I only need help with problem number 2.

I Only Need Help With Problem Number 2.

Answers

Answer 1

Answer:

Scanning

Explanation:


Related Questions

Do all three bird species occupy the same niche? Explain .

Answers

Answer:

None of the birds have the same niche.

Explanation:

They all have different niches because of the food they ate. Over time, they were gentically changing to adapt to their own food.

Scientists find the fossilized remains of a fish in the middle rock layers of a research site. They find the fossil of an insect in the lowest rock layers.
What can be concluded from this evidence?

A. the insect lived before the fish

B. the insect lived on the bottom of the ocean that the fish lived in

Answers

It is A I think the insect lived first and so it is under because it is under a different layer so if they were around at the same time and the fish was just under water it would be in the same layer of rock but because it is different rock it was not around at the same time

Help me on this question please.

Answers

Answer:

The answer would be D because, stars have nothing to do with the water cycle.

answer:

the stars appearing to move through the night sky.

- so option D.

Can the change in cyclin concentration during mitosis be explained by the fact that the cell divides in two and thus divides the material in the cell into two smaller volumes

Answers

Answer:

No, because cell division is expected to decrease not only the net amount of cyclin molecules in daughter cells but also the volume of these daughter cells compared to the original parent cell, and therefore the concentration should be nearly equal.

Explanation:

When a cell divides to produce two daughter cells, the cell components including its previously duplicated genetic material (DNA), organelles, signaling molecules, fatty acids (lipids), proteins, etc., are distributed into daughter cells. These daughter cells have a smaller volume compared to the original parent cell. In consequence, the concentration of cellular components (including cyclin proteins) should be similar between parent cell and daughter cells.

A change in DNA could alter the amino acid order which will affect the folding of the protein, and therefore it's function.

Answers

Answer:

true

Explanation:

When there are more molecules, there will be less energy.

Answers

The more molecules move the more kinetic energy they have. I hope that helped
Energy, potential energy, is stored in the covalent bonds holding atoms together in the form of molecules. This is often called chemical energy. Except at absolute zero (the coldest temperature it is possible to reach), all molecules move. This movement is a form of kinetic energy, and the more the molecules move the more kinetic energy they have. Molecules in solids don't move much, they just vibrate. Molecules in liquids move faster and further, but they stick together enough to hold them in a small volume - the liquid. In a gas, however, the molecules are moving fast (over 1,000 miles per hour), moving in all directions, and don't stay together so they spread out and fill the available volume.

Matter and energy always flow from the
in ecosystems.
A. consumers to the producers
B. heterotrophs to the autotrophs
C. autotrophs to the consumers

Answers

Answer: When organisms use organic matter for cellular respiration, ALL the goes back into carbon dioxide, water, and minerals, while ALL the energy leaves the ecosystem as heat. So matter cycles, energy flows through ecosystems. So It is C

Explanation: A. The producers generate food for themselves and others; consumers do not produce anything, instead eating producers, other consumers or both.

B. Autotrophs make food for their own use, but they make enough to support other life as well.Heterotrophs cannot make their own food, so they must eat or absorb it.

So C is correct

Matter and energy always flow from the in ecosystems from autotrophs to the consumer.

What is ecosystem?

The energy flow in the ecosystem is one of the important factors that enables the survival of such a huge number of animals. An ecosystem is made up of a network of connections between living and non-living elements.

All of the energy needed by living things is provided by the sun. About 1% of all radiant energy is absorbed by green plants and distributed throughout the ecosystem.

According to the first law of thermodynamics, energy cannot be generated or destroyed. The energy source, in this case solar energy, cannot be created or destroyed. It can only be moved from one system to another, just like a form is moved from one form to another.

Therefore, Matter and energy always flow from the in ecosystems from autotrophs to the consumer.

To learn more about energy, refer to the link:

https://brainly.com/question/1932868

#SPJ2

Chromosome structure can be microscopically observed best during​

Answers

i believe the answer is mitosis

Which is a step of the scientific method in environmental science? A. Testing a hypothesis B.Carrying out research C.Collecting ideas from boocks is a step in the scientific method. The step that follows this step involves forming A.a judgment B.a conclusion C .notes .

Answers

Answer:

The correct answer is Option B (Carrying out research). The step that follows this step involves forming B.a conclusion

Explanation:

The Natural environment  around us is a function of both the living things and the non-living things. So, environmental science is the study of the natural environment around us. This study includes how to tackle environmental problems and further study on how humans could be impacted by the interactions with their environment. The scientific method is a step taken towards ensuring development in a field by bringing new discoveries and challenging existing beliefs through scientific tests and research. Generally, for most scientific methods of many fields, it starts with:

1. Observations

2. Making inquiry which involves asking questions

3. Forming a hypothesis, which means making untested assumptions

4. Conducting an experiment to check the hypothesis

5. Analyze the results

6. Publish the results

The correct answer is Option B (Carrying out research). Because it involves the scientific method highlighted above. The step that follows this step involves forming B.a conclusion



Match each cloud type with its image.

Cirrus
Cumulus
Stratus
Cumulonimbus
Fog

Answers

The name of the clouds with respect to its image are given below:

A ----- Cumulonimbus.B ----- Stratus.C ----- Cirrus.D ----- Fog.E ----- Cumulus.

What do you mean by Clouds?

Clouds may be defined as an observable mass of particles of crystallized vapor suspended in the atmosphere of a planet or moon.

The major function of the clouds is to prevent yourself from the sun's intense heat during the day while to limiting the extremely cold at night.

Therefore, it is well described above.

To learn more about Clouds, refer to the link:

https://brainly.com/question/1783904

#SPJ2

describe the regions where the process of crystallization happens
most often

Answers

In polar regions vapor deposition is the primary method of crystal growth in the upper fairing

Explanation:

hope this helps have a nice day :) ♡

Please help me guys!!
Look at the number of deer in “predation” and “starvation” columns. What conclusions can you draw about the introduction of the wolves on these values?

Answers

Answer:

This is because when the wolves preyed on the deer, their population got regulated. Due to this, the competition for resources amongst the surviving deer population got reduced resulting in low starvation.

This is because the deer's numbers were controlled when wolves preyed on them. As a result, there was less rivalry for resources among the remaining deer population, which led to decreased hunger.

"Predation" and "starvation" are both ecological concepts related to the interactions and dynamics of populations within ecosystems.

Predation is a biological interaction in which one organism, called the predator, hunts, captures, kills, and consumes another organism, known as the prey. Predation is a common relationship in nature, observed across various taxa, such as carnivores hunting herbivores or parasites feeding on host organisms.

Starvation refers to the condition in which an organism suffers from a lack of sufficient food or nutrients required for its survival and normal functioning. When resources become scarce or unavailable, individuals within a population may not obtain enough food to sustain themselves.

Therefore, there was less rivalry for resources among the remaining deer population, which led to decreased hunger.

For more details regarding "Predation" and "starvation", visit:

https://brainly.com/question/17407899

#SPJ6

What is the difference between plastic CONSUMPTION and plastic WASTE?

Answers

Answer:

plastic consumption is like using a lot of plastic and plastic waste is when you throw out a lot.

Explanation:

consumption means like eating /using

waste means throwing out / not really using

hope this helped. btw I'm not sure if this is right but I hope it is!

I don’t understand how to do this

Answers

Answer:

Translation: GAUGCUUCCAACGACCACTA

Transcription:

GTACGAAGGTTGCTGGTGAT

GATGCTTCCAACGACCACTA

Explanation:

Economic impact of aflatoxin on health and agriculture

Answers

Answer : contamination in crops results mainly from a reduction in marketable volume

Aflatoxin consumed contributes to the mutagenic , carcinogenic , teratogenic , and immunosuppressive health effects in humans.

The direct economic impact of aflatoxin contamination in crops results mainly from a reduction in marketable volume, loss in value in the national markets, inadmissibility or rejection of products by the international market, and losses incurred from livestock disease, consequential morbidity and mortality.

Explain how the structure of DNA is important in the synthesis

Answers

Answer:

DNA is the primary genetic material contained within your cells and in nearly all organisms. It's used to create proteins during protein synthesis, which is a multi-step process that takes the coded message of DNA and converts it into a usable protein molecule.

Explanation:

Explain what happened to the spread of the infection as more individuals were vaccinated.

Answers

Answer: As a result of more people being vaccinated the spread of the infection slowed down.

Where are the photoreceptors located inside a human eye?​

Answers

Explanation:

retina

photoreceptor; rod and cone

Rods and cones are photoreceptive cells located in the retina of the eye.

Which of the following statements is true? The shape of DNA is a triple helix. DNA mutations never affect an entire chromosome. Mutations in egg and sperm cells are inherited by offspring. Reginald Punnett discovered patterns of inheritance during pea plant experiments.​

Answers

Answer:

Reginald Punnet discovered patterns of inheritance during pea plant experiments

Explanation:

is there more than one right answer

✧・゚: *✧・゚:*  Answer:  *:・゚✧*:・゚✧

✅ Reginald Punnett discovered the theory of incomplete dominance during flower experiments.   ~ ₕₒₚₑ ₜₕᵢₛ ₕₑₗₚₛ! :₎ ♡ ~

Are you for, against or undecided on GMOs? Explain.
Please give your opinion <3

Answers

Answer:

AGAINST for sure

Explanation:

ive personally raised GMO animals and they have no life. like chickens at the age of 8 weeks the breasts on GMO chickens are so large they are unable to walk and if u do not butcher them they will have heart attacks at around 9 weeks. they also dont get to go outside and walk around bc that makes them lose weight. so most of the GMO chickens do not get to go outside and actually have clean air. let alone see the sun light and stand in grass.

I NEED HELP The measure of how resistant a solid is to shape change when a force is applied.

Answers

Hardness is a measure of how resistant solid matter is to various kinds of permanent shape change when a force is applied Macroscopic hardness is generally characterized by strong intermolecular bonds, but the behavior of solid materials under force is complex; therefore, there are different measurements of hardness: scratch hardness, indentation hardness, and rebound hardness. Hardness is dependent on ductility, elastic stiffness, plasticity, strain, strength, toughness, viscoelasticity, and viscosity. Common examples of hard matter are ceramics, concrete, certain metals, and super hard materials, which can be contrasted with soft matter.

Difference between second level consumer and third level consumer

Answers

Answer:

Second-level Consumers - consumers that get their energy from first-level consumers and/or producers. Carnivores - organisms that eat only other animals. Third-level Consumers - consumers that eat second-level consumers and/or first-level consumers.

PLEASE HELP 47 POINTS ASAP

There is an amusement park based on sea life. Its purpose is to get the public interested and caring about conservation of the world’s oceans. Some of the profits from this organization go toward funding ocean research and conservation. In order to get people interested, some of the shows that the park offers include large marine mammals that do tricks. Some of the larger marine animals are housed in pools for viewing instead of being allowed to live in their natural habitat. They also have rare and endangered species on display to help increase awareness of them. They even have a breeding program for the some of the endangered animals.

Describe an ethical concern that would be related to this park.

Answers

Answer:

The animals don't know outside of that habit because that where they were born. If they were to be released they would die because they are not used to having to fend for themselves.

Explanation:

Why is crossing over of the chromosomes during meiosis
important?

Answers

Because it increases the genetic variability, offering more combinations of genotypes.

3. Scientists who study the cell cycle use fluorescent dyes and lasers that enable them to measure the DNA content of individual cells. They can count the number of cells with 2N and 4N DNA content, as well as in between 2N and 4N (greater than 2N, but not quite 4N yet). a. In what phase(s) of the cell cycle will cells have 2N DNA content

Answers

Answer:

G1 phase

Explanation:

The cell cycle is divided into 2 major phases

1. The interphase

2. The m phase

The interphase, in chronological order, is further subdivided into

G1 phaseS phaseG2 phase

Cells grow and develop at the G1 phase while the G2 phase is characterized by protein synthesis in addition to continued growth.

The DNA of a cell in interphase is doubled at the S phase. This means that if a cell has a 2N amount of DNA at the beginning of the S phase, the amount of DNA at the end would have become 4N. This amount of DNA is shared into 2 daughter cells in equal amounts during mitosis or the m phase, meaning that each daughter cell would have a 2N amount of DNA before entering the interphase.

Hence, cells will have 2N DNA content in a period that spans through the end of the m phase of the cell cycle to the beginning of the S phase of the same cycle. This means that cells at the G1 phase would be the ones with 2N DNA contents.

Cell grows and prepare itself for replication in the G1 phase cell cycle. In G1 phase of cell cycle, cell is in 2n state.

Cell Cycle:

Cell cycle is the life cycle of the cell in which cell grow and divide. This completes in 2 phases,

InterphaseM- phase

Interphase:

Cell grows in this phase and prepare to divide. This includes 3 phases,

G1 phase In this phase cell, grow and prepare for replication.S- phase : Cell synthesizes its DNA via replication. In S- phase cell is in 4n stage. G-2 phase: Cell prepares itself for division.

M- phase:

Cell condenses its chromosome and divide into 2 cell.Since, cell replicates its DNA in S-phase.

Therefore, in G1 phase of cell cycle, cell is in 2n state.

To know more about the cell cycle, refer to the link:

https://brainly.com/question/11009129

What is a daughter cell?

Example: "When a cell in the body divides, it will pass on a copy of its DNA to each of its daughter cells."

Answers

Answer:

Explanation:

Daughter cells are produced after a single cell undergoes cell division. During mitosis, one pair of daughter cells is created after one round of DNA replication. In mitosis, a single cell becomes two identical cells. ... Daughter cells in this sense are actually closer to clones

Which molecule in the equation represents food energy made by plants? A Carbon dioxide B Water C Glucose D Oxygen

Answers

Answer: Glucose

Explanation: Photosynthesis is a set of chemical reactions that uses energy from the sun and carbon dioxide to produce sugar and oxygen. The sugar provides plants with energy to grow.

Two rabbits have different parents. One rabbit has ears that flop over, and the other rabbit has ears that stand straight up. Why do the rabbits have ears with different shapes?

Answers

Answer:

The rabbits have different versions of the gene for ear shape, which instruct for different proteins that make differently shaped ears. A Father sheep has curly wool while a Mother sheep has straight wool.

Explanation:

I majored in Biology

Answer:

Explanation: Each rabbit has a different ear shape because they have different versions of the gene for ear shape that connect together to make different ear shapes. - D

Empathy means that you can communicate well with others.
A.
True
B.
False

Answers

Answer:

A. true

Explanation:

i mean if you have empathy then yeah it's true

Answer:

A

Explanation:

It means you have the ability to feel what someone is experiencing.

At a warm front warm air meets and moves cold air

Answers

what? what u need?!!!!
Other Questions
Solve the inequality:2(x = 5) > 4 SOMEONE PLEASE HELP I NEED THIS IN LIKE 10 MINUTES THANKSThe graph of f(x) = (0.5)* is replaced by the graph of g(x) = (0.5)* k. If g(x) is obtainedby shifting f(x) down by 7 units, then what is the value of k?k=1k=-1/7k=7k=-7 HELP URGENT PLEASEEEEE 1. Jiyoung spent $82 at Uniqlo on shirts and shorts. She lost the receipt but knows that the shirts are$11 each, and the shorts were $9 each. If Jiyoung bought 5 shirts, how many shorts did she buy?2. Normally, Bath and Body Works sells scented lotions for $9 each. During the holidays, they have aspecial deal: $15 for 3 lotions. If Angela buys 6 lotions, how much money would she save if she paidfor the holiday special instead of the regular price?3. Game cards go for $3 for 10 cards. If Angelina spent $18 on cards, how many cards does she havein total?4. Liana has Apple music, which costs $17 each month. One month, she buys 8 songs for $2 each. Howmuch money did she spend on her Apple music account that month?5. A gardener uses 4 plots of land to plant 5 fruit trees each. On each of the fruit trees, there are 3pieces of fruit. If the gardener picks 17 fruits in total, how many pieces of fruit are there left on theland?6. Alisha is composing a pop song. Her song has 6 half notes, which have 2 beats each, and 12 wholenotes, which have 4 beats each. Alisha gives her song to a composer, who divides the notes intogroups of 4. How many groups are there in total?7. The Harry Potter book series has 7 books. Each book has around 400 pages each. If it takes Irwin 1month to finish 200 pages, how many months will it take Irwin to finish the entire book series?8. Most movies are around 2 hours long. Martin spends a full day watching 4 movies. During winterbreak, he has a whole week to watch movies. If he needs to add 2 hours each day for lunch anddinner, how many hours has Martin wasted watching movies and eating?9. Johinder can type 30 words a minute. He spends 4 hours typing a book. If divides his book into 20chapters, how many words are in each chapter?10. There are 12 students in a 4th grade class. Mr. Erwin needs is printing math packets for the class andneeds one for himself as well. Each math packet has 6 pages, and Mr. Erwin also needs an extra pagefor his answers. How many pages does he need to print out in total?11. On a chessboard, two team have 16 pieces each. Half of the pieces are pawns, and they are alldestroyed. If 2 knights are also destroyed, how many pieces are left in play?12. Azita has 24 coworkers. She is going to buy donuts for them. Dunkin Donuts sells donuts in boxesof 6. She buys 9 boxes of donuts. After everyone else eats 2 donuts, how many are left for Azita?13. Ursula buys 300 ounces of beef from the supermarket. She splits the beef into 6 groups and makesmeatballs with them. If she makes 25 meatballs with each group, how much does each meatballweigh?ANSWER ALL OF THIS FFOR ME PLS WITH EXAMPLES Crust is destroyed: A. At the lithosphere.B. Near ocean trenches.C. Near ocean ridges.D. Near a divergent boundary. Whats the answer? For every 4 small popcorns sold at the theater there were 3 large popcorns sold. If the theater sells24 small popcorns, how many large popcorns did they sell?(HURRY PLEASE) The play is set only shortly before the Titanicsank. Why did Priestley choose this moment forhis play to be set? Ignore number 6, I need help with number 5. Please help!!! true it false: Liquid molecules have more room to slide past one another which ls why they can easily change shape true or false: the fossils record cannot help us understand the transition between organisms Which factors most contributed to Washington's growth and led to statehood? Check all that apply.the development of a new system of roadsthe construction of railroads in the areathe increase in the territory's populationthe expansion of commercial fishingthe expansion of the timber industryOthyhexpansion of cotton production ILL GIVE BRAINLIEST !!!!! You sit down at your desk and notice that your pencil is gone. The boy sitting beside you is writing with what appears to be your pencil. Explain a good way to handle this situation. (no violent answers pls) A 500 kg roller coaster moving at 15 m/s suddenly comes to a stop at the end of the ride. How much work energy was needed to stop the coaster? write hydrometer uses how do the characters in the legend of daragang magayun corerespond in real life I'll GIVE BRAINLY THINGThe cost of 6 sandwiches and 4 drinks is $50. The cost of 3 sandwiches and 6 drinks is $74. How much does one drink cost?$1.50$1.75$2.50$3.00 1. Based on the map above, where did Zheng He's voyage begin? I'm done with this test, just exhausted from it. Brainly do your magic. "Simple living and high thinking is the high appreciate it and motivating principle of Mohandas Ghandhi." Justify this principle on the basis of their appropriate logic. solve this math problem. Estimate it by giving whole number. Show working also. (ESTIMATE, NOT WORK OUT) :)