A type of insoluble carbohydrate, often stored in leaves and other parts of the plant?

Answers

Answer 1

Answer:

Starch

Explanation:

Answer 2

The answer is starch, it is an insoluble carbohydrate and can be stored in plants


Related Questions

Which is a step of the scientific method in environmental science? A. Testing a hypothesis B.Carrying out research C.Collecting ideas from boocks is a step in the scientific method. The step that follows this step involves forming A.a judgment B.a conclusion C .notes .

Answers

Answer:

The correct answer is Option B (Carrying out research). The step that follows this step involves forming B.a conclusion

Explanation:

The Natural environment  around us is a function of both the living things and the non-living things. So, environmental science is the study of the natural environment around us. This study includes how to tackle environmental problems and further study on how humans could be impacted by the interactions with their environment. The scientific method is a step taken towards ensuring development in a field by bringing new discoveries and challenging existing beliefs through scientific tests and research. Generally, for most scientific methods of many fields, it starts with:

1. Observations

2. Making inquiry which involves asking questions

3. Forming a hypothesis, which means making untested assumptions

4. Conducting an experiment to check the hypothesis

5. Analyze the results

6. Publish the results

The correct answer is Option B (Carrying out research). Because it involves the scientific method highlighted above. The step that follows this step involves forming B.a conclusion

Two rabbits have different parents. One rabbit has ears that flop over, and the other rabbit has ears that stand straight up. Why do the rabbits have ears with different shapes?

Answers

Answer:

The rabbits have different versions of the gene for ear shape, which instruct for different proteins that make differently shaped ears. A Father sheep has curly wool while a Mother sheep has straight wool.

Explanation:

I majored in Biology

Answer:

Explanation: Each rabbit has a different ear shape because they have different versions of the gene for ear shape that connect together to make different ear shapes. - D

What is the probability that each of the following pairs of parents will produce the indicated offsprings? (assume independent assortment of all gene pairs)
a)CCDDEE•ccddee=CcDdEe
b)CCDdEe•CcDdEe=CCddEE
c) CcDdEe•CcDdEe=CcDdEe
d)ccDdEE•CCDdee=CcDdEe​

Answers

Answer:

C is the pick c I'm 99% sure

What is the after effect of increased temperature in the atmosphere?​

Answers

Answer:

global warming

Explanation:

Explain what happened to the spread of the infection as more individuals were vaccinated.

Answers

Answer: As a result of more people being vaccinated the spread of the infection slowed down.


Citrus trees create their seed by a method of asexual reproduction by a process called

Answers

Answer:

Some plants can produce seeds without fertilization. Either the ovule or part of the ovary, which is diploid in nature, gives rise to a new seed. This method of reproduction is known as apomixis. An advantage of asexual reproduction is that the resulting plant will reach maturity faster.

Explanation:

Answer:

Apomixis

Explanation:

Apomixis is the method of asexual reproduction.

Hope this is correct, have a great day.

Which of the following is the major concern with utilizing forensic DNA testing?
O keeping Innocent people out of all
treating genetic diseases as early as possible
a violation of privacy
a violation of the law

Answers

Answer: a violation of privacy

Explanation:

A person's DNA cannot be changed as it is their genetic information. It is therefore their most private information and when it is utilized in forensic DNA testing, it runs the risk of invading a person's privacy.

Forensic DNA testing works by comparing the subject DNA with a DNA database. Using this database means going through the DNA of millions of people without their consent.

This is their most private information and it is being stored and accessed without permission. Critics say that this is a violation of privacy and many studies have showed that this is a major concern

Which air mass would produce cold, dry weather in the winter?

Answers

Answer:

The correct answer is - Continental polar air mass. The continental polar air masses are very big air masses that are very cold, and dry

Answer:

Continental Polar Air Mass

Explanation:

The continental polar air masses are vey big air masses that are very cold, and dry.

What does light years measure

Answers

A light-year is how astronomers measure distance in space, hope this helps ^^

Answer:

Light year measures distance in space

Explanation:

it is mostly used to estimate very far distances and so it might take us about 24 million light years to travel to another galaxy and so on

A change in DNA could alter the amino acid order which will affect the folding of the protein, and therefore it's function.

Answers

Answer:

true

Explanation:

How does the mitotic spindle ensure that each daughter cell receives a full complement of the genetic material in the cell nucleus

Answers

Answer:

The mitotic spindle attaches to the kinetochores at the centromeres of the chromosomes and then it moves toward the poles of the cell. Thus, sister chromatids are separated simultaneously at their centromeres so that each daughter cell will have the same genetic material as the parent cell (i.e., daughter cells will be genetically identical to the parent cell).

Explanation:  

The mitotic spindle is a structure composed of microtubule proteins whose function is to ensure the correct segregation of the chromosomes during mitosis. During metaphase, microtubules from the mitotic spindle bind to the kinetochore (a protein complex assembled on the centromeric region) in order to align sister chromatids on the metaphase plate. Subsequently, during anaphase, the mitotic spindle moves toward the poles of the cell, thereby sister chromatids are separated from each other. In consequence, each daughter cell will have the same amount of genetic material (i.e., the same number of chromosomes) as the parent cell.

I don’t understand how to do this

Answers

Answer:

Translation: GAUGCUUCCAACGACCACTA

Transcription:

GTACGAAGGTTGCTGGTGAT

GATGCTTCCAACGACCACTA

Explanation:

Economic impact of aflatoxin on health and agriculture

Answers

Answer : contamination in crops results mainly from a reduction in marketable volume

Aflatoxin consumed contributes to the mutagenic , carcinogenic , teratogenic , and immunosuppressive health effects in humans.

The direct economic impact of aflatoxin contamination in crops results mainly from a reduction in marketable volume, loss in value in the national markets, inadmissibility or rejection of products by the international market, and losses incurred from livestock disease, consequential morbidity and mortality.

2. Based on your results, can any conclusions be draw as to the types of habitats likely to contain the most microbes?

Answers

Answer:

Yes.

Explanation:

Yes, conclusions can be drawn from the types of habitats the most microbes likely to present because different microbes needs different types of environmental conditions. Some microbes needs moist and cool environment and can't survive in warm and dry environment while some microbes survive in dry and warm environment and die in moist and cool environment so we can draw conclusion from their habitat types.

Monitoring levels of which two gases would help determine the human
impact on air quality?
A. Methane
B. Water vapor
C. Carbon dioxide
D. Oxygen

Answers

Answer:

A. Methane  

C. Carbon dioxide

Explanation:

Methane and carbondioxide are the two gases that determine the human  impact on air quality because these gases are produced due to human activities. Methane gas is used in homes for cooking and heating purpose while on the other hand, carbondioxide gas is released from burning of fossil fuels in the engine of vehicles and industries for making different products. These two gases greatly affect air quality.

Answer:

a and c your welcome my children

Explanation:

Are you for, against or undecided on GMOs? Explain.
Please give your opinion <3

Answers

Answer:

AGAINST for sure

Explanation:

ive personally raised GMO animals and they have no life. like chickens at the age of 8 weeks the breasts on GMO chickens are so large they are unable to walk and if u do not butcher them they will have heart attacks at around 9 weeks. they also dont get to go outside and walk around bc that makes them lose weight. so most of the GMO chickens do not get to go outside and actually have clean air. let alone see the sun light and stand in grass.

Matter and energy always flow from the
in ecosystems.
A. consumers to the producers
B. heterotrophs to the autotrophs
C. autotrophs to the consumers

Answers

Answer: When organisms use organic matter for cellular respiration, ALL the goes back into carbon dioxide, water, and minerals, while ALL the energy leaves the ecosystem as heat. So matter cycles, energy flows through ecosystems. So It is C

Explanation: A. The producers generate food for themselves and others; consumers do not produce anything, instead eating producers, other consumers or both.

B. Autotrophs make food for their own use, but they make enough to support other life as well.Heterotrophs cannot make their own food, so they must eat or absorb it.

So C is correct

Matter and energy always flow from the in ecosystems from autotrophs to the consumer.

What is ecosystem?

The energy flow in the ecosystem is one of the important factors that enables the survival of such a huge number of animals. An ecosystem is made up of a network of connections between living and non-living elements.

All of the energy needed by living things is provided by the sun. About 1% of all radiant energy is absorbed by green plants and distributed throughout the ecosystem.

According to the first law of thermodynamics, energy cannot be generated or destroyed. The energy source, in this case solar energy, cannot be created or destroyed. It can only be moved from one system to another, just like a form is moved from one form to another.

Therefore, Matter and energy always flow from the in ecosystems from autotrophs to the consumer.

To learn more about energy, refer to the link:

https://brainly.com/question/1932868

#SPJ2

Why is crossing over of the chromosomes during meiosis
important?

Answers

Because it increases the genetic variability, offering more combinations of genotypes.

How are sexual and asexual reproduction similar?

A. Both are processes that form new cells necessary for the survival of either an organism or a species.

B. Both are processes that produce daughter cells with the same number of chromosomes as the parent cells.

C. Both are processes used to replace dead skin cells.

D. Both are processes used to create exact copies of cells.

Answers

The correct answer is A I hope this helps

Can the change in cyclin concentration during mitosis be explained by the fact that the cell divides in two and thus divides the material in the cell into two smaller volumes

Answers

Answer:

No, because cell division is expected to decrease not only the net amount of cyclin molecules in daughter cells but also the volume of these daughter cells compared to the original parent cell, and therefore the concentration should be nearly equal.

Explanation:

When a cell divides to produce two daughter cells, the cell components including its previously duplicated genetic material (DNA), organelles, signaling molecules, fatty acids (lipids), proteins, etc., are distributed into daughter cells. These daughter cells have a smaller volume compared to the original parent cell. In consequence, the concentration of cellular components (including cyclin proteins) should be similar between parent cell and daughter cells.

At a warm front warm air meets and moves cold air

Answers

what? what u need?!!!!

Which of the following statements is true? The shape of DNA is a triple helix. DNA mutations never affect an entire chromosome. Mutations in egg and sperm cells are inherited by offspring. Reginald Punnett discovered patterns of inheritance during pea plant experiments.​

Answers

Answer:

Reginald Punnet discovered patterns of inheritance during pea plant experiments

Explanation:

is there more than one right answer

✧・゚: *✧・゚:*  Answer:  *:・゚✧*:・゚✧

✅ Reginald Punnett discovered the theory of incomplete dominance during flower experiments.   ~ ₕₒₚₑ ₜₕᵢₛ ₕₑₗₚₛ! :₎ ♡ ~

Explain how the structure of DNA is important in the synthesis

Answers

Answer:

DNA is the primary genetic material contained within your cells and in nearly all organisms. It's used to create proteins during protein synthesis, which is a multi-step process that takes the coded message of DNA and converts it into a usable protein molecule.

Explanation:

what conditions can cause a population to decrease?

Answers

Answer:

if the population is too high and food is scarce.

high population attract predators.

high competition for food.

mutations.

Answer:

A reduction over time in a region's population can be caused by sudden adverse events such as outbursts of infectious disease, famine, and war or by long-term trends, for example sub-replacement fertility, persistently low birth rates, high mortality rates, and continued emigration.

Empathy means that you can communicate well with others.
A.
True
B.
False

Answers

Answer:

A. true

Explanation:

i mean if you have empathy then yeah it's true

Answer:

A

Explanation:

It means you have the ability to feel what someone is experiencing.

Someone please help me

Answers

Answer:

Your answer is D) Graduated Cylinder.

Answer:

Graduated cylinder

Explanation:

Liquid volume is typically measured using specific tool called graduated cylinder.

Which molecule in the equation represents food energy made by plants? A Carbon dioxide B Water C Glucose D Oxygen

Answers

Answer: Glucose

Explanation: Photosynthesis is a set of chemical reactions that uses energy from the sun and carbon dioxide to produce sugar and oxygen. The sugar provides plants with energy to grow.

HELP ITS DUE SOOOONNNN

Answers

Answer:

A

Explanation:

Denim

Hope this helps :D Have a great day :3

The body layers that can be dissected in the dissection study area are arranged from superficial to deep.


True or False

Answers

Answer:

True

Explanation:

The correct option about the arrangement of the body layers to be dissected in a dissection study from superficial to deep is ; TRUE

During dissection study there only one way in which structures can be viewed  also when the body layers are to be dissected are arranged  in only one way as well ( from superficial to deep ) because the superficial layers lie just under the skin while deep layers lies deep inside the skin surrounding each muscle.

therefore arranging the body layers from superficial to deep is the best arrangement when dissecting.

Learn more :  https://brainly.com/question/17874053

When shorthorn red cattle are bred to shorthorn white cattle, they produce roan (red and white hairs interspersed) offspring. What type of inheritance is this

Answers

Answer:

Co-dominance.

Explanation:

Genetics can be defined as the scientific study of hereditary in living organisms such as humans, animals and plants.

In Genetics, co-dominance can be defined as a phenomenon in which two (2) alleles of the same gene are present in a living organism and both are equally expressed to a degree or simultaneously.

This ultimately implies that, co-dominance is a phenomenon that typically involves the relationship between alleles i.e the two (2) versions of a gene present in living organisms. Also, a single version of a gene expressed by a living organism is referred to as an allele.

In this scenario, when shorthorn red cattle are bred to shorthorn white cattle, they produce roan (red and white hairs interspersed) offspring. Therefore, this type of inheritance is known as co-dominance because the two (2) alleles (shorthorn red and shorthorn white) are expressed equally or simultaneously in their offspring i.e a roan.

Other Questions
He recognized immediately that the last two hieroglyphs were the same as two in Ramesses and read "mes." They were accompanied by the figure of a bird, an ibis. Champollion knew from reading ancient Greek books that the ibis was the symbol of Thoth, the Egyptian god of learning and magic. He decided the three hieroglyphs must represent the name of Thothmes, the "Child of Thoth," a pharaoh who ruled Egypt from 1501 to 1447 B.C.Based on the excerpt, what detail did Champollion use to conclude that the hieroglyphics represent the pharaoh Thothmes?the title of Thoth as the god of learning and magic the dates that Thothmes ruled Egyptthe symbolic meaning of the ibisthe ancient Greek language ) Luci Lulu opened a cookie store in the mall. She found that the relationship between the price of a cookie, p, and the number of cookies sold, x, is given by the linear relationship x = 2000 p + 4000 . Find the maximum revenue Luci can make selling cookies in one day algebra 1. THanks so much for ur time!!! How can Sustainable Development Goals 3 positively impact your community?A.They fight against cases of poliomyelitis (polio) in the United States of America.B.They propose traffic laws to keep everyone safe.C.They promote tobacco use only for adults.D.They regulate the food diets that everyone has to follow. ASAPPP!!!!!! Need help with this its timed pleaseeeee PLEASE HELP ME!!!!! I'LL GIVE BRAINLIST TO BEST ANSWER!!!Explain both the positive and negative influences geography had on the people who moved to the West early on. What opportunities did geography provide? What obstacles did it present? Provide multiple specific examples. ( Specific details and 2-3 sentences ) HELP HELP HELP POINTS GIVEN POINTS GIVENN (marking brainliest or however you spell it)may someone help me on this? please?? thank you if you tried to help! 9.5=25/t+(-8) helppppppppp sasha from aot died :( factorise x^3 - 5xplease help, would be greatful Given: Q=7m+3n, R=11-2m, S=n+5, and T=-m-3n+8 simplify Q+S-T The trail lines on the map above represent the trails taken by pioneers migrating to the West. What was the likely effect of these trails on the western regions? (1 point)Group of answer choicesOver time, development occurred all along the trails not just at the end.The trails had little impact on the regions and quickly disappeared after the rush.Along the way, settlers destroyed the land and polluted all the natural resources.Once they reached the end, settlers returned to various points along the trail they liked better. Yo! Can someone explain a theme statement in a way a not so bright blonde would understand What happened as fish rubbing developed into an art? if he had taken my advice The nitrogen bases down the center are held together by? Lana bought a bamboo plant that was9 1/5 feet high. When she got it home she cut 7 1/2 feet off of it. How tall wasthe plant after she cut it down? In your own words, describe the Renaissance. Please write at least 5 sentences Which linear equation can be used to represent a line perpendicular to Line W passing through point (-3,-2)?line is x=8 on graph PLEASE HELP!