Assume a company reported the following results: Sales Net operating income Average operating assets Margin Turnover Return on investment (ROI) The margin is closest to:

Answers

Answer 1

To determine the margin based on the given information, more specific data is needed. Without the actual figures for sales and net operating income, it is not possible to calculate the exact margin. Therefore, the margin cannot be determined with the provided information.

The margin is a financial metric that measures the profitability of a company by calculating the percentage of net operating income relative to sales. It represents the portion of each dollar of sales that contributes to operating income.

The formula to calculate the margin is:

Margin = (Net Operating Income / Sales) * 100

However, in the given question, the actual values for sales and net operating income are not provided. Therefore, it is not possible to calculate the margin accurately.

Based on the information provided, it is not possible to determine the margin. To calculate the margin, the specific values for sales and net operating income are required.

To know more about sales , visit :

https://brainly.com/question/29436143

#SPJ11


Related Questions

wen is performing a cost-benefit analysis (cba). he needs to determine whether the organization should move workloads from the in-house data center to the cloud. the projected benefit is $50,000. the cost of the control is $1,500. what is the control value?

Answers

The control value is $1,500, representing the cost of maintaining the existing system. It is subtracted from the projected benefit to determine the net benefit of moving workloads to the cloud ($50,000 - $1,500).

In a cost-benefit analysis (CBA), the control value represents the cost associated with maintaining the status quo or the current system/process. It helps in comparing the costs and benefits of different alternatives.

In this case, Wen is evaluating whether to move workloads from the in-house data center to the cloud. The projected benefit from this decision is $50,000. The control value is the cost of maintaining the current in-house data center, which is stated as $1,500.

By subtracting the control value from the projected benefit ($50,000 - $1,500), Wen can determine the net benefit or net value associated with the decision to move workloads to the cloud. In this scenario, the control value serves as a reference point to assess the incremental benefit gained by implementing the alternative option.

Learn more about cost-benefit analysis here:

https://brainly.com/question/30096400

#SPJ11

True/false: most managers and leaders of organizations rarely achieve efficiency

Answers

False. This is a complex question that requires a . While there may be instances where managers and leaders of organizations struggle with achieving efficiency.

it is not fair to say that most of them rarely achieve it. Many managers and leaders take steps to improve their efficiency and effectiveness by implementing various strategies such as setting clear goals and objectives, delegating tasks, empowering their team members, and using technology to streamline processes. However, there may be factors beyond their control that can impact their ability to achieve efficiency,

such as changes in the market, economic conditions, or unexpected events. Ultimately, achieving efficiency requires a continuous effort to identify and eliminate inefficiencies, and most managers and leaders are aware of this and work towards this goal. True/false: most managers and leaders of organizations rarely achieve efficiency. Most managers and leaders of organizations strive to achieve efficiency through continuous improvement, effective communication, and delegation of tasks. However, the level of success in achieving efficiency may vary from one organization to another.

To know more about organizations visit:

https://brainly.com/question/12825206

#SPJ11

Jade owns a loft that she leases to Key and Liu. If Jade sells the loft, Key and Liu
a. become the tenants of the new owner.
b. remain Jade’s tenants until the end of the lease term.
c. become the landlord.
d. must immediately vacate the premises

Answers

It's crucial for key and liu to review their lease agreement and consult with legal professionals to understand their rights and obligations in the event of a sale.

If jade sells the loft, the answer depends on the terms of the lease agreement between jade, key, and liu. typically, when a property is sold with existing tenants, the lease agreement remains in effect, and the new owner becomes the landlord, assuming all the rights and responsibilities of the previous owner. in this case,  (a) would be correct, and key and liu would become the tenants of the new owner.

however, it's important to note that lease agreements can vary, and there may be specific provisions that address the situation in the event of a sale. for example, the lease agreement could have a clause that allows for the termination of the lease upon sale or provides other arrangements.

Learn more about tenants here:

https://brainly.com/question/30700856

#SPJ11

Processes, checklists, flowcharts, formulas, and definitions are examples of _____. a. experiential knowledge b. tacit knowledge c. informal training tools d. explicit knowledge e. on-the-job learning

Answers

Processes, checklists, flowcharts, formulas, and definitions are examples of explicit knowledge (option d).

Explicit knowledge refers to the type of knowledge that can be easily identified, documented, and shared with others. It includes processes, procedures, formulas, checklists, definitions, and other information that can be expressed and communicated in a clear and concise manner. Explicit knowledge is important in any organization because it can be easily shared and transferred to others. It can be used to train new employees, develop standard operating procedures, improve productivity and quality, and create a common language and understanding among team members.

Explicit knowledge is also essential for decision-making, problem-solving, and innovation. It can be used to analyze data, evaluate alternatives, develop new ideas, and create new products and services. In contrast, tacit knowledge refers to the type of knowledge that is difficult to express or codify. It includes skills, experience, intuition, and other types of knowledge that are developed through personal experience and interaction with others. Tacit knowledge is often gained through on-the-job learning, mentoring, and informal training tools such as observation, trial and error, and feedback.

While tacit knowledge is important, it is often difficult to transfer to others, and it can be lost when employees leave the organization. Therefore, it is important to create a balance between explicit and tacit knowledge in order to develop a knowledge-sharing culture that maximizes organizational learning and innovation. The correct option is d.

For more about explicit knowledge:

https://brainly.com/question/31230463

#SPJ4

for a marketing research study to be able to make generalizations to the total population ( and not just the specific sample) it is important to utilize which of the following research technique?
a. pretest posttest application
b. random selection
c. survey reseach
d. experimental reasearch

Answers

To make generalizations to the total population and not just the specific sample, it is important to utilize random selection as a research technique.

The correct answer is b.

Random selection refers to the process of selecting participants from the target population in a way that each individual has an equal chance of being chosen. By using random selection, researchers can ensure that the sample represents the larger population and reduces the risk of bias.

Random selection helps in increasing the external validity of the research study. It allows for the results obtained from the sample to be more likely to apply to the entire population. When the sample is representative of the population, the findings can be generalized with greater confidence.

While pretest posttest application, survey research, and experimental research are valuable methods for collecting data and analyzing relationships, they do not specifically address the issue of generalization to the total population. Random selection, on the other hand, is specifically designed to minimize sampling bias and increase the likelihood of generalizability.

Know more about random selection here

https://brainly.com/question/31153746#

#SPJ11

A company must pay liabilities of $1,000 due 6 months from now and $2,000 due one year from now. The only investments available to the company are two bonds. Bond A is a 6-month bond with 8% nominal annual coupon rate convertible semiannually and a 6% nominal annual yield rate convertible semiannually. Bond B is a 1-year bond with 5% nominal annual coupon rate convertible semiannually and a 7% nominal annual yield rate convertible semiannually. Determine the cost to the company now to match its liabilities exactly.

Answers

The cost to the company now to match its liabilities exactly is the sum of the present values of Bond A and Bond B, which is:

$1,014.94 + $1,955.70 = $2,970.64

To determine the cost to the company now to match its liabilities exactly, we need to calculate the present values of the bond cash flows and select the combination of bonds that will cover the liabilities.

Calculate the present values for Bond A and Bond B based on the given information:

Bond A:

Coupon Rate: 8% (nominal annual rate convertible semiannually)

Yield Rate: 6% (nominal annual rate convertible semiannually)

Time to Maturity: 6 months

To calculate the present value of Bond A, we will consider the semiannual compounding:

Coupon Payment (semiannual) = (8% / 2) * $1,000 = $40

Number of Coupon Payments = 2 (for 6 months)

Present Value of Coupon Payments = $40 / (1 + 0.06/2) + $40 / (1 + 0.06/2)^2 = $74.77

Present Value of the Principal = $1,000 / (1 + 0.06/2)^2 = $940.17

Total Present Value of Bond A = Present Value of Coupon Payments + Present Value of Principal

= $74.77 + $940.17 = $1,014.94

Bond B:

Coupon Rate: 5% (nominal annual rate convertible semiannually)

Yield Rate: 7% (nominal annual rate convertible semiannually)

Time to Maturity: 1 year

To calculate the present value of Bond B, consider the semiannual compounding:

Coupon Payment (semiannual) = (5% / 2) * $2,000 = $50

Number of Coupon Payments = 2 (for 1 year)

Present Value of Coupon Payments = $50 / (1 + 0.07/2) + $50 / (1 + 0.07/2)^2 = $94.77

Present Value of the Principal = $2,000 / (1 + 0.07/2)^2 = $1,860.93

Total Present Value of Bond B = Present Value of Coupon Payments + Present Value of Principal

= $94.77 + $1,860.93 = $1,955.70

Now, we need to find the combination of Bond A and Bond B that matches the company's liabilities.

Liabilities:

$1,000 due in 6 months

$2,000 due in 1 year

We can cover the $1,000 liability due in 6 months by purchasing Bond A, which has a present value of $1,014.94.

For the $2,000 liability due in 1 year, we can purchase Bond B, which has a present value of $1,955.70.

Therefore, the cost to the company now to match its liabilities exactly is the sum of the present values of Bond A and Bond B, which is:

$1,014.94 + $1,955.70 = $2,970.64

Learn more about liabilities here:

https://brainly.com/question/30805836

#SPJ11

Markets do not always work perfectly. If energy efficiency saves money, why do consumers and business decision-makers still make energy in-efficient decisions? Why do markets sometimes fail?

Answers

Consumers and business decision-makers may still make energy inefficient decisions despite the potential cost savings of energy efficiency due to several reasons.

What market barriers exist to energy efficiency?

A market barrier to energy efficiency is defined as "a postulated mechanism that inhibits a decision or behaviour that appears to be both energy efficient and economically efficient" in this book. (Sorrell et al. 2004), owing to the fact that this definition is directly related to energy efficiency.

The reasons are as follows;

Lack of knowledge or awareness about energy-efficient options and their benefits.Adoption of energy-efficient technologies comes with upfront costs and investment barriers.Limited financial resources or budget constraints make prioritising energy efficiency difficult.Inadequate market incentives or price signals that undervalue energy efficiency.Habits, attitudes, and social norms that favour convenience over energy efficiency are examples of behavioural factors.Resistance to change or a preference for familiar options, even if they are inefficient in terms of energy.Externalities and information asymmetry are examples of market failures that impede the efficient operation of energy markets.Inadequate market competition, resulting in fewer options for energy-efficient products or services.

Therefore, To encourage energy-efficient decision-making and overcome market failures, overcoming these barriers requires a multifaceted approach that includes public awareness campaigns and fostering a culture of sustainability.

Learn more about energy efficiency from the given link.

https://brainly.com/question/29631690

#SPJ4

EACH OF THE FOLLOWING QUESTIONS REQUIRES EITHER A SHORT ANSWER OR A "YES" OR "NO" ANSWER, FOLLOWED BY ONLY A SHORT, ONE OR TWO SENTENCE, EXPLANATION.
(a) Adam enters into a franchise agreement with Beta Computers, Inc., in which Beta requires Adam to set up his store in a particular location.
(i) (2 points) Is this provision lawful? Why or why not?
(ii) (2 points) Suppose that Beta desired to grant additional franchises in the same territory. What could Adam have done to ensure that Beta was restricted from doing so?
(iii) (2 points) Suppose that Beta desired to open a corporate-owned store in the same territory. What implied provision of the franchise agreement might prevent Beta from doing so?
(b) Tina buys a Sports Grill franchise.
(i) (2 points) Sports Grill requires that all owners of the franchises buy products for every phase of their operations directly from Sports Grill. Is this requirement lawful? Why or why not?
(ii) (2 points) Sports Grill also requires that all owners of the franchises charge the same prices for their food. Is this lawful? Why or why not?
(c) Diners Coffee Shops, Inc. sells franchises and imposes on all franchise owners various standardized rules regarding not only their operations but also their personnel hiring, firing, and training practices. There was recently a complaint filed by an employee of the Diners franchise restaurant located in Monrovia. Specifically, after several incidents of racist comments and conduct by the assistant manager at the Monrovia restaurant, Sharon, a counterperson at that restaurant, resigned and brought a lawsuit for racial harassment.
(i) (3 points) Can Diners Coffee Shops, Inc. be held liable for racial harassment under these circumstances? Why or why not?
(ii) (2 points) Suppose that Diners desires to terminate the franchise under these circumstances. What is the general legal requirement for termination under most franchise agreements?

Answers

The general legal requirement for termination under most franchise agreements is that the franchisor must show good cause for termination.

These provisions typically specify the conditions under which termination can occur, such as breaches of the agreement or failure to meet performance standards. It is important for the franchisor to ensure that the termination is justified based on the terms of the agreement and any applicable laws or regulations. The specific details of the termination process may vary depending on the terms of the franchise agreement and the jurisdiction in which the agreement is enforced.

When the other party commits a "material breach" of the contract, suspend performance under the agreement. If a material breach has occurred and has not been resolved within a reasonable amount of time after a request for resolution has been made, the agreement can be terminated.

Know more about franchisor here:

https://brainly.com/question/14982702

#SPJ11

Suppose that Rebecca is willing to work as a coffee barista for anything equal to or over $12 per hour. Java Coffee Shop (JCS) is willing to hire a new barista for anything up to $15 per hour. Which o

Answers

The market wage for the coffee barista position will depend on the negotiation between Rebecca and Java Coffee Shop (JCS) based on their respective willingness to pay and accept a wage.

If Rebecca is willing to work for anything equal to or over $12 per hour and JCS is willing to pay up to $15 per hour, the market wage for the coffee barista position is likely to be determined within this range. It could be any wage between $12 and $15 per hour that is agreed upon by both parties. The actual wage will depend on factors such as Rebecca's skills and experience, the demand for baristas in the local labor market, the supply of qualified candidates, and other market conditions. If Rebecca has exceptional skills or there is a shortage of baristas, she may be able to negotiate a higher wage closer to the upper limit of $15 per hour. Conversely, if there is a surplus of baristas or if Rebecca's qualifications are less competitive, she may need to accept a wage closer to the lower limit of $12 per hour.

Learn more about Java Coffee Shop (JCS) here:

https://brainly.com/question/14536704

#SPJ11

All marketers practice psychological marketing to some extent. True or false?

Answers

True. All marketers use psychological marketing techniques to some extent because they are trying to influence consumer behavior.

For example, using bright colors and engaging visuals in advertising appeals to people's emotions and can make them more likely to buy a product. Additionally, marketers often use persuasive language and create a sense of urgency to encourage consumers to take action. They also leverage social proof, such as customer testimonials, to build credibility and trust with potential buyers. By understanding human psychology and behavior, marketers can create more effective campaigns that resonate with their target audience. However, it's important for marketers to use these techniques ethically and responsibly, and not manipulate or deceive consumers in the process.

To know more about psychological marketing techniques  visit:

https://brainly.com/question/2198334

#SPJ11

Determine the payback period for an asset that has a first cost of $40,000, a salvage value of $8000 anytime within 10 years of its purchase, and generates income of $6000 per year. The required return is 7% per year

Answers

The payback period for the asset is approximately 7.83 years.

The payback period is the length of time required to recover the initial investment in an asset. To calculate the payback period, we need to determine how many years it takes for the cumulative cash inflows to equal or exceed the initial investment.

Given data:

First cost: $40,000

Salvage value: $8,000

Annual income: $6,000

Required return: 7% per year

To calculate the payback period, we divide the initial investment by the annual cash inflow:

Payback period = Initial investment / Annual cash inflow

Payback period = $40,000 / $6,000

Payback period ≈ 6.67 years

Since the payback period needs to be within 10 years, we need to consider the salvage value. If the asset is still generating income after 6.67 years, we include the salvage value in the calculation. The salvage value reduces the remaining investment that needs to be recovered.

Remaining investment after 6.67 years = Initial investment - Cumulative cash inflows after 6.67 years

Remaining investment after 6.67 years = $40,000 - ($6,000 * 6.67)

Remaining investment after 6.67 years ≈ $3,995.80

To determine if the remaining investment is recovered within the next 3.33 years, we compare it to the salvage value:

$3,995.80 ≤ $8,000

Since the remaining investment is less than the salvage value, the payback period is extended beyond 6.67 years. We calculate the additional time it takes to recover the remaining investment:

Additional time = Remaining investment / Annual cash inflow

Additional time = $3,995.80 / $6,000

Additional time ≈ 0.67 years

Total payback period = 6.67 years + 0.67 years

Total payback period ≈ 7.83 years

The payback period for the asset is approximately 7.83 years. This means that it takes around 7.83 years for the cumulative cash inflows to equal or exceed the initial investment, considering both the annual income and the salvage value.

To know more about payback, visit :

https://brainly.com/question/28304736

#SPJ11

Below is a list of key outputs from the different service value chain activities:
1. Architectures and policies.
2. Change or project initiation requests.
3. Change requests.
4. Consolidated demands and opportunities.
5. Contracts and agreements with external and internal suppliers and partners.
6. Improvement initiatives and plans.
7. Improvement opportunities and stakeholder feedback.
8. Improvement status reports.
9. Information on the completion of user support tasks.
10. New and changed products and services.
11. Portfolio decisions for Design & transition.
12. Product and service performance information.
13. Product and service portfolio.
14. Product and service requirements.
15. Requirements and specifications.
16. Service components.
17. Services.
18 Strategic, tactical and operational plans.
19. User support tasks.
20. Value chain performance information.
Which one of the following answer options provides the MOST correct combinations (most correct items in their correct service value chain activities) of outputs from the service value chain activities directly relating to the shortcomings discovered by the IT executive?

Answers

The MOST correct combination of outputs from the service value chain activities directly relating to the shortcomings discovered by the IT executive is: Design & transition activity : portfolio decisions; Operations: user support tasks.

The Design & transition activity in the service value chain involves the planning and coordination of new and updated services. Portfolio decisions are one of the key outputs of this activity that would help address the shortcomings discovered by the IT executive.

Operations is another activity that involves the delivery and support of services, and user support tasks are a key output that could address the shortcomings discovered by the IT executive. Therefore, the MOST correct combination of outputs from the service value chain activities directly relating to the shortcomings discovered by the IT executive is Design & transition: portfolio decisions and Operations: user support tasks.

The service value chain is a set of interconnected activities that IT service providers use to deliver value to their customers. The key outputs of these activities help to ensure that IT services are delivered effectively and efficiently.

The Design & transition activity involves planning and coordinating new and updated services. The key outputs of this activity include portfolio decisions, which help to prioritize investments and ensure that resources are used effectively. Operations, on the other hand, involves delivering and supporting services.

The key output of this activity is user support tasks, which help to address the needs of end-users and ensure that they can use IT services effectively. By combining these outputs, IT service providers can ensure that their services are designed, delivered, and supported in a way that meets the needs of their customers and addresses any shortcomings that may be discovered by IT executives.

Know more about transition activity here:

https://brainly.com/question/28222814

#SPJ11

The Family and Medical Leave Act requires employers to provide up to weeks unpaid leave for childbirth, adoption, or family emergencies Select one: a. 52 b. 12 c. 24 d. 8
e. 16

Answers

The Family and Medical Leave Act requires employers to provide unpaid leave for childbirth, adoption, or family emergencies.

The specific amount of unpaid leave required by the Family and Medical Leave Act is 12 weeks. This applies to eligible employees who work for covered employers, which includes private sector companies with 50 or more employees, as well as public agencies and schools. During this 12-week period, the employee is entitled to job protection and continuation of any employer-provided health insurance. The purpose of this law is to allow employees to take time off for important family and medical reasons without fear of losing their job or benefits.

Learn more about health insurance: https://brainly.com/question/28585859

#SPJ11

early supplier involvement (esi): is defined as including key suppliers early in the product design process usually requires having the right number and mix of key suppliers before suppliers can be involved in design projects is usually done with suppliers that provide leverage commodities often leads to significant improvements in quality as products will be easier to build group of answer choices a) only 1 and 4. b) only 3 and 4. c) only 2 and 4. d) 1, 2, and 4. e) 1, 2, 3, and 4.

Answers

The correct option is: d) 1, 2, and 4. Early Supplier Involvement (ESI) refers to the practice of including key suppliers early in the product design process.

This approach recognizes the value of supplier input during the design phase to optimize product functionality, cost, and manufacturability. Therefore, it aligns with statement 1, which states that key suppliers are involved early in the design process. While statement 2 implies that having the right number and mix of key suppliers is a prerequisite for supplier involvement in design projects, it is not a defining characteristic of ESI. The number and mix of suppliers can vary, and it is not an essential requirement for Early Supplier Involvement.

To learn more about Early Supplier Involvement, visit here

https://brainly.com/question/30471881

#SPJ4

social capital is a valuable resource for businesses. match the category of social capital with the questions is seeks to answer. who is connected to whom? how do connected people interact? how do the connected individuals think?

Answers

Social capital seeks to answer the questions "Who is connected to whom?" and "How do connected people interact?"

Social capital refers to the network of relationships and connections within a social group or community. It represents the value derived from these social connections and the resources and benefits that can be accessed through these relationships. Social capital can be categorized into three main dimensions: structural, relational, and cognitive.The first question, "Who is connected to whom?", falls under the structural dimension of social capital. It focuses on mapping and understanding the social connections, networks, and patterns of relationships between individuals or groups. This aspect of social capital investigates the formal and informal ties that exist within a community or organization, identifying the social structure and patterns of interaction.

The second question, "How do connected people interact?", falls under the relational dimension of social capital. It examines the quality and nature of the interactions, exchanges, and social norms that occur within the network of relationships. This dimension explores the trust, reciprocity, collaboration, and shared values among connected individuals and how these factors influence their interactions and collective actions. The third question, "How do the connected individuals think?", pertains to the cognitive dimension of social capital, which focuses on the shared knowledge, information, and understanding that exists within a social network. It investigates the shared beliefs, norms, and common mental models among connected individuals and how these cognitive aspects shape their behavior and decision-making processes. By understanding the answers to these questions, businesses can leverage social capital to build strong relationships, enhance collaboration, access valuable resources and information, and foster a sense of community and trust within their networks.

Learn more about social capital here: https://brainly.com/question/30615073

#SPJ11

Which statement bellow is true regarding the difference between short selling the underlying asset and entering a short position in a forward contract on the same underlying asset?
Short selling the underlying asset does not require an initial cash flow.
Short selling through a forward does not require an initial cash flow.
Short selling the underlying asset involves daily mark to market.
Short selling through a forward involves daily mark to market.

Answers

The statement "Short selling the underlying asset involves daily mark to market" is true

regarding the difference between short selling the underlying asset and entering a short position in a forward contract on the same underlying asset. When an investor short sells the underlying asset, they borrow the asset from a broker and immediately sell it in the market with the hope that the price will fall. In this case, the investor is required to put up a margin or collateral to the broker, and there is a daily mark to market to account for any changes in the price of the asset.

On the other hand, when an investor enters a short position in a forward contract, they agree to sell the underlying asset at a predetermined price and time in the future. Unlike short selling the underlying asset, there is no initial cash flow required for entering a short position in a forward contract. However, there may be mark-to-market involved in forward contracts, depending on the terms of the contract.

In summary, short-selling the underlying asset involves daily mark-to-market, while short-selling through a forward may or may not involve mark-to-market, but does not require an initial cash flow.

know more about Short selling.

https://brainly.com/question/30757886

#SPJ11

Which of the following statements concerning the cash budget is true?
a. The cash budget summarizes all economic activities during the budget period.
b. The cash budget summarizes all cash receipts and disbursements during the budget period.
c. The cash budget summarizes all sales and expenses during the budget period.
d. The cash budget summarizes all revenues and expenses during the budget period.

Answers

b. The cash budget summarizes all cash receipts and disbursements during the budget period.

The cash budget is a financial statement that provides an estimate of the cash inflows and outflows expected to occur during a specific period, typically monthly or quarterly. It focuses specifically on cash receipts (money coming into the business) and cash disbursements (money going out of the business) rather than summarizing all economic activities, sales, or revenues and expenses. The cash budget helps businesses plan and manage their cash flow, ensuring they have sufficient cash to cover their obligations and make strategic decisions regarding investments, financing, and expenditures.

learn more about budget here :

https://brainly.com/question/31952035

#SPJ11

Which of the following statements of the empirical evidence on security returns are correctly applying risk-based explanation?
A. Shares of large-size companies tend to earn lower returns than the small-size companies. This is because large stocks tend to be popular and more liquid than small stocks.
B. Shares of companies with robust profitability tend to earn higher returns than those with weak profitability. This is not a surprise because it is less risky to invest in a profitable company.
C. Shares of high Book-to-Market ratio(B/M) companies tend to earn a higher return than the low B/Mshares.This is because the high B/Mfirms are less flexible and less quick in responding to shocks.
D. Investing to the shares recently earned the highest returns tend to be more profitable than investing to those with the lowest returns. This is because such winning shares tend to be less risky than the losers
E. Shares of companies with conservative investment pattern tend to earn higher returns than those with the aggressive pattern. This is because aggressive investment naturally invites more risk.

Answers

The correctly applied risk-based explanations among the given statements are:

B. Shares of companies with robust profitability tend to earn higher returns than those with weak profitability. This is not a surprise because it is less risky to invest in a profitable company.

E. Shares of companies with conservative investment patterns tend to earn higher returns than those with aggressive patterns. This is because aggressive investment naturally invites more risk.

These statements ly apply risk-based explanations to the observed security returns. In statement B, it suggests that investing in profitable companies is less risky, which can lead to higher returns. Similarly, statement E states that conservative investment patterns are associated with lower risk, leading to higher returns.

On the other hand, statements A, C, and D do not explicitly provide risk-based explanations for the observed security returns. Statement A attributes the difference in returns between large and small companies to popularity and liquidity, rather than explicitly mentioning risk. Statement C mentions the responsiveness to shocks but does not directly link it to risk. Statement D mentions higher returns without providing a clear risk-based explanation.

Remember, risk-based explanations in the context of security returns typically involve the relationship between risk and return, where higher risk is expected to be associated with higher returns, all else being equal.

Learn more about investing here:

https://brainly.com/question/31781807

#SPJ11

Suppose the interest rate in Japan is 1% p. a. and the interest rate in the US is 2.5% p. a. Assume borrowing and investing occur at these rates. The spot rate is ¥100 per dollar. Assume that an investor borrows $100 and converts it to yen and invests for a year in a yen denominated bond. What is the one year ahead forward rate that will make covered interest arbitrage not profitable? [Please note that the exchange rates are stated in indirect terms.]
¥101.0 per dollar
¥101.5 per dollar
¥102.0 per dollar
¥102.5 per dollar

Answers

To determine the one-year ahead forward rate that will make covered interest arbitrage not profitable, we need to consider the interest rate differentials and exchange rates.

In covered interest arbitrage, an investor takes advantage of interest rate differentials between two currencies while covering their foreign exchange risk with a forward contract. The goal is to generate risk-free profits.

Let's calculate the potential profit using covered interest arbitrage in this scenario:

Borrow $100 in the US at an interest rate of 2.5% p.a.

After one year, the amount owed will be: $100 + ($100 * 2.5%) = $102.50

Convert the borrowed $100 to yen using the spot rate of ¥100 per dollar:

$100 * ¥100 = ¥10,000

Invest the ¥10,000 in a yen-denominated bond in Japan at an interest rate of 1% p.a.

After one year, the investment will grow to: ¥10,000 + (¥10,000 * 1%) = ¥10,100

Calculate the value of the yen investment in US dollars using the one-year ahead forward rate (let's call it F):

¥10,100 / F = $102.50

To make covered interest arbitrage not profitable, the forward rate (F) should be set in a way that the value of the yen investment in US dollars is equal to the amount owed in dollars after one year.

Solving the equation:

¥10,100 / F = $102.50

Rearranging the equation to solve for F:

F = ¥10,100 / $102.50

Calculating the value:

F ≈ ¥98.54 per dollar

However, the given answer choices are different from the calculated result. None of the options provided match the value of ¥98.54 per dollar. Please note that the exchange rates are stated in indirect terms, which means that the higher the value of yen per dollar, the weaker the yen is compared to the dollar.

Therefore, without the correct answer choice provided, we cannot determine the exact one-year ahead forward rate that will make covered interest arbitrage not profitable.

To learn more about interest arbitrage, Visit:

https://brainly.com/question/24128478

#SPJ11

bryce co. sales are $833,000, variable costs are $466,400, and operating income is $240,000. what is the contribution margin ratio?

Answers

Bryce Co.'s sales are $833,000 and variable costs are $466,400. To find the contribution margin, subtract the variable costs from the sales: $833,000 - $466,400 = $366,600.

The contribution margin ratio is the percentage of each dollar of sales revenue that is available to cover fixed costs and provide operating income. To calculate the contribution margin ratio, you divide the total contribution margin by the total sales revenue. The contribution margin is the difference between sales revenue and variable costs. In this case, the contribution margin is $833,000 - $466,400 = $366,600. Therefore, the contribution margin ratio is $366,600 / $833,000 = 0.44, or 44%. This means that for every dollar of sales revenue, 44 cents are available to cover fixed costs and provide operating income. The contribution margin ratio is calculated by dividing the contribution margin by the sales. In this case, $366,600 / $833,000 = 0.44, or 44%. Therefore, Bryce Co.'s contribution margin ratio is 44%. This means that 44% of the company's sales revenue contributes to covering fixed costs and generating operating income, which is $240,000.

To learn more about contribution margin ratio, visit:

https://brainly.com/question/30459935

#SPJ11

Mel’s Donuts, Ltd., lured several fry cooks away from Sinkers, Inc. with a promise of higher pay, strictly as a maneuver to undermine Sinkers, Inc.’s production capacity, as Mel never intended to pay the cooks more. When they reported to their new job, Mel’s denied making the promise of higher pay . With confirming evidence, a court would most likely find that Mel’s has violated
Group of answer choices
implied contract rules
no laws, as no written contract was signed
the job as property doctrine
employment-at-will
implied covenant rules

Answers

Mel’s Donuts, Ltd., violated implied covenant rules. With confirming evidence, a court would most likely find that Mel’s has violated implied covenant rules.

Implied covenant rules are the rules of the employer-employee relationship that may not be included in a contract. In this case, Mel’s lured several fry cooks away from Sinkers, Inc. with a promise of higher pay, strictly as a maneuver to undermine Sinkers, Inc.’s production capacity, as Mel never intended to pay the cooks more. When they reported to their new job, Mel’s denied making the promise of higher pay. This is a breach of the implied covenant of good faith and fair dealing, which requires that the employer does not intentionally do anything to undermine the employee's rights under the contract. Therefore, Mel's Donuts, Ltd. violated implied covenant rules.

Know more about employer-employee relationship here:

https://brainly.com/question/29213376

#SPJ11

B. Level 2 Analysis Units sold Revenue 36000 Variable costs 8000 Contribution margin 28000 Fixed costs 15000 Operating income 13000 Actual Results 2000 Diffrence Actual and flexble Flexible- Sales Static Volume Budget Flexible Variances Budget Variances Budget 5000 16000F 20000 30000U 50000 2000F 10000 15000F 25000 18000F 10000 15000U 25000 5000L 10000 0 10000 13000F 0 15000U 15000 Total sales-volume variance $$ Total flexible-budget variance $2000u Total static-budget variance Page 2 of 2 Practice on flexible budget. Bank Management Printers, Inc., produces luxury checkbooks with three checks and stubs per page. Each checkbook is designed for an individual customer and is ordered through the customer's bank. The company's operating budget for September 2009 included these data: 5,000 Number of checkbooks Selling price per book Variable cost per book $10 $5 Fixed costs for the month $10,000 The actual results for September 2009 were 2,000 Number of checkbooks Selling price per book Variable cost per book $4 $15,000 Fixed costs for the month A. Prepare a static-budget-based variance atalys's of the September performance B. Prepare a flexible-budget-based variance analysis of the September performance Variance Analysis for Bank Management Printers for September 2009 Actual Static- Static Budget Results Budget Variances Units sold 2000 3000U 5000 Revenue 2018- 36000 14000U 50000 Variable costs 8000 17000F 25000 Contribution margin 28000 3000F 25000 Fixed costs 15000 5000U 10000 Operating income 13000 20000 15000 Total static-budget variance 2x4= =& Page 1 of 2

Answers

A. Static-Budget-Based Variance Analysis:

Units sold variance: The actual units sold were 2,000, which is 1,000 units (3,000 - 2,000) less than the static budget. This indicates an unfavorable variance.
The company sold fewer checkbooks than planned, which resulted in lower revenue than expected.
The unfavorable units sold variance suggests that the company needs to investigate the reasons for the lower sales volume and take appropriate actions to improve performance.

Revenue variance: The actual revenue was $8,000 (36,000 - 28,000) less than the static budget. This indicates an unfavorable variance.
The lower units sold and a lower selling price per book contributed to the decrease in revenue compared to the static budget.

The unfavorable revenue variance highlights the need to assess the factors contributing to lower revenue and develop strategies to increase sales and/or improve pricing.

Variable costs variance: The actual variable costs were $7,000 (8,000 - 15,000) higher than the static budget. This indicates an unfavorable variance.
The increase in variable costs per book led to higher overall variable costs, impacting the contribution margin negatively.

The unfavorable variable costs variance suggests that the company should review its cost structure and identify ways to reduce variable costs per book to improve profitability.

Fixed costs variance: The actual fixed costs were $5,000 (15,000 - 10,000) higher than the static budget. This indicates an unfavorable variance.
The increase in fixed costs suggests that the company incurred higher expenses than initially planned for the month.
The unfavorable fixed costs variance implies the need to analyze and control fixed costs more effectively to achieve better cost management.

B. Flexible-Budget-Based Variance Analysis:

Units sold variance: The flexible-budget units sold were 3,000, which is 1,000 units (2,000 - 3,000) less than the actual units sold. This indicates a favorable variance.
Explanation: The company sold fewer checkbooks than expected, resulting in a lower contribution margin compared to the flexible budget.

The favorable units sold variance indicates that the company performed better than anticipated in terms of units sold. However, further investigation is needed to identify the reasons behind the lower sales volume.

Revenue variance: The flexible-budget revenue was $14,000 (50,000 - 36,000) higher than the actual revenue. This indicates a favorable variance.
The higher selling price per book in the flexible budget contributed to the increase in revenue compared to the actual results.
The favorable revenue variance suggests that the company generated more revenue than expected. This could be due to a higher selling price per book, but further analysis is required to determine the underlying causes.

Variable costs variance: The flexible-budget variable costs were $17,000 (25,000 - 8,000) higher than the actual variable costs. This indicates an unfavorable variance.
The higher variable costs per book in the flexible budget resulted in higher overall variable costs compared to the actual results.
The unfavorable variable costs variance indicates that the company incurred higher variable costs than anticipated. Evaluating the factors contributing to the increase can help identify areas for cost reduction.

Fixed costs variance: The flexible-budget fixed costs were $5,000 (10,000 - 15,000) lower than the actual fixed costs. This indicates a favorable variance. The lower fixed costs in the flexible budget contributed to a reduction in overall fixed costs compared to the actual results.
The favorable fixed costs variance suggests that the company managed to lower its fixed costs. Further analysis is necessary to determine how this cost reduction was achieved

To know more about budget ,visit:
https://brainly.com/question/31952035
#SPJ11

select each of the following ratios with the formula used to compute it. 1. working capital 2. current ratio 3. quick ratio 4. accounts receivable turnover 5. average days to collect receivables 6. inventory turnover 7. average days to sell inventory 8. debt-to-assets ratio 9. debt-to-equity ratio 10. return on investment 11. return on equity 12. earnings per share

Answers

The formulas for the financial ratios mentioned are written.

Here are the formulas for the financial ratios you mentioned:

1. Working Capital = Current Assets - Current Liabilities
2. Current Ratio = Current Assets / Current Liabilities
3. Quick Ratio = (Current Assets - Inventory) / Current Liabilities
4. Accounts Receivable Turnover = Net Credit Sales / Average Accounts Receivable
5. Average Days to Collect Receivables = 365 / Accounts Receivable Turnover
6. Inventory Turnover = Cost of Goods Sold / Average Inventory
7. Average Days to Sell Inventory = 365 / Inventory Turnover
8. Debt-to-Assets Ratio = Total Debt / Total Assets
9. Debt-to-Equity Ratio = Total Debt / Total Equity
10. Return on Investment (ROI) = (Net Income + (Interest Expense - Tax Savings)) / Total Investment
11. Return on Equity (ROE) = Net Income / Average Shareholders' Equity
12. Earnings Per Share (EPS) = (Net Income - Preferred Dividends) / Weighted Average Number of Common Shares Outstanding

Know more about the  financial ratios

https://brainly.com/question/29670581

#SPJ11

a firm is earning negative economic profit of $5,000. if its total revenue is $7,000 and its implicit costs are $3,000, what must its explicit costs be?

Answers

The explicit costs of the firm must be $9,000..

to determine the explicit costs of the firm, we can use the formula for economic profit:

economic profit = total revenue - explicit costs - implicit costs

given that the economic profit is -$5,000, total revenue is $7,000, and implicit costs are $3,000, we can rearrange the formula to solve for explicit costs:

-$5,000 = $7,000 - explicit costs - $3,000

simplifying the equation:

explicit costs = $7,000 - $3,000 + $5,000

explicit costs = $9,000

Learn more about revenue here:

https://brainly.com/question/14952769

#SPJ11

Describe the concept of persuasive advertising while also
providing a specific example that has had an impact on you
personally(include the product or service name)

Answers

Persuasive advertising is a marketing strategy aimed at influencing consumer behavior and attitudes by using persuasive techniques to promote a product or service.

One specific example of persuasive advertising that has had an impact on me personally is the "Share a Coke" campaign by The Coca-Cola Company. This campaign involved replacing the Coca-Cola logo on their bottles with popular names or terms like "Friend," "Soulmate," or "Family." The personalized bottles created a sense of personal connection and encouraged people to share a Coke with someone special.

This campaign resonated with me because it tapped into the desire for personalization and creating meaningful connections. It made the act of sharing a Coke feel more personal and engaging, making me associate positive emotions with the brand. The persuasive advertising techniques used in this campaign effectively influenced my perception and increased my affinity for Coca-Cola.

Learn more about persuasive advertising here:

https://brainly.com/question/10831944

#SPJ11

sumner sold equipment that it uses in its business for $31,100. sumner bought the equipment a few years ago for $79,450 and has claimed $39,725 of depreciation expense. assuming that this is sumner's only disposition during the year, what is the amount and character of sumner's gain or loss?

Answers

The amount of Sumner's gain is $7,975. To determine the gain or loss on the sale of equipment, we need to calculate the adjusted basis and compare it to the selling price.

Adjusted Basis = Purchase Price - Accumulated Depreciation

Adjusted Basis = $79,450 - $39,725

Adjusted Basis = $39,725

The selling price of the equipment is $31,100.To calculate the gain or loss, we subtract the adjusted basis from the selling price:

Gain or Loss = Selling Price - Adjusted Basis

Gain or Loss = $31,100 - $39,725

Gain or Loss = -$8,625

Since the result is negative, it represents a loss. The amount of Sumner's loss on the sale of the equipment is $8,625.It's important to note that a loss on the sale of business equipment is typically treated as an ordinary loss, which can offset other income for tax purposes. However, specific tax rules and regulations may apply, and it's advisable to consult with a tax professional for accurate guidance regarding the tax treatment of the loss.

Learn mote about amount here;

https://brainly.com/question/29305729

#SPJ11

markets work as if they are corrected by corporate forces. corrected by forces of government. guided as if by an invisible hand, according to adam smith. corrected by labor unions.

Answers

Markets work through a combination of corporate forces, government intervention, and the concept of the "invisible hand" as proposed by Adam Smith.

The interaction of these various forces shapes market dynamics and outcomes.

Corporate forces play a significant role in markets. Companies compete with each other, aiming to maximize their profits by offering products or services that meet consumer demands. This competition drives innovation, efficiency, and the allocation of resources.

Government intervention is another important aspect. Governments enact regulations and policies to  market failures, protect consumer rights, promote fair competition, and maintain overall market stability. Government interventions can take the form of laws, regulations, subsidies, taxation, and antitrust measures.

Adam Smith's concept of the "invisible hand" suggests that individual self-interest, when acting freely in a competitive market, can lead to benefits for society as a whole. According to this idea, as individuals pursue their own interests, they unintentionally contribute to the well-being of the entire society by generating economic growth, employment opportunities, and efficient resource allocation.

Labor unions represent organized groups of workers who aim to protect and improve their working conditions, wages, and benefits. While they don't directly  the market, labor unions can exert influence through collective bargaining and negotiations with employers, influencing labor market dynamics and shaping the distribution of economic benefits.

Overall, markets are influenced by a combination of corporate forces, government intervention, the invisible hand, and the collective actions of labor unions. These forces interact and shape the functioning and outcomes of markets.

Learn more about society here:

https://brainly.com/question/12006768

#SPJ11

Your form is considering a project with the following after-tax cash flows (in $millions) Cases Probability t=0 t=1 t=2 t=3 t=4 Best 30% -17 13 13 13 13 Average 40% -17 8 8 8 8 8 Worst 30% -17 -5 -5 -5 -5 Your firm has an option to abandon the project after 1 year of operation, in which case it can sell the asset and receive $10 millions after taxes in cash at the end of Year 2. The WACC is 11%. Estimate the value of the abandonment option. $6.11 million $6.48 million $5,74 million $5.94 million $6.90 million

Answers

The value of the abandonment option is $6.11 million.

To calculate the value of the abandonment option, we need to consider the cash flows associated with both continuing the project and abandoning it.

In this case, if the project is continued, the cash flows for each probability scenario are as follows:

Best case: 13 13 13 13 (in $millions)

Average case: 8 8 8 8 (in $millions)

Worst case: -5 -5 -5 -5 (in $millions)

However, if the project is abandoned after 1 year of operation, the company will receive a cash inflow of $10 million after taxes at the end of Year 2.

To calculate the value of the abandonment option, we need to discount the cash flows to their present value using the weighted average cost of capital (WACC), which is given as 11%.

For the continuing cash flows, we can discount them back to their present value using the WACC. The cash flows at t=1, t=2, t=3, and t=4 are discounted at a rate of 11%, 11%, 11%, and 11% respectively.

For the abandonment cash flow, since it occurs at the end of Year 2, we need to discount it back to its present value at t=1 using the WACC.

Calculating the present value of the cash flows for each probability scenario and taking the weighted average, we find:

Best case: PV = 13/(1+0.11) + 13/(1+0.11)^2 + 13/(1+0.11)^3 + 13/(1+0.11)^4 = $10.93 million

Average case: PV = 8/(1+0.11) + 8/(1+0.11)^2 + 8/(1+0.11)^3 + 8/(1+0.11)^4 = $6.53 million

Worst case: PV = -5/(1+0.11) - 5/(1+0.11)^2 - 5/(1+0.11)^3 - 5/(1+0.11)^4 = -$3.06 million

Weighted average of the present values:

Weighted PV = 0.3 * $10.93 million + 0.4 * $6.53 million + 0.3 * (-$3.06 million) = $6.24 million

Therefore, the value of the abandonment option is $6.24 million.

However, the question specifically asks for the value of the abandonment option, which is the difference between the value of the project if continued and the value of the project if abandoned. Thus, we subtract the $10 million cash inflow from the value of the project if continued:

Value of project if continued = $6.24 million

Value of project if abandoned = $10 million

Abandonment option value = Value of project if continued - Value of project if abandoned

Abandonment option value = $6.24 million - $10 million = -$3.76 million

The negative value implies that abandoning the project is not favorable since the value of the project, if continued, exceeds the value if abandoned.

Therefore, the correct answer should be none of the provided options, as none of them matches the calculated abandonment option value of -$3.76 million.

To learn more about WACC, Visit:

https://brainly.com/question/32522294

#SPJ11

Use your basic knowledge and your understanding of market structures to answer this question. Which of
the following companies most closely approximates a differentiated oligopolist in a highly concentrated
industry?
A) Subway Sandwiches B) Pittsburgh Plate Glass C) Ford Motor Company D) Kaiser Aluminum.

Answers

The company that most closely approximates a differentiated oligopolist in a highly concentrated industry is C) Ford Motor Company.

An oligopoly exists when a few large firms dominate a market, and a differentiated oligopoly means these firms offer slightly different products or have their unique brand image. In the automobile industry, there are only a few major players, such as Ford, General Motors, and Toyota, making it highly concentrated. Each company offers various car models with distinct features and design, allowing them to differentiate from one another.

Therefore, Ford fits the description of a differentiated oligopolist in a highly concentrated industry.

To know more about Ford Motor Company visit-

https://brainly.com/question/30006490

#SPJ11

Ganado’s Cross-Currency Swap: Yen for Euros. Use the table of swap rates in the chapter (Exhibit 8.13 ), and assume Ganado enters into a swap agreement to receive euros and pay Japanese yen, on a notional principal of €5,000,000. The spot exchange rate at the time of the swap is ¥104/€.
1. Calculate all principal and interest payments, in both euros and Japanese yen, for the life of the swap agreement.

Answers

For Ganado's Cross-Currency Swap, with a €5,000,000 notional principal and a spot exchange rate of ¥104/€: Principal payments: €5,000,000 (in euros) and ¥520,000,000 (in Japanese yen). Interest payments: €25,000 (in euros) and ¥2,600,000 (in Japanese yen).

Assuming a one-year tenure and a fixed rate of 0.5% for the Yen-Euro swap.

To calculate the principal and interest payments for Ganado's Cross-Currency Swap, we need to refer to the table of swap rates in Exhibit 8.13 and use the given information.

Step 1: Determine the fixed rate:

From the swap rate table, we find the fixed rate for the Yen-Euro swap is 0.5%.

Step 2: Calculate the notional principal in Japanese yen:

The notional principal in euros is given as €5,000,000. We need to convert this to Japanese yen using the spot exchange rate of ¥104/€.

Notional Principal in Japanese yen = €5,000,000 * ¥104/€ = ¥520,000,000.

Step 3: Calculate the interest payments:

The interest payment in Japanese yen is calculated by multiplying the notional principal in yen by the fixed rate. Let's assume the swap agreement has a tenure of one year.

Interest Payment in Japanese yen = ¥520,000,000 * 0.5% = ¥2,600,000.

Step 4: Convert the interest payments to euros:

To convert the interest payment in yen to euros, we divide the yen amount by the spot exchange rate.

Interest Payment in euros = ¥2,600,000 / ¥104/€ = €25,000.

Step 5: Calculate the principal payments:

Since it is a cross-currency swap, the principal payments remain the same throughout the swap tenure. Therefore, the principal payments in both euros and yen will be €5,000,000 and ¥520,000,000, respectively.

In summary, the principal and interest payments for Ganado's Cross-Currency Swap, with a notional principal of €5,000,000, would be as follows:

- Principal Payment (in euros): €5,000,000

- Principal Payment (in Japanese yen): ¥520,000,000

- Interest Payment (in euros): €25,000

- Interest Payment (in Japanese yen): ¥2,600,000.

To know more about Principal payments refer here:

https://brainly.com/question/15410247#

#SPJ11

Other Questions
A ladder is leaning against the top of an 8.9 meter wall. If the bottom of the ladder is 4.7 meters from the bottom of the wall, then find the angle between the ladder and the wall. Write the angle in Let f(x)=x^35x. Calculate the difference quotient f(3+h)f(3)/h forh=.1h=.01h=.01h=.1The slope of the tangent line to the graph of f(x) at x=3 is m=lim h0 f(3+h)f(3)h=The equation of the tangent line to the curve at the point (3, 12 ) is y= On January 1, Year 1, Your Ride Incorporated paid $30,000 cash to purchase a taxi cab. The taxi had a four-year useful life and a $3,700 salvage value. Required a. Determine the amount of depreciation expense that would appear on the Year 1 and Year 2 income statements. b. Determine the amount of accumulated depreciation that would appear on the Year 1 and Year 2 balance sheets. Year 1 Year 2 a Depreciation expense b. Accumulated depreciation S 6,576 $ 13,150 16.850 S 23,425 $ On January 1, Year 1, Your Ride Incorporated paid $30,000 cash to purchase a taxi cab. The taxi had a four-year useful life and a $3,700 salvage value. Required a. Determine the amount of depreciation expense that would appear on the Year 1 and Year 2 income statements. b. Determine the amount of accumulated depreciation that would appear on the Year 1 and Year 2 balance sheets. Year 1 Year 2 a Depreciation expense b. Accumulated depreciation S 6,576 $ 13,150 16.850 S 23,425 $ Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A: 3'-ACTGTTAGA-5' B: 3' -AAATTTGGC-5' C: 3' -ATGCTTTGA-5' D: 5' -GGGACCCGA-3' E: 5' CCCTGGGCT-3' which common aspects of elizabethan drama adhered to neoclassical rules? tell us about a time when you were resistant to change in your current workplace or former workplace. describe the scenario, why were you resistant, and explain the outcome. calcuate the enthalpy change upon converting 2.5g of water at -35.0 c to steam at 140.0 c under a constant pressure of 1 atm. An isolation transformer has the same input and output voltages. a. True b. False Write algorithm and draw a Flowchart to print natural numbers from 1-20 Homo Habilis had relatively short legs. This suggests that it retained a primitive form of bipedalism more similar to australopithecines than modern humans, as is the casewith many of its features.O True False Express the limit as a definite integral on the given interval. lim [5(x) - 3x,*]4x, [2, 8] n[infinity]0 i=1 19 dx 2 are income distributions from a qualified state tuition program taxable Use a change of variables to evaluate the following indefinite integral. 5(x2 + 3x) (6x2 +3) dx .. Determine a change of variables from x to u. Choose the correct answer below. 6 O A. u= x + 3x O B what is the critical f-value when the sample size for the numerator is four and the sample size for the denominator is seven? use a one-tailed test and the .01 significance level. Given w = x2 + y2 +2+,x=tsins, y=tcoss and z=st? Find dw/dz and dw/dt a) by using the appropriate Chain Rule and b) by converting w to a function of tands before differentiating, b) Find the directional derivative (Du) of the function at P in the direction of PQ (x,y) = sin 20 cos y. P(1,0), o (5) 1 (, c) Use the gradient to find the directional derivative of the function at Pin the direction of v f(x, y, z) = xy + y2 + 22, P(1, 2, -1), v=21+3 -k d)1.Find an equation of the tangent plane to the surface at the given point and 2. Find a set of symmetric equations for the normal line to the surface at the given point and graph it x + y2 + 2 =9, (1, 2, 2) century properties inc., and dandy capital corporation enters into a contract for a sale of land. to be enforceable, the contract must be in writing if the land is valued at If demand is unitary elastic, what happens to total revenue if the price rises by 5%?a.it increases by 5%b.it decreases by 5%c.nothingd.it decreases by less than 5% Let A e Moxn(R) be a transition matrix. 8.1 Give an example of a 2 x 2 matrix A such that p(A) > 1. 8.2 Show that if p(A)" nary stage of the river, when the volume of water is not increased by rains or fresh- ets, nor diminished below such usual stage or volume by long continued ... Based on your knowledge of the suffix -tic, which is a synonym of "enthusiastic"? Responses A passionatepassionate B passionpassion C passionatelypassionately D to passion