Given f(x) = 2x2 + 4x - 3 and g(x) = 5x - 2, find f(x) + g(x).
Must show all work to receive credit! Show your work in the box below.

Given F(x) = 2x2 + 4x - 3 And G(x) = 5x - 2, Find F(x) + G(x).Must Show All Work To Receive Credit! Show

Answers

Answer 1

Answer:

9x-3

Step-by-step explanation:

2x2=4

4+4x-3

4x-1

5x-2

Add them together

4x-1+5x-2= 9x-3


Related Questions

Selecting which is the digit six is 10 times the value of the digit six in 3.161

Answers

Step-by-step explanation:

All the answers which apply are D and F

Answer:

I think it is d but I am now overthinking it so don't put too much trust in that

What is the ones digit of 5120 + 2301 + 456?

Answers

Answer:

7

Step-by-step explanation:

Easier than you think. You do not have to add the numbers together to find your answer. You can just add 0+1+6, and you will get 7.

Answer:

7

Step-by-step explanation:

5120+2301=7421

7421+456=7877

Last # is 7

Becky read 10 books in 4 days.Sarah reads 50 books in 20 days. Are the two girls reading at the same rate

Answers

Yes,
10 x 5 = 50
4 x 5 = 20
They both have equal multiples.

x2 + 5x +4=0
How do we do this

Answers

Answer: x=−1 or x=−4

Step-by-step explanation: Solve by factoring

Answer:

(x+1)(x+4)

Step-by-step explanation:

Solve the equation and describe what your answer. What happens? 5x-7=2x+1+3x

Answers

You combined like terms

Answer: The Answer is 0

Step-by-step explanation:

The key here is combining like terms. Here:

1) 5x-7=2x+1+3x

2) 5x-7=5x+1

Then you add 7 to both sides anywhere that there is no variable. You also subtract 5x to the other 5x

3) 0x=8

When you divide by zero on both sides, your answer should be 0

How long would 8 thousand trillion trillion trillion trillion trillion trillion trillion trillion years be if typed out?

Answers

Answer:

100 digits

Step-by-step explanation:

One trillion is 10¹², so it adds 12 zeros.

8000 adds 4 digits.

8 trillions add 8·12 = 96 zeros.

So in total you have 96+4 = 100 digits

This number would also be called 8 googol, since 1 googol is 10¹⁰⁰

After simplifying the following expression, the coefficient of the m^2 term will be ______.
6mn^2 + 3m^2 + 16m^2 - 6m^2 - 5nm^2
The solution is ______

Answers

Answers:

After simplifying the following expression, the coefficient of the m^2 term will be  13  

The solution is  13m^2 + 6mn^2 - 5nm^2  

====================================================

Explanation:

Highlight all the terms that have m^2 in them and nothing else (so that means no variables of n or n^2)

You should highlight 3m^2, 16m^2 and -6m^2 as the three terms.

The coefficients 3, 16 and -6 combine to 3+16-6 = 13

Meaning that 3m^2+16m^2-6m^2 = 13m^2

----------------

There are no other like terms that pair up.

The 6mn^2 and -5nm^2 are different because the exponent 2 is over a different letter each time. Put another way: mn^2 is not the same as nm^2

So we cannot combine 6mn^2-5nm^2. We leave it as is.

Overall, the entire expression simplifies to 13m^2 + 6mn^2 - 5nm^2

Help?!
I dont understand this Help?!

Answers

Use the equation form the last question to answer how many it would cost to do 30 hours

1+1 pls, help, I will give you brainliest answer!!! just hellllllp!!!!!​

Answers

Answer:

2!!!

Step-by-step explanation:

PLS GIVE BRAINLIEST

Answer:

1+1=2

Step-by-step explanation:

Brainliest please!

what is the equation of aline that passes through the point (4,-8) and has a slope of -1/2?

Answers

Answer:

The equation of the line will be:

[tex]y=-\frac{1}{2}x-6[/tex]

Step-by-step explanation:

Given

slope = m = -1/2point (4, -8)

Point slope form:

[tex]y-y_1=m\left(x-x_1\right)[/tex]

substituting the values m = -1/2 and the point (4,-8)

[tex]y-\left(-8\right)=\frac{-1}{2}\left(x-4\right)[/tex]

[tex]y+8=\frac{-1}{2}\left(x-4\right)[/tex]

subtract 8 from both sides

[tex]y+8-8=\frac{-1}{2}\left(x-4\right)-8[/tex]

[tex]y=-\frac{1}{2}x-6[/tex]

Therefore, the equation of the line will be:

[tex]y=-\frac{1}{2}x-6[/tex]

Please help I’m stuck on this question

Answers

Answer:

C. a => c

Step-by-step explanation:

       a                          b                           c                a => b          a => c (not C)

       0                          0                        0                    

       0                           0                        1                    

       0                          1                         0                    

        0                           1                         1                                          

        1                         0                          0                     F                  F

         1                        0                          1                      F                  

         1                        1                           0                                         F

          1                       1                          1

¬a                          b                           c                a => b          ¬a => c (not B)

       1                          0                        0                  F                  F

       1                           0                        1                  F  

       1                          1                         0                                       F

        1                           1                         1                                          

        0                         0                          0                                      

        0                        0                          1                                        

         0                        1                           0                                        

          0                       1                          1

a                          b                           c                a => b          c => a (not D)

       0                          0                        0                                        

       0                           0                        1                                            F

       0                          1                         0                    

        0                           1                         1                                           F

        1                         0                          0                     F                  

         1                        0                          1                      F                  

         1                        1                           0                                        

          1                       1                          1

¬a                          b                           ¬c                a => b          ¬a => ¬c

       1                          0                        1                                          

       1                           0                        0                                         F

       1                          1                         1                                      

        1                           1                         0                                        F

        0                         0                          1                 F                      

        0                        0                          0                 F                      

         0                        1                           1                                        

          0                       1                          0

answer: everything is false lol


[tex](a) { - (b)}^{2} [/tex]

Answers

Answer:

 a - b2

Step-by-step explanation:

STEP  1 :

Trying to factor as a Difference of Squares:

1.1      Factoring:  a-b2  

Theory : A difference of two perfect squares,  A2 - B2  can be factored into  (A+B) • (A-B)

Proof :  (A+B) • (A-B) =

        A2 - AB + BA - B2 =

        A2 - AB + AB - B2 =

        A2 - B2

Note :  AB = BA is the commutative property of multiplication.

Note :  - AB + AB equals zero and is therefore eliminated from the expression.

Check :  a1   is not a square !!

Ruling : Binomial can not be factored as the difference of two perfect squares

Final result :

 a - b2

HOPE THIS HELPS!

PLEASE MARK BRAINLIEST! :)

Write the equation of the line that is parallel to the line y = -3x + 12 and passes through the point (-1, 6). (2 points)

Answers

Answer:

x=−9. Explanation: x=12 is a line parallel to the y-axis passing through all points in the plane with an x-coordinate of 12. therefore a line ...

x=−9 Explanation: x=12 is a line parallel to the y-axis passing through all points in the plane with an x-coordinate of 12 therefore a line parallel ... More

What is the slops of this line? Enter your answer as a fraction in simplest term in the box.

Answers

The slope is 1/4 cause it goes up 1 and right 4 meaning slope=1/4

Answer:

It is 1/4

Step-by-step explanation:

If you go from dot to dot on the line, starting with the first dot:

you go to the right 4 times and then up 1 to get to the next dot.

If you put that into a fraction it is [tex]\frac{rise}{run}[/tex] so going up (1) is ontop of going to the right (4), which is 1/4.

Are these two triangles congruent? Use tracing paper to justify your answer

Answers

Answer:

no

Step-by-step explanation:

Answer:

Where's the pic shorty

Step-by-step explanation:

????????

Martinez bought 8 3/4 yd of fabric. She wants to make a skirt using 1 7/8 yd, pants using 2 3/8, and a vest using 1 2/3 yd. how much fabric will be left over?
Please help ASAP!!! :(

Answers

Answer:

The fabric left over will be [tex]2\frac{5}{6}[/tex]

Step-by-step explanation:

Total fabric bought= [tex]8\frac{3}{4} \ yd[/tex]

Fabric used for skirt = [tex]1\frac{7}{8} \ yd[/tex]

Fabric used for pants = [tex]2\frac{3}{8} \ yd[/tex]

Fabric used for vest = [tex]1\frac{2}{3} \ yd[/tex]

Total fabric used = Fabric used for skirt+Fabric used for pants+Fabric used for vest

Total fabric used=[tex]1\frac{7}{8}+2\frac{3}{8}+1\frac{2}{3}[/tex]

[tex]=\frac{15}{8}+\frac{19}{8}+\frac{5}{3}\\=\frac{15*3+19*3+5*8}{24}\\=\frac{45+57+40}{24}\\=\frac{142}{24} \\=\frac{71}{12}[/tex]

So, Total fabric used = [tex]\frac{71}{12}[/tex]

Total Fabric left= Total fabric bought-Total fabric used

Total Fabric left=[tex]8\frac{3}{4}-\frac{71}{12}[/tex]

[tex]=\frac{35}{4}-\frac{71}{12}\\=\frac{35*3-71}{12} \\=\frac{105-71}{12}\\=\frac{34}{12}\\=\frac{17}{6}\\=2\frac{5}{6}[/tex]

So, the fabric left over will be [tex]2\frac{5}{6}[/tex]


DECA is putting in a t-shirt order for the school. At the Nike store you can get 3 t-shirts for $25.00. At the
Adidas store you can get 4 t-shirts for $29.00. At the Under Armour store you can get 5 t-shirts for $36.00. At
which store would the school get the better deal?

Answers

Answer:

Under Armour store you can get a better deal.

Step-by-step explanation:

25/3=8.33

29/4=7.25

36/5=7.2

Answer this please thanks

Answers

Answer:

No

Step-by-step explanation:

The first 3 boxes are proportional since they have a ratio of 1:3, but 6:21 is not proportional to the others.

Answer:

No it is not proportional.

Step-by-step explanation:

This is not proportional because

2 times 3 = 6

4 times 3 = 12

8 times 3 =  24

but,

6 times 3 = 18 not 21 so it is not proportional.

Hope this helped! Ask me any questions if needed!

con las medidas de los lados 8cm , 9cm ,2cm se existe un triángulo ?

Answers

Answer:

si

Step-by-step explanation:

la longitud mayor es menor que la suma de las otras 2 longitudes que es 10

Please help I’m stuck on this question

Answers

the answer is b. the rest is so it can be enough charecters so i can post this answer

if 5x+2y=20 and y=10, what is 3x?​

Answers

Answer:

3x = 0

Step-by-step explanation:

Given,

y = 10

now,

5x+2y = 20

or, 5x+2×10=20

or, 5x = 20-20

or, 5x = 0

or, x = 0/5

or, x = 0

Again,

3x = 3×0 =0

When two data sets are compared, what characteristics will give the most accurate prediction? Explain.

Answers

Answer:

If the trend line of scatterplots for two data sets are compared, the one more likely to provide an accurate prediction is the one with the stronger correlation.

Step-by-step explanation:

Answer:

If the trend line of scatterplots for two data sets are compared, the one more likely to provide an accurate prediction is the one with the stronger correlation.

Step-by-step explanation:

correct on edge

Celeste wants to have her hair cut and
permed and also go to lunch. She knows
she will need $95. The perm costs twice
as much as her haircut and she needs $5
for lunch.
How much does the perm cost?

Answers

Answer:

the perm will cost $60

Step-by-step explanation:

take away $5 from the total because Its a set amount that's already known

which leaves 90 which if you  take 30 away you are left with 60 its twice the amount of the haircut, I didn't really do any math techniques so I'm sorry that my explanation is weird, I hope this helped

Write an equation and solve. Round to the nearest hundredth where necessary. What is 35% of 63?

Answers

22.05

35/100=.35 .35x63=22.05

A sonographer is trying to determine the size of a gallstone. If
the stone is spherical and has a diameter of 12 millimeters, what
Is its volume?

Answers

Answer:

0.9 cubic centimeters

Step-by-step explanation:

does anyone like 4freakshow if so start a convo in comments 11-16 pleasee

Answers

Answer:

mhm

Step-by-step explanation:

Answer:

Bet

Step-by-step explanation:

In circle K with \text{m} \angle JKL= 138^{\circ}m∠JKL=138

, find the angle measure of minor arc \stackrel{\Large \frown}{JL}.
JL

.

Answers

^ what they saidddddddddddddddddd

(1, -7) slope = -1 writing linear equations given point and slope

Answers

Answer:

The answer is

[tex] \huge y = - x - 6[/tex]

Step-by-step explanation:

To find an equation of a line when given the slope and a point we use the formula

[tex]y - y_1 = m(x - x_1)[/tex]

From the question we have

[tex]y + 7 = - 1(x - 1) \\ y + 7 = - x + 1 \\ y = - x + 1 - 7[/tex]

We have the final answer as

[tex]y = - x - 6[/tex]

Hope this helps you

An annual pass to a park costs $120. Use a percent model to find 200% of the full price of the annual pass.

200% of the full price is $____

Answers

Given:

An annual pass to a park costs $120.

To find:

The 200% of the full price using percent model.

Solution:

In the percent model,

100% = 1 box

It means 1 box represents park costs $120.

200% = 2 box

[tex]120+120=240[/tex]

It means 2 box represents park costs $240.

Therefore, 200% of the full price is $240.

I will give branliest to the first person to answer!
Simplify the following expressions
Please include the work its greatly appriciated!
1. 8x - 5 + 2x
2. 2.5w - 3y + 4w
3. 3(5 - 2n) + 9n
4. 5/7x + 15 = 9/14x - 9

Answers

Answer:

1: 10x-5

2: 6.5w-3y

3: 15+3n

4: not sure

Other Questions
what would you do when you grow up?*Career* And explain why! During a formal group discussion, participants should be prepared toO lead the conversation and prompt others to speak. O persuade others to agree with their viewpoint. O interrupt other speakers when necessary. O take turns both listening and speaking. This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive How do you do this question? Abdul made $252 for 12 hours of work.At the same rate,how many hours would he have to work to make $105 XYZ Corporation, whose common stock is currently selling for $40 per share, is having a rights offering. The terms of the offering require 10 rights plus $35 to subscribe to one share of stock. Compute the theoretical value of a right before the ex-rights date. Est ce que quelqu'un pourrait bien corriger mon expression ecrite ou donner son avie dessus s'il vous plait A $10,000 bond with 18%/year, compounded semi-annually (interest is paid every six month) is available in the market. The bond matures in 10 years. The closest PW of this bond if the purchaser can earn 12%/year, compounded quarterly is:_____. My annoying brother likes to drive me crazy. There is no other who is that lazy. He whines to my mom night and day, until eventually gets his way. What is a sister to do, when he screams til he's blue? There is no way to win, for he gets under your skin. He does his best to kill all joy. Oh, how my brother does annoy! What is the tone of the poem PLZ HELP!!!Will mark brainliest44. Show that the quadrilateral with vertices A(0,0), B(a,0), C(a + b, c) and D(b, c) is a parallelogram. hehe i need help with the whole quiz basically:IFind the decimal that is equivalent to: A. 1.714 B. 0.583 C. 0.0583 D. 6. Another engine reaches its top speed from rest in 7.5 s. It is able to perform 250,000 J of wok inthat time How much power does this engine have in that time? The Yellow River is often called the cradle of Chinese civilization. It was along the banks of the Yellow River where the Chinese civilization first formed. The Yellow River is 3,395 miles long, making it the sixth longest river in the world. It is also called the Huang He River.Early Chinese farmers built small villages along the Yellow River. The rich yellow-colored soil was good for growing a grain called millet. The farmers of this area also raised sheep and cattle. Ancient China: Geography,Ken NelsonUsing context clues, which statement best defines the phrase "cradle of Chinese civilization?the place where the longest river in China startsthe place where most people in ancient China livedthe place where people in China began a farming culturethe only place in ancient China where people could farm What is an accurate statement about many of the first Africans to come to Louisiana?They came voluntarily.They were skilled laborers. They came in search of domestic work. They knew how to grow crops. Carter was given a box of assorted chocolates for his birthday. Each night, Carter treated himself to some chocolates. Carter ate 5 chocolates each night and there were originally 30 chocolates in the box. Write an equation for C,C, in terms of t,t, representing the number of chocolates remaining in the box tt days after Carter's birthday. When a space shuttle was launched, the astronauts on board experienced an acceleration of 29.0 m/s2. If one of the astronauts had a mass of 60.0 kg, what net force in Newtons did the astronaut experience?