GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were
Answers
Answer:
u want step by step?
Explanation:
Related Questions
Where is blood produced?
Answers
Answer:Love..
Explanation:
Love comes from your....
The giant african land snail is an invasive species that is also the largest snail ons earth what is most likely consequence of introducing this invasive species into a stable ecosystem?
A. The native snail species will change their diet therefore destabilizing the ecosystem.
B. The native snail species will move to another area allowing the ecosystem to remain stable.
C. The native snail species will share their food with the invasive species stabilizing the ecosystem.
D. The native snail species will compete for resources with the invasive species and destabilize the ecosystem
Answers
Answer:
D. The native snail species will compete for resources with the invasive species and destabilize the ecosystem
Explanation:
In Ecology, an invasive species refers to a species of organism that is foreign i.e. non-native to a particular habitat or environment. They are characterized by the ability to proliferate in growth and compete for space and nutrients with the native species in the habitat they are introduced to.
In this case, the giant african land snail, which is an invasive species, if introduced into a stable ecosystem will compete for resources with the native species of that ecosystem leading to the destabilization of the ecosystem.
HELP PLEASE ILL GIVE BRAINLIEST!!!
Answers
Answer:answer is osmosis
Explanation:
im smart
How has the environment of this location changed since Basilosaurus lived?
Answers
When will a seed begin to germinate?
A. When it has sunlight and water
B. When it has energy
C. When it has water
D. When it has sunlight
Answers
Answer:
A
Explanation:
When it has sunlight and water
Answer:
A. When it has sunlight and water
Explanation:
7. In a cross with a homo zygous, grey, female moth and a homo zygous, black, male moth, all of the progeny are grey. In a cross with a homo zygous, black, female moth and a homo zygous, grey, male moth, all of the progeny are black. What is the best explanation for this? (2 words)
Answers
Answer:
Due to dominant trait.
Explanation:
The best explanation for this result is that grey colour is dominant trait due to which all of the progeny appears grey while in the second example, black colour is dominant trait which appears in the all the offspring of moth. In the offspring, only that trait becomes visible which is dominant while the trait which does not appear is known as recessive trait so that's the reason due to which grey in the first and black colour in the second becomes visible.
As the fruit develops, why do the petals, stamen, and sepals fall off?
A. The fruit absorbs them, which gives the fruit its color.
B. They have served their purpose and are no longer needed by the plant.
C. The material in the petals, stamen, and sepals become the skin of the fruit.
D. The flower has become dehydrated.
Answers
Answer:
A. The fruit absorb them, which gives the fruit its color
Explanation:
basta yunn
2) Fill in the blanks with the following options.
What was the environment of early earth like? Complete the statement below to answer the question.
a)wind
b)elements
c)gases
d)inorganic
e)organic
f)lightning
g)primordial
______seas absorbed______of the atmosphere, there was a heavy concentration of ultraviolet radiation from the sun, and frequent______strikes, and the environment was helpful in producing______molecules from______molecules.
Answers
Answer:
1.primordeal 2.gases 3. lightning 4.organic 5.inorganic
PRIMORDEAL seas absorbed GASES of the atmosphere,There was a heavy concentration of ultraviolet radiation from the sun, and frequent LIGHTNING strikes, and the environment was helpful in producing ORGANIC molecules from INORGANIC molecules.
Gases are absorbed by the primordial seas and lightning strikes in earth helpful in producing inorganic molecules from organic molecules mostly present in living things.
What is primordial sea?Oceans of earth in the earlier time is called as primordial seas in the history . Primordial seas creates heavy rain last for long time.
Lightening in earth is caused by electrostatic charge from the ions in the atmosphere. Lightening is followed by thunder. Lightning helps to produce oxides and nitrogen in the atmosphere.
The passage which describes the weather in the earth can be completed as follows:
Primordial seas absorbed gases of the atmosphere, there was a heavy concentration of ultraviolet radiation from the sun, and frequent lightning strikes, and the environment was helpful in producing inorganic molecules from organic molecules.
To find more on lightning, refer here:
https://brainly.com/question/10443677
#SPJ2
When you exhale, what happens in the lungs?
A. Air moves from high pressure (in the lungs) to low pressure (outside)
B. Space in the lungs increases
C. Lung pressure decreases
D. Air moves from low pressure (in the lungs) to high pressure (outside)
Answers
Answer:
Conversely, exhalation moves the diaphragm up into the chest cavity and reduces the space in it. This forces the air, which is dense with carbon dioxide at that point, out of the lungs and windpipe. It then exits the body either through the nose or mouth. Usually, this requires no physical effort from the body.
Explanation:
So its A
how do central nervous system and the peripheral nervous system work together to control the body?
Answers
The primary role of the PNS is to connect the CNS to the organs, limbs, and skin. These nerves extend from the central nervous system to the outermost areas of the body.
In conjunction with the central nervous system (CNS), the PNS coordinates action and responses by sending signals from one part of the body to another.
The general flow of information is that the peripheral nervous system (PNS) takes in information through sensory neurons, then sends it to the central nervous system (CNS) to be processed. After processing, the CNS “tells” the PNS what to do—what muscles to flex, whether the lungs need more oxygen, which limbs need more blood, any number of biological processes—and the PNS makes it happen through muscle control. The neurons responsible for taking information to the CNS are known as afferent neurons, while the neurons that carry the responses from the CNS to the PNS are known as efferent neurons.
SOS SOS SOS SOS WILL MARK BRAINLIEST Which statement correctly connects the bee-eater's adaptations with its environment?
The environment determines which bee-eater traits are adaptive.
The bee-eater's traits influence where it chooses to live.
I narrowed it down to these 2 answers. help me xddd
Answers
Answer:A/ the top one
Explanation:
because it’s talking about how they adapt not how they get to the point where they adapt.
If certain traits of the organism help them in the environment, then that trait can be considered adaptive. They are considered adaptive or not based on its interaction with the environment.
two liquids that are at two different temperatures are added to each other in a container is closed . The temperature is taken at one-minute intervals .
Answers
Answer: Graph A
Explanation:
Can someone help me asappp
Answers
Answer:
im 90% sure its D
Explanation:
well
Which component of the biosphere is an example of organic matter?
A. Phosphorus
B. Glucose
C. Carbon dioxide
D. Oxygen
Answers
Select the correct answer from the drop-down menu. The lunar eclipse occurs during the _______ phase. A.new Moon B.full Moon C.first-quarter Moon D.last-quarter Moon
Answers
Answer:
B. full moon
Explanation:
A solar eclipse occurs in the daytime at new moon, when the Moon is between Earth and the Sun, while a lunar eclipse occurs at night at full moon, when Earth passes between the Sun and the Moon.
Can I get Brainliest? TYSMMMMMMMMMMMMMMM
Answer:
the correct answer is . B
Explanation:
Advances in technology have helped many industries, including agriculture. Which agricultural application is most likely
to be affected by new advances in DNA technology from the Human Genome Project?
O a researcher who is investigating selective breeding of livestock
O a farmer who is planning a harvest schedule for genetically modified crops
O a plant scientist who is modifying the genetic information of crop plants in a laboratory
O a conservationist who wants to find water sources in drought-prone places
Answers
Answer:
O a researcher who is investigating selective breeding of livestock
Explanation:
The Human Genome Project (HGP) aims at determining the full nucleotide sequence of the human genome, which can be used for the identification, characterization and mapping of the human genes. The livestock genome sequence exhibits a high level of conservation with the genomes of many mammals including humans. In consequence, the information obtained by mapping genes from the HGP can be of help to map livestock genes. The livestock genome mapping projects have greatly been helped by the increasing availability of human and murine genome sequences, which has been used in comparative genomics for the identification of candidate genes involved in animal traits.
Answer:
A
Explanation:
Which has become the greatest source of environmental change a) acid rain b) energy c) conservation d) human activity
Answers
Answer:
human activity, i think.
Answer:
human activity
Explanation:
Humans can build things acid rain and the others cant,Human Activity has changed most of everything
hurry plz due in five min
Answers
Answer:
Its B the 2nd option
Explanation:
.......
Write a paragraph describing the function of the endomembrane system? Include these terms: DNA, RNA, Ribosome, Endoplasmic Reticulum, Golgi Apparatus, plasma membrane, secretory vesicle, free ribosome, bound ribosome, protein.
Answers
Answer:
Please find the function of the endomembrane system below.
Explanation:
The endomembrane system is a system of membranous organelles in eukaryotic cells which plays the collective role of synthesis, modification, packaging and transportation of lipids and proteins within the cell. The organelles involved are endoplasmic reticulum, Golgi apparatus, vesicles and plasma membrane.
DNA, which is the genetic material in living cells encodes genetic information. The information in DNA is transcribed in the nucleus into a RNA molecule, which is then translated in the ribosomes (organelle for protein synthesis) into PROTEINS. Ribosomes can either be free or membrane-bound depending on whether it produces proteins that are used in the cell or are exported out of the cell respectively. However, ribosomes are attached to the surfaces of endoplasmic reticulum making them called ROUGH ENDOPLASMIC RETICULUM. This makes rough endoplasmic reticulum associated with protein production/synthesis.
The synthesized proteins is then packaged and modified in the GOLGI APPARATUS, after which it is transported by SECRETORY VESICLES that transports it to the PLASMA MEMBRANE for exocytosis.
If a strand of DNA has 24% T, what percent will be G?
Answers
Answer:
points
Explanation:
for freee thanks and sorry
What formed between Australia and Antartica? What was the result of this?
Answers
An incoming ray of light strikes the surface of a calm pool of water. Which letter below indicates the
reflected ray of light?
Answers
If I'm correct its W ....
I have a Lab work who will do it for me I'll give 100 points
promise
Answers
Answer:
Okay, what is it?
Explanation:
When fungi and bacteria decompose organic matter, they return ____ to the environment.
Answers
Answer:
Carbon and nitrogen.
probably
Hope that helped :)
Fungi and bacteria decompose organic matter, contributing to the formation of soil organic matter since they return nitrogen and carbon to the environment.
How is the decomposition of organic matter?Fungi and bacteria break down residues and organic matter, excess nutrients (nitrogen, phosphorus and carbon) are released into the soil in forms that can be used by plants (nutrient availability).The nitrogen released by these microorganisms is in the form of ammonium (NH4+) and thus readily available to the roots of plants and other organisms.By decomposing residues and storing carbon within their own biomass, soil biota play a very important role in nutrient recycling processes.Therefore, we can conclude that the most important function of fungi and bacteria microorganisms is the breakdown of organic materials.
Learn more about the decomposition of organic matter here: https://brainly.com/question/6183920
1. True or False? Climate Change refers to major and long-term changes in the average state;
temperature, precipitation, wind patterns, etc. of the Earth's climate.
Answers
Answer:
True
Explanation:
Climate change is a long-term shift in global or regional climate patterns. Often climate change refers specifically to the rise in global temperatures from ... from the sun's rays inside the atmosphere causing Earth's average temperature to rise. ... Throughout Earth's history, climate has continually changed.
1. precipitation
2. weather
3. temperature
4. windward
5. El Niño
6. The Antarctic Circumpolar Current transports warm water from the Pacific Ocean to the northern Atlantic Ocean. This warms the Atlantic Ocean and increases temperatures in the surrounding region. This reduces seasonal fluctuations in European weather patterns. also
I believe the statement that best compares weather and climate is that Weather refers to the atmospheric conditions at a given time while climate refers to the average weather conditions over an extended period of time. Weather reflects short term conditions of the atmosphere while climate is the average daily weather for an extended period of time at a certain location.
Which 3 characteristics did Darwin observe that were slightly different in a population?
A function, breeding habits, food sources
B form, function, behavior
C behavior, form, food sources
D form, breeding habits, behavior
Answers
Answer:
B. form, function, behavior
Explanation:
The geologic species scale has units based on changes in rocks and fossils.
True
False
Answers
The geological time scale/species scale is divided into different units of time depending on changes in the rocks and fossils. So the statement is true.
What is the geological time scale?
The lengthy period of time that the Earth's geologic history has taken up is known as geologic time. Starting at the beginning of the Archean Eon (4.0 to 2.5 billion years ago), formal geologic time runs to the present.
The Hadean Eon, an informal time period that runs from around 4.6 billion years ago (corresponding to Earth's first creation) to 4.0 billion years ago, is also frequently included in modern geologic time scales. The period of Earth's history that is reflected by and preserved in the planet's rock layers is known as geologic time.
Events throughout Earth's history are "calendared" according to the geologic time scale. It divides all of the time into named units of abstract time known as eons, eras, periods, epochs, and ages, in declining order of duration. Those geologic time units are counted according to stratigraphy, the correlation, and the categorization of rock layers.
Therefore, the geological time scale is used for dividing different units of time according to changes in rocks and fossils. Hence the statement is true.
Read more about geological scale, here
https://brainly.com/question/10662464
#SPJ2
5. Why are microscopes useful tools in biology?
Answers
Answer:
cause to see the small organism that are only seen by microscope
*
Replication can best be described as:
1.making new DNA using the old DNA
2.making RNA using DNA
3.making proteins using RNA
4.making proteins using DNA
Answers
Answer:
2
Explanation:
DNA splits to make RNA
"What would railroads do if every state had different requirements for smokestacks or track width?"
Answers
Answer:
The train will move on the roads.
Explanation:
If every state had different requirements for smokestacks or track width, the trains should be run on the roads because if there is different requirement for track width, it is impossible to run same type of train on these tracks. One another act will be done and that was to make different types of trains for each state so that they can move on the tracks. But it is impossible for having different track width, it must be of same width.