364 avocados are produced by a particular tree at 12-th year.

Help DUE IN 30 MINUTES ​

Answers

Here is the working
Hope it helps :)

Find the inequality represented by the graph​

Answers

Answer:

y < 1/4x + 3

Step-by-step explanation:

the line is dotted so we know the symbol will not include the "equal to" part

we can also see that the shading in below the y intercept, so we know that the symbol will also be less than

this means the symbol is <

now, create an equation for the line:

we know that the y intercept is 3, and that there is a rise of 1 and a walk of 4

so the slope is 1/4

now put this together and you get 1/4x + 3

this part will go on the right side of the < symbol in your inequality

so now you can create an inequality: y < 1/4x + 3

Answer:

y < [tex]\frac{1}{4}[/tex] x + 3

Step-by-step explanation:

m = [tex]\frac{1}{4}[/tex] and coordinates of y-intercept are (0, 3)

y < [tex]\frac{1}{4}[/tex] x + 3

Destiny paid $9.60 for a dozen donuts. What is the unit cost for each donut?

Answers

Answer:

$0.8

Step-by-step explanation:

dozen=12

$3.60=12 donuts

$3.60/12= 0.8

$0.8


Please answer as soon as possible! Thanks
Transformation Questions)

Answers

Answer:

A = 1,1 ; 2,3 ; 5,3 ; 4,1 B = 1,-1 ; 2,-3 ; 5,-3 ; 4,-1

The altitude to the hypotenuse of a right triangle divides the hypotenuse into two segments measuring 11 cm and 5 cm. To the nearest tenth, what is the length of the shorter leg of the triangle?

Answers

Answer:

8.4 cm

Step-by-step explanation:

Given that:

A right angled triangle, let [tex]\triangle ABD[/tex]. Right angled at [tex]\angle A[/tex].

Altitude AC to the hypotenuse BD.

Length of side BC = 5 cm

Length of side CD = 11 cm

We have to find the value of shorter leg of triangle. i.e. side AB = ?

Using the concept of similarity, we can say the following:

[tex]\dfrac{AB}{BC} = \dfrac{BD}{AB}\\\Rightarrow AB^2=BC.BD\\\Rightarrow AB^2=5\times (5+11)\\\Rightarrow AB^2=5\times 16\\\Rightarrow AB^2=80\\\Rightarrow AB=\sqrt{80}\\\Rightarrow \bold{AB\approx 8.4\ cm}[/tex]

The length of shorter leg of the triangle = 8.4 cm

please help:) please help:)​

Answers

Is less than <
Hope it helpss

Answer:

Your answer is A) =

Step-by-step explanation:

100 - 2(20)

100 - 40 = 60

3(20) = 60

What are the domain and range of the function below?

Answers

Answer:

Domain: all real numbers

Range: all real numbers greater than or equal to -2

Step-by-step explanation:

The domain is the set of x-coordinates.

It is the set of real numbers since x can be any real number.

The range is the set of y-coordinates.

The minimum value for y is -2. y can be -2 or any real number greater than -2.

Answer:

Domain: all real numbers

Range: all real numbers greater than or equal to -2

Answer:

C on Edge

Step-by-step explanation:

The length of a rectangle is three times the width. The perimeter of the rectangle is 72 cm. Find the dimensions of the rectangle.

Answers

Answer: length=27, width 9

Step-by-step explanation: To solve this problem, you should set up an equation. The length is 3x, and the width is x. To find the perimeter of a triangle, you do length times two + width times two. So 6x+2x=72. 8x=72, x=9. Length is 27, width is 9.

Answer:

Length: 27cm

Width: 9cm

Step-by-step explanation:

Since the length of the rectangle is 3 times the width, we can assume the    width=x and the length=3x.

      P=72cm

     Perimeter= 3x+3x+x+x

Set the 2 equations equal to each other

   72=3x+3x+x+x

Solve for x

   72=8x

   9=x

Length=3x

   Length=9(3)

   Length=27

Width=x

   Width=9

   

Find the number of groups and the number left over. 24 - 5 = with left over 24-5= with left over (Type whole numbers.) ​

Answers

Answer: 19 is my answer 19 is left over

Answer the question in the picture. Thanks!

Answers

Answer:

4+3x=9

Step-by-step explanation:

All of the other choices equal to 4x+12=9 except 4+3x.

what expression is equal to(5+x-2)×2

Answers

If you simply the equation it would be 6+2x

BRAINIEST TO CORRECT ANSWER
(2x^2 +7x)+ (−x^2+10x+3)

Answers

Answer: x2+17x+3

Step-by-step explanation:

2x2+7x−x2+10x+3

=2x2+7x+−x2+10x+3

Combine Like Terms:

=2x2+7x+−x2+10x+3

=(2x2+−x2)+(7x+10x)+(3)

=x2+17x+3

A school librarian has enough money to order 8 paperback books at $155 each. If the librarian decided instead to
order books with hard covers at $188 each, how many books can the librarian buy?

Answers

hi

money he has  :   155 *8  =     800 + 440  =  1240

SO  1240 / 188 ≈ 6.59

so answer  is  6  as you cannot buy half books...

Answer: 6 hard cover books

Step-by-step explanation:

$155 x 8 =1,240

$188 x 6 = 1,128 which is as close as you can get without going over

Mr. Fink's economy car can travel 420 miles on a 12-gallon tank of gas. Determine how many miles he can travel on 8 gallons.

Answers

Answer:

280 miles

Step-by-step explanation:

So, 420 miles=12 gallons

That means that for 1 gallon you would be able to go 35 miles.

Just multiply that by 8. 35*8=280

Other Questions
need answers asap1. risk factorsa. refers to being in good shapeb. the process and function of the bodyc. social needs, social behaviors, and social problems d. traits that increase the possibility of developing an illness or disease2. diabetesa. a disease in which the body produces and/or uses insulin in an inefficient manner, causing a high level of glucose (sugar) in the bloodb. a disease in which the body does not produce and/or use glucose in an effective manner, causing a high level of cholesterol (fat) in the bloodc. a disease in which the body produces too much insulin, and causes low levels of glucose (sugar) in the bloodd. a disease in which the body does not produce and/or use insulin in a effective manner, causing a low level of glucose (sugar) in the blood 3. flexibility a. the ability of a tendon to move through its full range of motionb. the ability of a joint to move through its full range of motionc. the ability of a muscle to move through its full range of motiond. the ability of a ligament to move through its full range of motion4. cardiovascular fitnessa. a term used to refer to the heart, lungs, and blood vessels. Cardio means heart and vascular means the blood vesselsb. the term used to describe the bodys ability to utilize oxygen at a maximal level of efficiencyc. the state of being free from disease or illnessd. traits that increase the possiblity of developing an illness or disease 5. physiologicala. the processes and functions of the bodyb. the processes of the mind c. social needs, social behaviors, and social problemsd. traits that increase the possiblity of developing an illness or disease 6. _____ is/are a/an aspect(s) that can set physical limits to our fitness potential a. heredityb. heart diseasec. environmentd. both a and c7. a condition in which the pancreas does not produce and/or utilize enough insulin to meet the bodys needsa. type 1 diabetes b. type 2 diabetesc. pancreatitis d. none of the above8. health-related factors refer to:a. cardiovascular efficiency b. muscular strength and endurance c. flexibility, and body composition d. all of the above9. skill-related factors refer to:a. agility and reaction timeb. cardiovascular efficiency c. aerobic endurance d. both a and c10. _____ is defined as the greatest amount of force that a muscle group can exert in a single efforta. muscular endurance b. muscular strength c. flexibility d. range of motion Geographers use two key questions every day. When using these two key questions to study the migration of birds, a geographer would ask "where are the birds going?" and "__________?" Which detail is relevant for an argument to make drivers who run through red lights pay a fee? Even though everyone knows that going through red lights is illegal, they do it anyway. The current fines, which are being used to maintain roads, are generating a lot of money for the city. People do not feel safe on the street because they know drivers are not stopping at red lights. The current fines are not high enough to discourage drivers from going through red lights. simply parmanent tissue real life application please help it's for my project Question 8 (1 point)Choose the correct form of the verb in the preterite. 1. Yo _________ (organizar) bien las cosas en la maleta. aorganiz borganizaste corganiz dorganic Please select the word from the list that best fits the definitionDoctors appointment today at 3:20pma.term calendarsb. weekly schedulec. daily organizer hellpppppp please I will give brainliest DUE 10:00 PM HELP ASAP. When Sarah left your house this morning her cell phone was 80% charged and then it started to lose 8% charge for each hour there after write an equation for B in terms of tea representing the charge remaining in series battery as percentage t hours after Sara left her house A news report says that 9% of middle school students are on the track team. There are 600 students in your middle school How many students in your school would you expect to be on the track team? HE Pad SATTE BAR HG West nus SAUNA w 1 PLEASE HELP! THIS A TIMED QUIZ!!Scientists found an artifact that has 25% of Carbon-14 left. Based on how much Carbon-14 is remaining, how old is the artifact that was found?A). 17,100 yearsB). 5,700 yearsC). 22,800 yearsD). 11,400 years Please help asap! Ill give brainliest!What theme does the excerpt convey?It is right to be wary of the unknown.Pride interferes with progress.Manners must be displayed in all situations.Strange animals cannot be trusted. What is your response? Why do u think sunny asks so many questions? anyone out there an expert on dreams?? Estimate 511 x 637 by first rounding each number so that it only has 1 nonzero digit. what would you do when you grow up?*Career* And explain why! During a formal group discussion, participants should be prepared toO lead the conversation and prompt others to speak. O persuade others to agree with their viewpoint. O interrupt other speakers when necessary. O take turns both listening and speaking. This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA