Determine the mRNA and amino acid sequence for the below DNA sequence.

Determine The MRNA And Amino Acid Sequence For The Below DNA Sequence.

Answers

Answer 1
AUGAGCCCCGCUAGGUUCUC

Related Questions

The first one to get it right gets brainest.

Answers

Answer:

D.Tropical Rainforest

Into what kingdom would each of the following be classified: Unicellular prokaryotes that live in dust. ______________________ Unicellular eukaryotes that line in pond water. _____________________ Multicellular eukaryotes that live all over the planet and consume food. ______________________ Unicellular prokaryotes that live in volcanic ash. _________________________ Multicellular eukaryotes that have cell walls and are heterotrophic. _______________________ Multicellular eukaryotes that have cell walls and are autotrophic. ________________________

Answers

Answer:

Unicellular prokaryotes that live in dust: Eubacteria

Unicellular eukaryotes that line in pond water: Protista  

Multicellular eukaryotes that live all over the planet and consume food: Anamalia  

Unicellular prokaryotes that live in volcanic ash: Archaebacteria  

Multicellular eukaryotes that have cell walls and are heterotrophic: Fungi  

Multicellular eukaryotes that have cell walls and are autotrophic: Plantae

Explanation:  

Prokaryotic organisms can be classified into two groups: Eubacteria and Archaebacteria. Eubacteria (i.e.,“true” bacteria) are unicellular prokaryotic microorganisms that live in normal environmental conditions. On the other hand, Archaea (Archaebacteria) are prokaryotic older organisms that thrive in extreme conditions (in this case, volcanic ash). Moreover, eukaryotic organisms can be classified into four kingdoms: Protista, Plantae, Fungi and Animalia. Protista are unicellular eukaryotes that live in different aquatic environments (i.e., oceans, ponds, streams, etc). Animals are multicellular, mobile, heterotrophic (i.e., organisms that cannot produce its own food) organisms whose cells lack walls. Fungi are heterotrophic organisms that acquire their food by absorbing dissolved organic compounds, whose cells have cell walls (but they lack chloroplasts). Finally, plants are multicellular autotrophic (i.e., organisms that produce their own food) organisms whose cells contain walls and chloroplasts (to produce food by photosynthesis).

Ferns tend to live in which of the following habitats?"
moist and sunny
moist and shady
O dry and sunny
Odry and shady

Answers

Answer:

Moist and shaddy

Explanation:

moist and shady
hope it helps

 HURRY I HAVE A TIME LIMIT!

Humans, cats, whales, and bats all have similar arm bones. What piece of evidence for common ancestry does this describe?

-homology
-embryology
-fossil record
-amino acids sequences

Answers

Answer:

Homology

Explanation:

Homology, in biology, similarity of the structure, physiology, or development of different species of organisms based upon their descent from a common evolutionary ancestor.

If radioactive Forcing were to increase in a particular region of earth what would you expect to happen to average temperatures

Answers

If radiative forcing increases in a particular region of the earth, , the average temperature over that area would increase. If radiative forcing increases in a particular region of the earth, , the average temperature over that area would increase. This answer has been confirmed as correct and helpful. Hope this helps! Mark brainly please!

Which is true for urochordates? *

Answers

The option which is true for urochordates is the second one - the notochord is present only in the larval stage; it is absent in adults.

what are basics of fungi​

Answers

Answer:

Explanation:

Fungi are heterotrophs and, like animals, obtain their carbon and energy from other organisms.

Answer:

Fungi are a kingdom of mostly microscopic organisms that are closely related to animals. They include spore-producing organisms such as mushrooms, yeast, and molds. Fungi are almost always invisible to the naked eye. Fungi are made up of masses of tubular filaments called hyphae that penetrate and absorb nutrients from the substrates on which fungi grow. Some fungi have extensive networks of hyphae that enable the fruiting body of the fungi to grow very large, such as many species of the shelf, or bracket, fungi

Explanation:

hope it helps-

Where are the best geothermal resources located in the U.S?
A. West Coast
B. East Coast
C. South
D. Midwest

help me help me help me help me help me please please ​

Answers

the west coast

Explanation:

yeah it mostly likely that

William built a machine that recycles metal. When
William places metal on the machine's conveyor
belt, the belt begins to move, pulling the metal
toward the rest of the machine. The machine uses
energy to break down the metal so it can be reused.
What characteristics does William's machine share
with living things?
O A. The machine responds to its environment
and reproduces new machines of its own
kind.
O B. The machine responds to its environment
and uses energy.
O C. The machine reproduces new machines of
its own kind and uses energy.
O D. The machine reproduces new machines of
its own kind and is made of cells.

Answers

Answer:

O B. The machine responds to its environment

and uses energy.

Explanation:

also THE MAN BEHIND THE SLAUGHTER im soo sorry i had to (≧w≦)

Which statement best describes the function of the nervous system in the body?
O to protect other organs and tissues
O send messages to body parts using only chemicals
O to gather information through the senses (stimuli) and also control all other body systems
O to transport oxygen and carbon dioxide

Answers

Answer:

i think that the answer might be B

B is not a bad choice, however, C is the best choice.

Compare and contrast suspension feeding and deposit feeding-

Answers

Answer:

Suspension feeding involves collecting food particles like small organisms, organic matter, detritus which are suspended in water, often using some form of filtration.

Suspension feeders catch food or organic material from the water using tentacles or spiny arms

where as

Deposit feeding involves feasting on detritus and organic matter that have settled on the ocean floor.

Deposit feeders pass sand, mud, water or sediment into their mouths using mucous-covered tentacles or arms etc.

Explanation:

Suspension feeding ingests the food particles which are suspended in water, while deposit feeding ingests sediments and aquire foods.

What do you mean by Deposit feeders?

Deposit feeders may be defined as those aquatic organisms that forage on organic matter that settled down on the bottom.

Suspension feeding maintains the water quality in the aquatic environment, while deposit feeding enhances oxygen level and nutrient cycling.

Suspension feeding occurs similarly to filter-feeding that only ingests suspended particles. While deposit-feeding ingests the deposited particles like detritus, organic matter, etc.

Therefore, it is well described above.

To learn more about Suspension feeding, refer to the link:

https://brainly.com/question/14008707

#SPJ2

In geothermal power systems temperature and pressure inside Earth ____ with depth
A. Increase
B. Decrease

help me help me help me help me help me help me help me help me help me help me​

Answers

Answer:

A

Explanation:

am not to sure but it mostly likely is hopefully this helps you

Identify the bonds formed between RNA nucleotides by RNA polymerase.

A. Ester
B. Glycosidic
C. Peptide
D. Phosphodiester​

Answers

Answer:

D. Phosphodiester​

Explanation:

Just as the DNA polymerase serves as a catalyst in the replication of the DNA, so does the RNA polymerase speed up the formation of the RNA. RNA polymerase performs its function of linking nucleotides when the phosphodiester bonds are formed in the 5' to 3' sequence. Nucleoside triphosphate precursors such as the Adenosine triphosphate, Cytosine triphosphate, and Guanosine triphosphate serve as the substrates that allow the formation of the RNA molecule.

When the RNA polymerase unwinds the double helix structure of the DNA found before the active site where the polymerization will occur, substrates can then pair themselves in a complementary form.

What body system is the human heart part of?

Answers

The heart is apart of the circulatory system.

Answer:

the answer will have to be The heart is apart of the circulatory system.

Explanation:

The real length of one villus is 0.8 mm
Calculate the image length if the villus is viewed at a magnification of x20

magnification = size of image / size of real object

Answers

Answer:

Explanation:

Re arrange formula=Size of image=Magnification*size of real image

0.8mm*20=16mm

The image length will be "16 mm". A further explanation is below.

Given:

Magnification,

20

Size of real image,

0.8 mm

As we know the formula,

→ [tex]Magnification = \frac{Size \ of \ image}{Size \ of \ real \ image}[/tex]

or,

→ [tex]Size \ of \ image=Magnification\times Size \ of \ real\ image[/tex]

By substituting the values, we get

→                         [tex]=20\times 0.88[/tex]

→                         [tex]= 16 \ mm[/tex]  

Thus the response above is correct.

Learn more:

https://brainly.com/question/24716995

2. Prokaryotes differ from eukaryotes by all of the
following characteristics EXCEPT:
A. kinds of nucleotides in their DNA
B. structure of their flagella
C. structure of their plasma membranes
D. structure of their chromosomes
E. methods of cell division

Answers

Answer:

C. structure of their plasma membranes

Explanation:

hope it helps

Which kingdom includes multicellular, heterotrophic organisms that absorb nutrients from other dead organisms?

Protista
Animalia
Plantae
Fungi

Answers

Answer: Fungi

Explanation:

Pls help meeee I’m stuck and thank you so much

Answers

Answer:

The answers is b

If a 25 kg car accelerates at a speed of 100m/s2,2 what will the force of the car be? Plug in the numbers: Force = mass x acceleration

Answers

Here is the answer:
Mass=25kg
Acceleration=100m/s^2
Force=mass*acceleration
Force=25*100
Force=2500N

what is the difference between the way that saprotrophs and detritivores digest their food

Answers

Answer:

Externally

Explanation:

Usually, detritivores are mostly animals, while saprotrophs are mostly fungi. Furthermore, detritivores consume lumps of dead organic matter separately, while saprotrophs absorb chemically digested food. Saprotrophs digest their food externally, whereas detritivores do it internally in the digestive system.

i hope this helps! :)

complex interactions must occur before solar energy is converted into a form of energy humans need to work and perform many life processes truth the sequence that best shows the path of energy

A) radiant energy --> mechanical energy --> chemical energy

B) heat energy --> light energy --> photosynthesis

C) radiant energy --> chemical energy --> mechanical energy

D) mechanical energy --> chemical energy --> radiant energy

Answers

The best answer to go with is b you’re welcome have a great day

pls answer soon 8th grade science

Answers

Answer: 1. Is true 2. is false 3. Is true 4 is true 5. Is false 6. Is true 7. Is false 8. Is true 9. Is true 10 is false 11. Is false

I couldn’t answer so I just commented the answers to part 1

Part b. 12. B, 13. E, 14. A, 15. D, 16. C.

now I did as a actua answer

Explanation:

200g of water at 90degree Celsius is mixed with 100g of water at 30 degree Celsius. What is the final temperature (C of water =4.2jkg-1 k-1​

Answers

Answer:

70 °C

Explanation:

Since heat lost by 200 g of water = heat gained by 100 g of water

-mc(T - T') = m'c(T - T")

where m = 200 g,T' = 90°C, m' = 100 g,T" = 30°C and T = final temperature of mixture, c = specific heat capacity of water = 4.2jkg-1 k-1​.

Substituting the values of the variables into the equation, we have

-mc(T - T') = m'c(T - T")

-200 g(T - 90 °C) = 100 g(T - 30 °C)

(T - 90 °C) = 100 g(T - 30 °C)/-200 g

(T - 90 °C) = -0.5(T - 30 °C)

T - 90 °C = -0.5T + 15 °C

collecting like terms, we have

T + 0.5T = 90 °C + 15 °C

1.5T = 105 °C

T = 105 °C/1,5

T = 70 °C

what is the word for a sequence of steps used to define and solve a problem

Answers

Answer:

Algorithm

Explanation:

Algorithm is the process that requires steps. Say for instance you are walking to school, and you don't want to step on a crack. You simply will step over one, and keep on going till you reach school. That's an algorithm.

Hope this helped, and please mark as Brainliest <3

Compare and contrast the structure and function of DNA and RNA.
▪ Identify the bases used in DNA and RNA and how they pair – classify
each as a purine or pyrimidine

Answers

Answer:

DNA has a double- helix structure which means it has two strands. The DNA strands are made from sugar (Deoxyribonucleic), phosphates and nitrogenous bases. There are 4 nitrogenous bases, 2 purine and 2 pyrimidine. The 2 purine bases are Adenine and Guanine. The pyrimidine bases are Thymine and Cytosine. DNA gives our genes.

RNA is a single strand unlike DNA. The strands are made from sugar (ribonucleic), phosphate and the nitrogenous bases. There are 4 nitrogenous bases 2 purine and 2 pyrimidine. The 2 purine bases are Adenine and Guanine. However, the 2 pyrimidine bases are Uracil and Cytosine. The function of RNA is to contribute to releasing proteins based on our rRNA and tRNA and mRNA. This process is known as RNA and transcription.

Explanation:

What do the arrows represent?
the magnetic field
thermal energy
light energy
the electric field

Answers

Answer:

the answer is A

Explanation:

Answer:

A. the magnetic field

Explanation:

Have a nice day/night :D

ASAP!! HELP ME WITH THESE pls :(

Question 1.Which moon phase starts and ends in the moon cycle?

Question 2 : How many days between each moon phase ?

Answers

Answer:

1. new moon

2. seven

Explanation:

:)

Answer:

there are 4 important phase. full moon is the first phase and new moon is what it ends.

it takes 27days between each moon phase

plzz help mark brainiest 10 points​

Answers

Answer:

B

Explanation:

Sunrise you will see a full moon

Are these ramen noodles expired?

Answers

Answer:

it depends on the numbers on the bottom they foretell the nono time to eat

Answer:

they look fine, just check the expiration date and make sure the package wasn't already opened.

Explanation:

they look good to me though, so I'd say eat up!

Which of these types of muscles are striated? Check all of the boxes that apply.
1) skeletal muscles
2) cardiac muscles
3) smooth muscles

Answers

Answer:

Muscle Types: Cardiac and skeletal muscle are both striated in appearance, while smooth muscle is not. Both cardiac and smooth muscle are involuntary while skeletal muscle is voluntary.

Answer: skeletal muscles  & cardiac muscles

Explanation: Skeletal and cardiac muscles are striated. Smooth muscles are not.

Other Questions
Please help! I'll mark you brainliest!! 2,451 people came to watch the Easter parade. 745 of those people were adults. How many children came to the parade? This table was included with a multimedia presentation on the election of 2000.How could this table be more effective?It could identify the source to show that it is reputable.It could list statistics that are more relevant to the topic.It could include a title that is clear and easy to understand.It could show statistics for more than one presidential election. 3. Which type(s) of cells have genetic material that is contained in a nucleus?A. bacterialB. plants onlyC. animals onlyD. both plant and animal cells The greatest snowfall in a 24- hour period was 76 inches. Which of these is the same as 76 inches?A. 6 1/3 feetB. 2.5 yardsC. 7.6 feetD. 2 1/3 yards Help please Im trying to go to sleep PLZ HELP ME its due tomorrow and I really need help I will also give brainiest. You will write a paragraph with at least 8 sentences where you talk about how you usually spend your free time, and how you will spend it on the weekend.Here are some questions to help you think about your paragraph:What sports/activities do you enjoy watching?What sports/activities do you enjoy playing or participating in?What do you play/participate in consistently? When do you play/participate in it? Where do you play/participate in it?What details can you provide in your sentences?What are your plans for the weekend?Make sure you provide as much detail as possible :) Review the rubric before you begin your project and before you submit it!! Help me please Ill will give brainliest if its right All light travels at the same speed.O TrueO False what are the characteristics if a granite rock A locker is in the shape of right rectangular prism. Its dimensions are as shown. What is the surface area of this locker?a.412b.392c.432d.448The height of the right circular cylinder shown below is 10 feet and its base has a radius of 4 feet.what is the surface area of the cylinder in terms of pi?a.96b.118c.112d.128 HELPPPPPPPPPPPPPPPP A player who replaces a runner is called a ________. True or False: The Union did little to help the South rebuild duringReconstruction Emily is giving candy to 8 of her friends. She wants to give each friend 2/3 of a chocolate bar. How many whole chocolate bars does she need? 7. Busco un viaje que_____econmico.soyseressea What are these things, and which room(s) do you usually find them in?1 girdef fridge, in the kitchen2 snik3 nacitusr4 shiconus5 ktelet6 bashniswa7 cparte8 lipowl9 shiwang chameni10 kocero11 chmariar12 leits Martin recorded the low temperatures at his house for one week. the temperatures are shown below --7, -3, 4, 1, -2, -8. 7Approximately what was the average low temperature of the week? Indias form of government OMG PLS HELP WITH THIS IM PANICKING OMG I GOT A F IN MATH MY MOM JUST YELLED AT ME IM CRYING PLS HELP WITH THS- PLSS TELL ME WHAT TO DRAW Please help.Is algebra.