A fast food chain sells 4,500 hamburgers per hour worldwide. How many hamburgers does the fast food chain sell worldwide in 1 minute?

Answers

Answer 1

Answer:

75 hamburgers per minute

Step-by-step explanation:

We’ll it’s 4500 per hour, or every 60 minutes, to find 1 min, you can divide by 60.

4500/60 = 75


Related Questions

Best Buy has a 15% mail in rebate for any purchase over $1,000.
Chloe purchased a new computer system for $1436.88. How much
will Chloe receive back from Best Buy?

Answers

She will receive $215.53 (rounded)

You multiply $1436.88 by 15% which is .15

which term of the series 2187,729,243...is 1/9​

Answers

Answer:

Step-by-step explanation:

Givens

a = 2187

r = 1/3

L = 1/9

what is n

Formula

L = a*r^(n-1)

1/9 = 2187 * (1/3)^(n-1)

1/(9 * 2187) = (1/3)^(n - 1)

1/19683 = (1/3)^(n - 1)

=================

You need to break 19683 down into its prime factors.

19683 = 3* 729

19683 = 3 * 3 * 243

19683 = 3 * 3 * 3 * 81

81 = 3^4 so there are 4 more threes in the breakdown.

19683 = 3 * 3 * 3 * 3 * 3 * 3 * 3

1/19683 = 1/(3)^(7-1)

1/9 is the 6th term in the series.

Example 4: In May 2006, Commonwealth Edison Company supplied electricity to residences for a

monthly customer charge of $7.58 plus $0.08275 per kilowatt-hour (kWhr) for the first 400 kWhr

supplied in the month, and $0.06208 per kWhr for all usage over 400 kWhr in the month. (a) What is the

charge for using 300 kWhr in a month? (b) What is the charge for using 700 kWhr in a month? (c) If Cis

the monthly charge for x kWhr, develop a model relating the monthly charge and kilowatt-hours used.

That is, express C as a function of x.

Answers

Answer: monthly customer charge of $7.58 plus $0.08275 per kilowatt-hour (kWhr) for the first 400 kWhr

Step-by-step explanation: I took this test before so I hope this helps gl on the test

a) The charge for using 300 kWhr in a month is $ 32.41

b) The charge for using 700 kWhr in a month is $ 59.30

c) The rule for computing C is

    C ( x ) = { 7.58 + 0.08275x    if 0 ≤ x ≤ 400
                   15.848 + 0.06208x    if x > 400

What is an Equation?

Equations are mathematical statements with two algebraic expressions flanking the equals (=) sign on either side.

It demonstrates the equality of the relationship between the expressions printed on the left and right sides.

Coefficients, variables, operators, constants, terms, expressions, and the equal to sign are some of the components of an equation. The "=" sign and terms on both sides must always be present when writing an equation.

Given data ,

The monthly charge = $ 7.58

The monthly charge for per kWhr = $ 0.08275

The monthly charge per kWhr over 400 kWhr = $ 0.06208

So ,

The monthly charge for x kWhr is given by the equation = 7.58 + 0.08275x

The monthly charge for x kWhr which is more than 400 kWhr is given by the equation = 7.58 + 0.08275 ( 400 ) + 0.06208 ( x - 400 )

Now ,

a)

The charge for using 300 kWhr in a month is calculated by substituting the value of x as 300

So ,

The monthly charge for x kWhr is given by the equation = 7.58 + 0.08275x

The monthly charge for 300 kWhr = 7.58 + 0.08275 x 300

                                                         = 7.58 + 24.825

                                                         = $ 32.405

Therefore , The monthly charge for 300 kWhr is $ 32.41

b)

The charge for using 700 kWhr in a month is calculated by substituting the value for x as 700

The monthly charge for x kWhr which is more than 400 kWhr is given by the equation = 7.58 + 0.08275 ( 400 ) + 0.06208 ( x - 400 )

The monthly charge for 700 kWhr =  
7.58 + 0.08275 ( 400 ) + 0.06208 ( x - 400 )

Substituting the value for x as 700 , we get

= 7.58 + 0.08275 ( 400 ) + 0.06208 ( 300 )

= 40.68 + 18.624

= $ 59.304

Therefore , The monthly charge for 700 kWhr is $ 59.304

c)

Let x represent the number of kWhr used and C be the monthly charge for x kWhr.

The model can be split into 2 parts of condition , where

For , 0 ≤ x ≤ 400

The function is 7.58 + 0.08275x

For , x > 400

The function is 15.848 + 0.06208x

Therefore ,

The rule for computing C is

    C ( x ) = { 7.58 + 0.08275x    if 0 ≤ x ≤ 400
                   15.848 + 0.06208x    if x > 400

Hence , The monthly charge for 300 kWhr is $ 32.41 and the monthly charge for 700 kWhr is $ 59.304

To learn more about equations click :

https://brainly.com/question/10413253

#SPJ5

Stuck on this last question​

Answers

Answer:

C.

because both of those decimals can be turned into fractions.

Step-by-step explanation:

Hope this helps and have a great day :)

Answer:

C

Step-by-step explanation:

.752 is a rational number and .232323... is a non-terminating repeating number, which is also rational

What is 8 divided by 3/5= ?

Answers

The answer is 13 1/3 or 13.333333333
8 x 5/3 = 13 1/3

Answer:

0.075

Step-by-step explanation:

Emily simplified this expression.



Expression: (5−2)2+23×4

Step 1: (3)2+23×4
Step 2: 9+23×4
Step 3: 9+9×4
Step 4: 9+36
Step 5: 45



Emily made a mistake. Which step shows her first mistake?


Step 1


Step 2


Step 3


Step 4

Answers

Step 2 since 3*2 equals 6

Reality Check 4: Bringing the NBA into Math 0980

Answers

Is this a question or do I have to search up this sentence to help you?
What’s the question?

What is the common difference between successive terms in the sequence? 0.36, 0.26, 0.16, 0.06, –0.04, –0.14

Answers

Answer:

-.1

Step-by-step explanation:

A license plate is to consist of digits followed by uppercase letters. Determine the number of different license plates possible if the first and second digits must beâ odd, and repetition is not permitted.A. 71, 610, 739, 200,000 B. 795, 674, 880,000 C. 7, 894, 720 D. 8, 840, 832,000

Answers

Answer:

D. 8, 840, 832,000

Step-by-step explanation:

The computation of the number of license plates possible is shown below:

Here the first position could be taken by any of the five odd numbers

The second position could be taken by any of the 4 odd numbers

The third position could be taken by the eight left numbers

The fourth position could be taken by another seven numbers

Als the first digit could be any of the 26 upper case letters and so on

So,

= 5 × 4 × 8 × 7 × 26 × 25 × 24 × 23 × 22

= 8,840,832,000

Therefore option D is correct

what makes this number special 8549176230​

Answers

Uhm hope this help (:

8,549,176,320 What makes this number unique? Answer: The said number has all the numbers from 0-9 exactly once and what is special is they are in lexicographical order of their English words.

A car running at a constant speed covers a distance of 492.36 km in
12 hours. Calculate the distance covered by the car in 51/2 hours.​

Answers

Answer:

the anser is 1046.265 because in

492.36=12hour

? =51/2hour then criscros both side 492.36*25,5/12=492.36

Please help me I don’t understand stand it

Answers

the answer is C, 4!!!



please help!! find the reciprocal of these numbers.
6.2
-2.3
0.9
-22.7

Answers

Answer:

They have its own reciprocal

6.2 will be 0.16 -2.3 will be -0.43 0.9 will be 1.11 and -22.7 will be 0.04. You need to change the decimals into fractions. Flip the fraction and then turn that fraction back into a decimal. I hope this is right!


Given f(x) = 2x2 + 4x - 3 and g(x) = 5x - 2, find f(x) - g(x).
Must show all work to receive credit! Show your work in the box below

Answers

Answer:

its the same steps as the other one I answered for you except subtract

Step-by-step explanation:

x-1

Answer:

f(x) - g(x) = 2x^2 - x - 1

Step-by-step explanation:

f(x) = 2x^2 + 4x - 3 g(x) = 5x - 2

f(x) - g(x) = (2x^2 + 4x - 3) - (5x - 2)

= 2x^2 + 4x - 3 - 5x + 2

= 2x^2 - x - 1

Hey how you doing? Hope everyone is doing great! I have a quick question for math, How do you find the unit rate in slopes and graphs?

Answers

Answer:

Divide the numerator and denominator of the given rate by the denominator of the given rate.

Step-by-step explanation:

There are 60 new houses being built in a neighborhood. Last month, 1/4 of them were sold. This month, 1/5 of the remaining houses were sold. How many houses are left to be sold.

Answers

Answer:

36

Step-by-step explanation:

Number of new houses  = 60

Number of houses sold last month = (1/4) of 60

                                                          [tex]= \frac{1}{4}*60[/tex]

                                                          = 15

Remaining houses  = 60 - 15 = 45

Number of houses sold this month = (1/5) of 45

                                                          [tex]=\frac{1}{5}*45\\\\= 9[/tex]

Number of houses that are left = 45 - 9 = 36

(x-8)(2x+5)=0 solve the equation

Answers

Answer:

x=8

Step-by-step explanation:

x= -5/2=-2 1/2= -2.5. If you add all of those up you will get x=8

Hope this helps and have a great day :)

I'm going to k.m.s GOODBYE WORLD

Answers

Answer:

nooooo

Step-by-step explanation:

Answer:honestly i might too at some point but if you decide not to and want to talk about what happened, let me know. i'm not a therapist and i'm not the best with words, but i do like to listen to what others have to say and learn from their lives. i hope you choose to live, but i sadly cannot stop you.

Step-by-step explanation:

What is 727.526 in word form

Answers

Answer:

I believe that's a decimal point

Step-by-step explanation:

If yes then,

Seven hundred and twenty seven point five two six

Answer:

727.526 in word form is :Seventy-five thousand seven hundred and twenty-six

Step-by-step explanation:

hope this helps :)

Solve Sec(2x)-4=0 for the first two positive solutions. thanks!

Answers

sec(2x) - 4 = 0

sec(2x) = 4

1 / cos(2x) = 4

cos(2x) = 1/4

2x = cos⁻¹(1/4) + 2   or   2x = -cos⁻¹(1/4) + 2

(where n is any integer)

x = 1/2 cos⁻¹(1/4) +   or   x = -1/2 cos⁻¹(1/4) +

The first two positive solutions occur for n = 0 in the first family of solutions, and for n = 1 in the second family, so

x = 1/2 cos⁻¹(1/4)   or   x = π - 1/2 cos⁻¹(1/4)

x ≈ 0.659   or   x ≈ 2.483

What is the radius of a circle whose equation is x2+y2−10x+6y+18=0?

2 units
4 units
8 units
16 units

Answers

Answer:

4 Units

Step-by-step explanation:

Edge 2021

Completing the squares and comparing with an standard equation, it is found that the radius of the circle is of 4 units.

What is the equation of a circle?

The equation of a circle of center [tex](x_0, y_0)[/tex] and radius r is given by:

[tex](x - x_0)^2 + (y - y_0)^2 = r^2[/tex]

In this problem, the equation is:

x² + y² - 10x + 6y = -18

Then, we start the steps to complete the squares, as follows:

x² - 10x + y² + 6y = -18

(x - 5)² + (y + 3)² = -18 + 25 + 9

(x - 5)² + (y + 3)² = 16

Then, the radius is found as follows:

r² = 16 -> r = 4 units.

More can be learned about the radius of a circle at https://brainly.com/question/24307696

#SPJ5

4x2 divided by 3 please help thanks you

Answers

Answer:

2 2/3 or 2.6... in decimal

Step-by-step explanation:

4*2 = 8

8/3 = 2 2/3

a rectangle has a length of x3y4 inches and a width of xy7 inches . Which expression represents the ratio of the length of the rectangle to do width of the rectangle?

Answers

Given:

Length of the rectangle = [tex]x^3y^4[/tex] inches

Width of the rectangle = [tex]xy^7[/tex] inches

To find:

The ratio of the length of the rectangle to width of the rectangle.

Solution:

We have,

Length = [tex]x^3y^4[/tex] inches

Width = [tex]xy^7[/tex] inches

So, the ratio of the length of the rectangle to width of the rectangle is

[tex]Ratio=\dfrac{Length}{width}[/tex]

[tex]Ratio=\dfrac{x^3y^4}{xy^7}[/tex]

[tex]Ratio=\dfrac{x\times x^2\times y^4}{x\times y^4\times y^3}[/tex]

Cancel out the common factors.

[tex]Ratio=\dfrac{x^2}{y^3}[/tex]

[tex]Ratio=x^2:y^3[/tex]

Therefore, the required ratio is [tex]x^2:y^3[/tex].

Write the slope intercept form of the equation of the line through the given point with the given slope

Through: (-2,1), slope = -3

Answers

Slope form: y= mx + b
Plug it in: y = -3x + b
1 = -3(-2) + b
1 = 6 + b
b = -5
Final equation: y = -3x -5

answer in percent 20/80 = x/100

Answers

25
Hope this helps H

Hiii this due today can you draw a digram for 5 times 20 please THIS IS DUE TODAY THANK You​

Answers

Answer:

draw the diagram and multiply 5x20

Expressions equivalent to z+(z+6)

Answers

Answer:

2z+6

Step-by-step explanation:

Answer:

z+ (z+6) =2 (z+3)

Step-by-step explanation:

the other given optional expressions are not equivalent to the given expression. The option 2 (z+3) is correct and it is the equivalent expression. Hence the given expression z+ (z+6) is equivalent to the expression 2 (z+3)

A line has a slope of - 3 and passes through the point (-3, 8). What is the equation of the line?
A. Y=-2/3x+6
B. Y=-2/3x+8
C. Y=6x-2/3
D. Y=8x-2/3

Answers

Answer:

y = -3x-1

Step-by-step explanation:

Point-slope equation of a line

y-y1=m(x-x1)

(x1,y1) are coordinates of a point in the line = (-3,8)

m is the slope of the line = -3

Fill in what you know and move constants to get y by itself (y=mx + b ... slope-intercept equation)

y-8=-3(x+3)

y-8=-3x-9

+8 +8

y = -3x-1

None of the options are correct

What comes between 1/2 and 2/3

Answers

Answer:

3/5

Step-by-step explanation:

1/2 can be written as 50%

2/3 can be written as 66.66%

3/5 can be written as 60%

Here

Step-by-step explanation:

The example fractions of 1/2, 2/3 and 3/4 with common denominators become 6/12, 8/12 and 9/12. The numerator 8 is between 6 and 9, so the fraction you created – 8/12, or 2/3 when simplified – is between the two fractions you started with.

4x + 5y = -30
slope intercept form

Answers

Answer:Y=4/5x-6







Explanation:

Slope intercept form of the equation 4x + 5y = - 30 is written as,

⇒ y = - 4/5x - 6

What is Equation of line?

The equation of line in point-slope form passing through the points

(x₁ , y₁) and (x₂, y₂) with slope m is defined as;

⇒ y - y₁ = m (x - x₁)

Where, m = (y₂ - y₁) / (x₂ - x₁)

We have to given that;

The equation is,

⇒ 4x + 5y = - 30

Now, We know that;

Slope intercept form of the equation is,

⇒ y = mx + c

Here, The equation is,

⇒ 4x + 5y = - 30

Subtract 4x both side,

⇒ 4x + 5y - 4x = - 30 - 4x

⇒ 5y = - 4x - 30

Divide by 5 both side, we get;

⇒ y = - 4/5x - 6

Hence, The Slope intercept form of the equation is,

⇒ y = - 4/5x - 6

Learn more about the equation of line visit:

https://brainly.com/question/18831322

#SPJ2

Other Questions
Please select the word from the list that best fits the definitionDoctors appointment today at 3:20pma.term calendarsb. weekly schedulec. daily organizer hellpppppp please I will give brainliest DUE 10:00 PM HELP ASAP. When Sarah left your house this morning her cell phone was 80% charged and then it started to lose 8% charge for each hour there after write an equation for B in terms of tea representing the charge remaining in series battery as percentage t hours after Sara left her house A news report says that 9% of middle school students are on the track team. There are 600 students in your middle school How many students in your school would you expect to be on the track team? HE Pad SATTE BAR HG West nus SAUNA w 1 PLEASE HELP! THIS A TIMED QUIZ!!Scientists found an artifact that has 25% of Carbon-14 left. Based on how much Carbon-14 is remaining, how old is the artifact that was found?A). 17,100 yearsB). 5,700 yearsC). 22,800 yearsD). 11,400 years Please help asap! Ill give brainliest!What theme does the excerpt convey?It is right to be wary of the unknown.Pride interferes with progress.Manners must be displayed in all situations.Strange animals cannot be trusted. What is your response? Why do u think sunny asks so many questions? anyone out there an expert on dreams?? Estimate 511 x 637 by first rounding each number so that it only has 1 nonzero digit. what would you do when you grow up?*Career* And explain why! During a formal group discussion, participants should be prepared toO lead the conversation and prompt others to speak. O persuade others to agree with their viewpoint. O interrupt other speakers when necessary. O take turns both listening and speaking. This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive How do you do this question? Abdul made $252 for 12 hours of work.At the same rate,how many hours would he have to work to make $105 XYZ Corporation, whose common stock is currently selling for $40 per share, is having a rights offering. The terms of the offering require 10 rights plus $35 to subscribe to one share of stock. Compute the theoretical value of a right before the ex-rights date.