Choose the correctly punctuated sentence. On the display screen, was a soothing pattern of light and shadow. After the morning rains cease, the swimmers emerge from their cottages. Some first-year architecture students, expect to design intricate structures immediately. Shade-loving plants such as, begonias, impatiens, and coleus can add color to a shady garden.

Answers

Answer 1

Answer:

The sentence that is correctly punctuated is:

After the morning rains cease, the swimmers emerge from their cottages.

Explanation:

Let's look at each sentence individually to find the problems.

1. On the display screen, was a soothing pattern of light and shadow. --> The comma is separating the subject and the verb, which should never be done. This sentence is INCORRECT.

2. After the morning rains cease, the swimmers emerge from their cottages. --> This sentence is CORRECT. The comma is separating the ideas expressed in the different clauses.

3. Some first-year architecture students, expect to design intricate structures immediately. --> Again, we have a comma separating the subject and the verb. This is INCORRECT

4. Shade-loving plants such as, begonias, impatiens, and coleus can add color to a shady garden. --> When using "such as", we should not place a comma right before the first item to be listed. Therefore, there shouldn't be a comma before "begonias". This is INCORRECT


Related Questions

Using the chart below, match the event to the era in which it occurred.



Column A
1.
Dinosaurs roamed the Earth:
Dinosaurs roamed the Earth
2.
Trilobites were one of the most dominant species:
Trilobites were one of the most dominant species
3.
The era we currently live in:
The era we currently live in
Column B
a.Mesozoic
b.Cenozoic
c.Phanerozoic
d.Paleozoic

Answers

Answer:

1a

2d

3b

Explanation:

just make a conversation. but if i find arguing or bullying to people thats different were gonna have a problem.

Answers

Answer:

hello can i bee ur friend

Explanation:

Answer:

Just make a conversation okay... umm I have 7 dogs 1 bunny 4 fish 1 horse and 1 guinea pig what do you have

Explanation:

The names are

corgi 1. Kyzercorgi 2. Elviscorgi 3.Bellacorgi 4. Rosko/chickencorgi 5. Wilsoncorgi 6. AbigailBelgian malinois 1. SoldierFish are- Gilburt, bubbles, Mr. bubbles, bobBunny- Thumperhorse- heaven guinea pig- Nugget

What does it mean to DROP a quote or ANCHOR a quote? What's the difference ?

Answers

Answer: ancho-r the quote is to- have supporting detail-s and a claim yo-ur detail-s,

and dropping a quote is are lines or passages from the text that stand alone as sentences, or are spliced into sentences in a grammatically incorrect manner.

Explanation: so-rry it to-o-k so- l-o-ng my pc has been giving me tro-ubl-e it keeps putting uncal-l- fo-r dashes in my sentences and makes it hard to- read so- i was making so-me edits to- that

Explanation:

dropping a quote is just to drop it in without stating who said it for example "The way to get started is to quit talking and begin doing."  

To anchor a quote you need to state who did it for "The way to get started is to quit talking and begin doing." -Walt Disney

Suppose the moral dilemma of "The Book of Martha" remained the same, but the theme was that people should

collaborate on difficult decisions. What would Martha mostly likely do that would shape this alternate theme?

She would refuse to make a decision and ask God to choose another person.

O She would consider how her ideas on population growth would affect others.

She would ask to return home and talk with others about whether her experiences were real.

She would ask God to choose other people to work with to make a decision.

Answers

Answer:

She would ask God to choose other people to work with to make a decision.

Explanation:

“The Book of Martha” is a narration about creating an utopian world and Martha is chosen by God to help people be less destructive and even though she is skeptical at first, she goes to work and begins to make plans that would help humanity attain perfection.

Therefore, if the moral dilemma of "The Book of Martha" remained the same, but the theme was that people should collaborate on difficult decisions, Martha would have to ask God to choose other people to work with to make a decision.

This makes the most sense because she is tasked with helping people work together to create solution to difficult problems.

In this response, you are to choose at least one of the readings from the Unit and write about the rites of passage that the individual in the selection confronts. You are to include names of characters as well as specific details from the text to support your claim. What this means is that you are to write about the challenges the characters faced and how they overcame those challenges.

Answers

Answer:

What book did you choose?

Explanation:

In this response, you are to choose at least one of the readings from the Unit and write about the rites of passage that the individual in the selection confronts. You are to include names of characters as well as specific details from the text to support your claim. What this means is that you are to write about the challenges the characters faced and how they overcame those challenges.

In Monster, which statement best supports the idea that Mr. Sawicki's opinion of Steve is valid?

Answers

I think that the awnser to this is the 4th one. Because if you know someone for a long time you get to know them as a person.

Answer:

d

Explanation:

I took the test

Hello, please help I will give brainliest!

Answers

The correct answer is b

what type of figurative language
he kept his eyes on the rocky peaks that jutted into the sky like jagged shark's teeth
.simle
.metaphor

Answers

Answer:

Simile

Explanation:

The author uses "like" to compare the rocky peaks to shark's teeth. The use of the word "like" makes it a simile.

Answer:

It would be a simile.

Explanation:

A simile is a figure of speech involving the comparison of one thing with another thing of a different kind, and that is used in the sentence. Comparing the rocky peaks to the jagged shark's teeth.

No way it would be a metaphor since everything is applicable in this sentence.

Read the excerpt from The Strange Case of Dr. Jekyll and Mr. Hyde. Round the corner from the by-street, there was a square of ancient, handsome houses, now for the most part decayed from their high estate and let in flats and chambers to all sorts and conditions of men; map-engravers, architects, shady lawyers and the agents of obscure enterprises. One house, however, second from the corner, was still occupied entire . . . In what way is this setting characteristic of gothic fiction? The homes have deteriorated from their original grandness. The street is busy with the activity of local traders. The homes have been transformed into places of business. The street is renowned for its wealthy occupants.

Answers

Answer:

The homes have deteriorated from their original grandness.

Explanation:

It is noteworthy that we are told in the excerpt that, "there was a square of ancient, handsome houses, now, for the most part, decayed from their high estate.."

This statement about the houses losing their grandness is similar to gothic fiction which often includes stories about ancient architectural styles.

Answer:

A) The homes have deteriorated from their original grandness

Whats a good police brutality thesis statement ?

Answers

The killing of George Floyd by a Minneapolis police officer is yet another tragic chapter in the long, sad history of lethal violence meted out to African Americans. This act of police brutality, a contemporary manifestation of the historically unfair and racist treatment of Black people by law enforcement and the criminal justice system, has sent people to the streets once more in protest, demanding to right this systemic wrong.

story : conformity
question: Read this sentence from paragraph 5.
" Sadly, the teacher died unexpectedly, and my mother's
dreams had to be buried as well. "
In this sentence, the author uses figurative language to indicate that -
F. her grandfather had an alternative plan for her mother
G. her mother lost interest in life
H. there was no other teacher to educate the girls
J. her mother did not care about becoming a midwife

Answers

I think is G hope it helps

In mother to son, why does the author use I'se, ain't, and climbin' in the story?

Answers

Answer:

Maybe because their southern? He grew up talking that way?

Explanation:

Sorry if that isn't what you'er looking for

HAPPY THXGIVING!!!

plz help I'll mark brainilest ​

Answers

1. Is
2. Looks
3.feels
4.is
5.was

Answer:

number 6 linking verb is amazing,

number 7 is heavier

number 8 is warmer

number 9 is best

number 10 is last..

Explanation:

i hoped this helped :) i tried..:(

Read the excerpt from the Speech of Chief Joseph of the Nez Percé Indians, in Washington, D.C. (1879). I have heard talk and talk, but nothing is done. Good words do not last long unless they amount to something. Words do not pay for my dead people. They do not pay for my country, now overrun by white men. . . . Good words will not get my people a home where they can live in peace and take care of themselves. I am tired of talk that comes to nothing. It makes my heart sick when I remember all the . . . broken promises. . . . If the white man wants to live in peace with the Indian he can live in peace. There need be no trouble. Treat all men alike. Give them the same law. Give them all an even chance to live and grow. All men were made by the same Great Spirit Chief. They are all brothers. What are Chief Joseph’s complaints about the treatment of his people?

Answers

Answer:

Despite his view that all men are brothers, the white men do not treat Indians as equals. The white men do not keep their word to his men.

Explanation:

According to the excerpt from the Speech of Chief Joseph of the Nez Percé Indians, in Washington, D.C. (1879), Chief Justice is disappointed with the way the white men treat his people and how they have been killed, their homes rendered uninhabitable, bitterness and strife and how they whites treats the Indians less than humans.

Chief Joseph's complaints about his people are that the white man fails to treat the Indians equal and steal their lands, kill the men, leaving the women widows and children fatherless.

Answer:

B

Explanation:

Edge 2020

Which might cause a brief moratorium on road building, a bad storm or potholes?​

Answers

Answer: potholes

Explantation:mark me the brainliest

How would telling Karana's encounter with the wild dog from the third person omniscient point of view reveal more information about the thoughts and feelings of both characters

Answers

Answer:

Had the encounter of Karana and the wild dog been narrated from a third person omniscient point of view, the the feelings of both will be shown and give us an insight into the thoughts of both characters. This will allow us to be a part of the two characters, giving us access into what they were thinking and why they had to act in such and such manners. Both sides of the story will be revealed, which will make us, readers, more involved and make us understand the situations that led up to this point.

Explanation:

The story "Island of the Blue Dolphins" by Scott O'Dell tells the true story of a young girl Karana and her survival after being left alone on an island. The story delves into how she overcame her fears and rather initiated friendship with the wild dogs and how she was eventually able to stay alive and be rescued and taken back to civilization.

Though the story is narrated from Karana's perspective, had the story been narrated from a third person omniscient point of view, the feelings and emotions of the characters involved will better present the scenario rather than just being told from a single perspective.

And in the scene where Karana and the leader of the wild dogs have a face-off, if the story was narrated from a third person's point of view, then the feelings of both Karana and the wild dog will be captured, giving us insight into what both characters are thinking. This will give us a better characterization of both sides of the party.

Why Sleep?
Which quote supports the central ideas that sleep is vital to basic functioning
and to how people feel?
A
"We now know that sleep plays an essential role in learning,
memory and emotional well-being."
B
"Just as a good meal is made up of different kinds of food, a
good night requires different kinds of sleep."
C
"During the night, you pass through the different stages, from
lighter to deeper sleep and back again."
D
"Keep in mind that most teenagers need at least 9 hours of sleep
per night!"

Answers

Your answer is A it is well explained
The answer is A just think about it

"sitting surrounded by the
smell" has examples of
which sound device?

consonance
internal rhyme
assonance
alliteration



Answers

Answer:

alliteration

Explanation:

Alliteration is when a sound is repeated several times in a sentence. In this case the "s" sound at the beginning of most of the words is emphasized.

Suppose you have read a poem and a story and identified a theme they share: the importance of enjoying life to the fullest. What important step is now required to compare the theme across the two genres?
a. Write down all examples of the use of literary elements.
b. Identify how the elements of each work express the theme.
c. Express an opinion of which genre expresses the theme better.
d. Make a list of plot events in both works.

Answers

Important step is now required to compare the theme across the two genres is option B. Identify how the elements of each work express the theme.

This is the message the author desires to carry via the tale. often the challenge of a tale is a large message approximately lifestyles. the concern of the tale is critical due to the truth it's miles a part of why the writer wrote the tale. find out the problem of the story.

You need to observe the complete story and feature a basic statistics of the features, plot, and other literary elements worried inside the story. realize the main themes of the tale. find out the author's factor of view on the topics stated. the problem count number is a lesson approximately lifestyles or a assertion about humanity that the poem expresses. To determine on a subject began through arising with the principle theme.

Learn more about The theme here:-https://brainly.com/question/25336781

#SPJ1

Answer: B. Identify how the elements of each work express the theme.

Important step is now required to compare the theme across the two genres is option B. Identify how the elements of each work express the theme.

This is the message the author desires to carry via the tale. often the challenge of a tale is a large message approximately lifestyles. the concern of the tale is critical due to the truth it's miles a part of why the writer wrote the tale. find out the problem of the story.

You need to observe the complete story and feature a basic statistic of the features, plot, and other literary elements worried inside the story. realize the main themes of the tale. find out the author's factor of view on the topics stated. the problem count number is a lesson approximately lifestyles or an assertion about humanity that the poem expresses. To determine on a subject began through arising with the principle theme.

What does medical/illness absence mean in school

Answers

Answer:

you should know

Explanation:

Translate into Latin:
The messengers have sailed away from the homeland.

We immediately invited our new friends to dinner.

The small boy carried the wine into the garden.

The angry slaves attacked the walls of Rome.

Many of the girls have given gifts to the goddess.

Answers

Answer: Nuntii a patria navigavit.

Nos statim ad cenam amicos invitavit nostra novum.

In parva hortis in Puer vinum ferri.

Adgressus est moenia servorum.

Multae puellae ad munera dederunt deam.

Explanation:

can someone write me an article?

its about:
a Kuwaiti (Arab) student gets Harvard scholarship

*create a full article (headline, introductory, paragraph, main body, conclusion)

use features of journalistic style.
write at least 4 paragraphs.

Answers

Answer: i think this is what your looking for

and you might need to zoom in if you need to

Think back to the last presentation or paper you wrote: What type of supporting material did you include? Why did you select the materials you included? Were the materials effective for your purpose? Why or why not?

Answers

Answer: Here's what I would put:

Explanation: The last essay I wrote was an argumentative essay debating whether or not juvenile offenders should be tried as adults in the legal system. To support my claims, I cited evidence from news sources, official legal documents and published opinion pieces regarding the matter. I included the citations as a solid way to defend my stance because it gave my paper more credibility and validation. I included opinion pieces from the opposing side so my work wouldn't seem one-dimensional by offering different perspectives on the  issue and effectively dismissing them and proving mine to be the most logical.

The tundra has many fish species. Millions of birds migrate there each year.

Answers

I’m sorry what was the question?
??, could you provide a bit more Context so someone could help you ?

What is the theme for thank you ma'am and what evidence can support it?

Answers

Answer:

The theme is don't steal and the evidence that could support it is when the woman makes it right.

Explanation:

Hope this help!s

And sry its been a while since i read this.    

What does the phrase “metaphoric foundations” most closely mean as it is used in paragraph 1

Answers

Answer:

Something metaphoric is figurative or symbolic — in other words, it's a metaphor. Your mom might use the metaphoric phrase "disaster area" when she talks about your bedroom. The Greek root of both is metaphora, "a transfer" or "a carrying over."

Explanation:

Discuss the strategy behind odysseus first shot in book 22 of the odyssey

Answers

Answer:

Odysseus invokes the name of Apollo because Apollo is the God of Archery. His strategy is to try and take out the leader while establishing his power.

Explanation:

when you're using a quote in an essay, how do you 'cite' it?

Answers

Answer:

Explanation:

All you need to do is just say where you got the information from

Answer:

Explanation: when i do it i put the link where i got my info from, if it's from a book, it will be more believable if you give the link.  

The title of this novel is "Black Boy." What does his ironic use of the word "boy" signify about the way that black men were perceived at this time in American history?

Answers

Answer:

The blacks in America were deemed inferior and only seen as someone lesser, like a young boy among adults. Maybe, this is one reason why Wright uses the word "boy" in his title.

Explanation:

Richard Wright's memoir "Black Boy" presents the author's childhood and also growing up years as a black man in the American South. The book deals with themes of growing up, racism, family, and also a sense of trying to find his identity.

The use of the word "boy" in the title is ironic because Wright may be describing his childhood experiences but at the same time, the memoir covers well beyond his childhood years too. This may also have to do with his feeling of still being a kid despite being an adult.

Also important is how the blacks were perceived by the whites, the "superior" whites. Though same in all senses, blacks were hardly accepted by the whites as their own or equals, and more like inferior and lesser than them. This can also be one reason why Wright uses the word "boy", as a generalization of how his black people were perceived by the whites.

DIFFICULT RIDDLE! WHOEVER IS CORRECT GETS BAINLIEST.
I am something people love or hate. I change peoples appearances and thoughts. If a person takes care of them self I will go up even higher. To some people I will fool them. To others I am a mystery. Some people might want to try and hide me but I will show. No matter how hard people try I will Never go down. What am I?

Answers

Answer:

Self-confidence?

Other Questions
Estimate 511 x 637 by first rounding each number so that it only has 1 nonzero digit. what would you do when you grow up?*Career* And explain why! During a formal group discussion, participants should be prepared toO lead the conversation and prompt others to speak. O persuade others to agree with their viewpoint. O interrupt other speakers when necessary. O take turns both listening and speaking. This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive How do you do this question? Abdul made $252 for 12 hours of work.At the same rate,how many hours would he have to work to make $105 XYZ Corporation, whose common stock is currently selling for $40 per share, is having a rights offering. The terms of the offering require 10 rights plus $35 to subscribe to one share of stock. Compute the theoretical value of a right before the ex-rights date. Est ce que quelqu'un pourrait bien corriger mon expression ecrite ou donner son avie dessus s'il vous plait A $10,000 bond with 18%/year, compounded semi-annually (interest is paid every six month) is available in the market. The bond matures in 10 years. The closest PW of this bond if the purchaser can earn 12%/year, compounded quarterly is:_____. My annoying brother likes to drive me crazy. There is no other who is that lazy. He whines to my mom night and day, until eventually gets his way. What is a sister to do, when he screams til he's blue? There is no way to win, for he gets under your skin. He does his best to kill all joy. Oh, how my brother does annoy! What is the tone of the poem PLZ HELP!!!Will mark brainliest44. Show that the quadrilateral with vertices A(0,0), B(a,0), C(a + b, c) and D(b, c) is a parallelogram. hehe i need help with the whole quiz basically:IFind the decimal that is equivalent to: A. 1.714 B. 0.583 C. 0.0583 D. 6. Another engine reaches its top speed from rest in 7.5 s. It is able to perform 250,000 J of wok inthat time How much power does this engine have in that time? The Yellow River is often called the cradle of Chinese civilization. It was along the banks of the Yellow River where the Chinese civilization first formed. The Yellow River is 3,395 miles long, making it the sixth longest river in the world. It is also called the Huang He River.Early Chinese farmers built small villages along the Yellow River. The rich yellow-colored soil was good for growing a grain called millet. The farmers of this area also raised sheep and cattle. Ancient China: Geography,Ken NelsonUsing context clues, which statement best defines the phrase "cradle of Chinese civilization?the place where the longest river in China startsthe place where most people in ancient China livedthe place where people in China began a farming culturethe only place in ancient China where people could farm What is an accurate statement about many of the first Africans to come to Louisiana?They came voluntarily.They were skilled laborers. They came in search of domestic work. They knew how to grow crops. Carter was given a box of assorted chocolates for his birthday. Each night, Carter treated himself to some chocolates. Carter ate 5 chocolates each night and there were originally 30 chocolates in the box. Write an equation for C,C, in terms of t,t, representing the number of chocolates remaining in the box tt days after Carter's birthday.