Compared with the other amendments, the Ninth Amendment is more general in the rights it protects. addresses states’ rights in greater detail. broadens federal government power. is narrower in the rights it protects.

Answers

Answer 1
Compared with the other amendments, the Ninth Amendment

is more general in the rights it protects.



Hope this helps!
Answer 2

Answer:

is more general in the rights it protects

Explanation:


Related Questions

What was one result of King George III’s rejection of the Olive Branch Petition?
A
The colonies couldn’t trade with foreign nations.
B.
Patriot groups attacked and looted King George III’s palace.
C.
Many colonists who were initially Loyalists became Patriots.
D.
Rebelling colonists were imprisoned and executed.

Answers

Answer:

C. Many colonists who were initially Loyalists became Patriots.

Explanation:

no explanation

Answer:

the answer is c

Explanation: i took the test

Which of the following best demonstrates how the societies of the Greek polis and the Roman Republic differed?

Roman society treated women far better than Greek society.

Greek city-states were composed of individual societies with unique governance and structure, while Rome was centered on a collection of city-states.

Roman society was hugely militaristic, bent on territorial domination, and Greek city-states were democratic and focused on arts and culture.

Roman citizens had compulsory military service, and Greek city-states had voluntary military service.

Answers

Answer:

Romans were hugely militaristic and Greeks are and culture

Explanation:

We know a lot of Greek philosophers and how they thought about the world. With roman can't conquer the whole Mediterranean and then some without an army

What made George Washington the perfect person to serve as the first president? What precedents did he set that have influenced Presidents who followed?

Answers

George Washington was viewed as the perfect person to serve as the first president of the United states because during the revolution, he led the colonial forces to victory over the British and thus became a national hero.

     He served as the first President of the United states set the precedent for the actions of all other presidents that followed him.

Having had an extraordinary life as the first in many aspects, he developed several presidential actions for his successors.

Some of the key actions undertaken by President Washington include the following.

Appointing Judges. Among the several challenges he faced was the appointment of Judges for the newly formed Judiciary branch of government.

Ceremonial purposes President Washington served in several ceremonial purposes. Although the office of president was supposed to be under the legislature, his personality made he stand out and hence command a lot of respect

Chief foreign diplomat President Washington served as the chief foreign diplomat by proposing and carrying out diplomatic functions and agenda.

Chooses a Cabinet President Washington developed the idea of Presidential cabinet and this has set the precedent for all his successors.

Commander in Chief of the Military. President Washington proposed the idea that the president in order to be in charge of the government had to command all branches of the American defense architecture.

Learn more about President Washington at https://brainly.com/question/2409724

#SPJ1

Why did President Truman go before a joint session of Congress after the British announced in 1947 that they could no longer afford to support the pro-western governments of the Mediterranean in their fight against communism?
NEED ASAP
Select one:
a. He wanted to send missionaries to the Mediterranean.
b. He wanted to send soldiers to the Mediterranean to fight the Russians.
c. He wanted to request aid for the countries of Greece and Turkey.
d. He wanted to encourage more companies to establish their businesses in the Mediterranean.

Answers

Answer:

Explanation:

Undibdibsi in

A school district in California held its graduation at a local church. Which statement best explains whether this action

violated the establishment clause, and why?

It violated the establishment clause because it held a school function at a denominational church, which

demonstrates support for a specific religion.

It violated the establishment clause because the school needs to show support for all religions and have events at a

variety of local religious locations.

It did not violate the establishment clause because the school was not promoting religion, the location was.

It did not violate the establishment clause because the school does not force people to attend graduation.

Answers

Answer: It violated the establishment clause because it held a school function at a denominational church, which demonstrates support for a specific religion

Explanation:

Establishment clause, forbids the government of the United States from flavouring a particular religion or establishing a religion.

According to the scenario in the question, we can deduce that the establishment clause was violated because it held a school function at a denominational church, which demonstrates support for a specific religion. One should be neutral when it comes to religion.

The statement that best  explains whether this action  violated the establishment clause is option A.

The following information should be considered:

The establishment clause forbids the government of the United States from flavoring the particular religion or creating a religion. As per the given situation, we can deduce that the establishment clause was violated since it held a school function at a denominational church, that represent support for a specific religion. Also, One should be neutral when it comes to religion.

Learn more: brainly.com/question/16911495

Describe the costs of trading grain for wood in ancient Egypt. In other words , what are the drawbacks of trading grain for wood ?

Answers

Answer:

Regular distribution began in 123 BC with a grain law proposed by Gaius Gracchus and approved by the Roman popular assembly. Adult male citizens (over 14 years of age) of Rome were entitled to buy at a below-market price five modii, about 33 kilograms (73 lb), of grain monthly.

Explanation:

7
What is a pull factor?
A.)a factor that makes people want to move to a new country or region
B.)none of the above
D.) a factor that makes people want to move away from their homeland, country, or region.

Answers

Answer:

something that attracts people to a place or an activity: Warm weather and a low living costs are two of the pull factors drawing retirees to Texas. Compare. push factor.

Explanation:

Answer:

“Be strong and courageous. Do not fear or be in dread of them, for it is the LORD your God who goes with you. He will not leave you or forsake you.” [Deuteronomy 31:6]

Explanation:

oh btw its a

which sentence describes an achievement of Rome's Empire that survived its fall ​

Answers

Answer: The answer will be C

Explanation: Because if they did not have a calendar they to know when they had war

The industrial revolution began in Great Britain. Which reason do you believe is most significant? Why?

Answers

Answer:Origins of the Industrial Revolution

First, the Agricultural Revolution of the 18th century created a favorable climate for industrialization. By increasing food production, the British population could be fed at lower prices with less effort than ever before.

Explanation:

why do you think storms in the Pacific differ from storms in the Atlantic?
(pls help asap)

Answers

Answer:

The Pacific Hurricane Season differs slightly from the Atlantic Hurricane Season in a few small ways. Firstly, the Season starts on May 15th and ends on November 30th. The terminology is also slightly different. Hurricanes that occur in the North Pacific are called typhoons, while those that occur in the Indian and South Pacific Oceans are called cyclones.

Are you satisfied with the current power of the
President? Why? Explain your answer​

Answers

Answer:

I am satisfied because the presidents powers are still limited

Answer:

I am very much satisfied .

Explanation:

Because his powers are limited.

The Texans were hoping to gain support from _______________ by creating the “Declaration of the People.”
a.
other Mexican citizens
b.
the United States
c.
all settlers in Texas
d.
the Mexican authorities

Answers

Answer:

Its A. other Mexican citizens

Explanation:

Answer: It's A. Other Mexican Citizens

Please I really need help on 15 I WILL MARK BRAINLIEST!!!!

Answers

Answer:

The Wichita tribe

Explanation:I learned in school. Also there is a city called Wichita. Sorry if it is wrong. Mark as Brainliest!

the answer to number 15 is C

What do you think must be improved from the agrarian reform?

Answers

Answer:

Most agrarian reforms aim at improving land distribution, so a point that can be improved from the agrarian reform is the access to land.

Explanation:

The idea is to have more farmers own land, and to have a more equal distribution of land as well. Agrarian reforms usually take on large estates owned by a few people and break it down in several farms that are later distributed to formerly landless, or poor peasants.

Agrarian reform should also focus on public goods, technical help, irrigation, fertilization, sustainability, and economic systems.

Compared to the Convention of 1832, the Convention of 1833 represented what kind of shift in the attitude of Texas settlers?

A. a growing resentment of U.S. meddling in Texas

B. an increase in their demands for independence

C. a softening of their anger toward Mexico

D. a greater willingness to accept Mexican rule


Choose the best answer PLEASE HURRY ASAP!!!

Answers

Answer:

B. an increase in their demands for Independence

Answer:

B an increase in their demands for independence

Explanation:

Hoped this helped:)))))))

Place names such as El paso, Amarillo, San Antinio, and San Angelo are examples of​

Answers

I hope it may be noun

What roles were played by Samuel Adams and John Adams in the events surrounding the Boston massacre?

Answers

Answer:

Samuel Adams was among the many who denounced the soldiers' acquittals as a grave miscarriage of justice, and the following year, he helped organize the first of several March 5 “Massacre Day” remembrances.

Explanation:

Answer:Preston wrote his version of the events from his jail cell for publication, while Sons of Liberty leaders such as John Hancock and Samuel Adams incited colonists to keep fighting the British. As tensions rose, British troops retreated from Boston to Fort William.

Explanation:

8. Who is Legree? How is he portrayed?

Answers

Answer : Simon Legree, fictional character, the principal villain in Harriet Beecher Stowe's antislavery novel Uncle Tom's Cabin (1851–52). This man is an extremely cruel plantation owner who sees his slaves as nothing more than feelingless objects to be used or abused as he pleases. This man is the embodiment of the most evil aspects of slavery.

Explanation:

Explanation:

I hope understand this answer

describe the development of the worst lead to conflict both inside and outside the nation

Answers

Answer:

We begin by developing the concept of human consequences and showing why, One way in which the actions that cause global change are different from most of ... of the natural environment; that topic is outside the range of human dimensions. ... An important consequence of global environmental change is conflict

Explanation:

What are three distinguishing marks of the catholic church ?

Answers

Answer:

Three marks are usually enumerated: the preaching of the Word, the administration of the sacraments, and church discipline

Explanation:

Are you talking about this ???

Answer:

the marks of the church are those things by which the true church may be recognized in protestant theology 3 marks are usually enumerated the preaching of the word the administration of sacraments and church discipline..

What did Assyrians use for money? What did they do for money?

Answers

Assyrian merchants used the route to export textiles, or woven thread as money. To get money, their Farmers grew many crops, the most important being barley. They also domesticated, or tamed, animals for livestock

Explanation:

Which of the following was a key theological difference between Greek Orthodoxy and Roman Catholicism?

A.Greek Orthodoxy did not support the divine origins of Jesus.

B.Greek Orthodoxy did not pursue missions and proselytizing outside of Constantinople.

C.Greek Orthodoxy held that Jesus did not become mortal to atone for humanity’s sins, but instead to facilitate the transformation of humans into divine beings.

D.Greek Orthodoxy avowed that Jerusalem, not Rome, was the center of Christianity.

Answers

Answer: C

Explanation:

hope this helps

The statement that was a key theological difference between Greek Orthodoxy and Roman Catholicism is: C.Greek Orthodoxy held that Jesus did not become mortal to atone for humanity’s sins, but instead to facilitate the transformation of humans into divine beings.

What is the difference between Greek Orthodoxy and Roman Catholicism?

The Greek Orthodoxy  believed that Jesus  Christ did was not a living human being  to atone for people  sins.

They believe that Jesus Christ was the one that help to facilitate the transformation of human kind into divine beings.

Therefore the correct statement is C.

Learn more about Difference between Greek Orthodoxy and Roman Catholicism here:https://brainly.com/question/11871918

#SPJ2

what are the two branches that specify at least one way of those two branches that can limit the power of the other branch ​

Answers

Answer:

The legislative branch can make laws by the president in the executive branch must veto the law.

5. Knights would not have had much need or time for religion in the Middle Ages. True or False?

Answers

Answer:

False.

Explanation:

Hope it will help you

How many sons did Edward Weston have

Answers

Answer:

2 sons whose names are Brett and Cole

Explanation:

Hope this helped :)

Answer:

2.... thousand:)

Explanation:

branch.
The President, the Vice-President, and the President's cabinet are under the branch

Answers

Answer: The President, the Vice-President, and the President's cabinet are under the Executive branch.

Explanation:

1. How did the Articles of Confederation create a weak national government?



a. The national government controlled the admission of states.



b. The Articles of Confederation gave the national government powers it no longer

needed



c. The national government could regulate the western land claims of the original 13

colonies.


d. The Articles of Confederation created a national government with few powers to

manage the economy.

Answers

Answer:

not too sure but I will go with d

1.Do you think we could survive if going back to agricultural society?

Answers

Answer:

nope

Explanation:

Agriculture is the very basis of modern human civilization. Without it their would be no food. ... Without food you cannot survive, most people cannot grow their own (at least in sufficient quantities) so without someone to do it for them, they would not survive.

As per the current scenario, it is not possible for today's generation to go back to agricultural society.

What is Agriculture?

The term agriculture has a vast meaning which is not just confined with the cropping patterns, it also includes cultivation of the soil harvesting the crops and rising the livestock that is domestication of the animals. It is acted the basis for modern human civilization.

In modern human civilization, it is not possible to live without performing agricultural activities that include production of the food. Without food, no human being good survive on this planet on their own, but just depending upon agriculture society will not develop the nation.

Due to the technology advancement, there are several sectors in which growth is necessary. One such sector is named as industrialization.

Therefore, it can be concluded that according to the current situation, it is not possible for today's generation to return to agrarian society.

Learn more about Agriculture here:

https://brainly.com/question/3632132

#SPJ2

Explain three ways in which would revise the US asylum process.

Answers

Answer:

through the affirmative process

defensive process.

using transitions to create logical relationships

Explanation:

what is autocracy ?

Answers

Answer:

A system of government by one person with absolute power.

Answer:

Autocracy is a system of government by one person with absolute power.

Explanation:

An example of autocracy would be the German leader Adolf Hitler.

Other Questions
A box contains 300 raffle tickets. Only 15 tickets are winning tickets. What is theprobability the first ticket drawn at random from the box is a winning ticket? How might the location of a city on a bay affect the economy of a city? Why do phase changes occur?1. Compare: Set the Water temperature to 0 C and click Play. Observe the water molecules.Click Reset, set the Water temperature to 100 C, and click Play again.What do you notice? The water molecules are moving slightly faster at 100 C than at 0 C.[Note: This difference may be too small to observe easily.]2. Observe: Click Reset. The mean molecular speed of the water molecules is displayedbelow the container. Set the Water temperature to 0 C and Add/remove heat energy to400 J/s. Click Play.A. How does the mean speed of the water molecules change as they are heated?The average speed of water molecules increases as they are heated.B. Does the mean molecular speed change as much as the temperature as thewater heats up? Explain.Sample answer: For each degree of temperature change, the mean molecularspeed increases by about 1 m/s. At 100 C, the mean molecular speed is about17% faster than at 0 C.3. Explain: How is temperature related to the motions of molecules?The higher the temperature, the faster the molecules move.4. Observe: Click Reset. Set the Water temperature to 20 C and the Ice volume to 50 cc.Set Add/remove heat energy to 0 J/s. Click Play. How do the molecules in the liquidinteract with the molecules in the solid?The molecules of the liquid collide with the molecules of solid, gradually breaking the bondsbetween the molecules in the solid and causing the ice to melt. please help me asap Who was the established groups in Postville before the in-migration? What were their expectations of each of the new groups Jeremy find the cost by adding the percents. 25% off of $60 is equal to 15% off of $60, then subtracting 10% from that cost is equal to . The two total costs are HELP!!BRAINLIEST AND 10 POINTS !! Complete the analogyREBEL : ORTHODOXY :: (A) nonconformist : convention(B) radical : revolution (C) soldier : combat (D) scientist : theory Which statement illustrates bias in scientific research?A zoologist publishes incomplete data on sloths which supports their original hypothesis and notes that more research is required.A botanist publishes data about plant growth that does not support their original hypothesis and is replicable.An ecologist publishes data funded by a construction company which supports their original hypothesis that an endangered animal's territory is not endangered.A microbiologist publishes data funded by the National Institutes of Health that does not support their original hypothesis. Help me please!!! I need a short letter, using basic or simple teems, words, vocabulary. I would like to be Cabinet member perspective. But Natives is also fine with me. Thanks. Please need help Choose the words that complete the following sentence.Direct quotes needaround them, or else it is considered(1 point)O quotation marks/summarizingO quotation marks/plagiarismO parentheses/summarizingO parentheses/plagiarism I love you. You are worth it. What does this quote mean? Thanks! Ayala is making salad dressing. She mixes oil andvinegar in a blender until a smooth consistency isformed. Explain whether this is a heterogeneous or ahomogeneous mixture and why. Help?Jessica must determine how many packages of cookies and cupcakes to buy for her family reunion. Jessica's mother has asked her to buy the same number of each type of item but no more than 100 of each. At the bakery, Jessica finds that cookies are sold in packages of 12 and cupcakes are sold in packages of 9.Use the drop-down menus to select the answers that make each statement true.The greatest number of packages that Jessica can buy is _ packages of cookies and _ packages of cupcakes. explain what happens when particles collide When a story is told from the _____, the narrator has full knowledge of all the characters. omniscient third-person point of view reliable first-person point of view unreliable first-person point of view limited third-person point of view The product of the ages of two adults is 572. Find their ages. Guys, I need help ASAP!! The standard deviation of the following data set is 0.31. 95% of the data would fall in which range?4.3, 5.1, 3.9, 4.5, 4.4, 4.9, 5.0, 4.7, 4.1, 4.6, 4.4, 4.3, 4.8, 4.4, 4.2, 4.5, 4.4Pr (3.88 X 5.12)Pr (2.67 X 5.33)Pr (4.19 X 4.81)Pr (3.57 X 5.43) ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut