Identify the type of mutation that occurred and explain in what way it affected the protien

Identify The Type Of Mutation That Occurred And Explain In What Way It Affected The Protien

Answers

Answer 1

Answer:

The type of mutation that occurs when in the DNA strand there is a change from guanine to cytosine is a nonsense mutation, since the triplet that should encode the amino acid encodes a stop codon and the protein cannot be completely synthesized.

Explanation:

The nonsense mutation consists of a change in one of the bases of the stranded DNA, which is transcribed into an altered mRNA, producing a stop codon, instead of an amino acid.

In the table it is observed that the CCA codon is a stop codon that cuts off the protein synthesis prematurely, leaving it incomplete and probably non-functional.

Sometimes this type of mutation can alter the sequence of amino acids but the protein may be complete enough to partially fulfill its function.


Related Questions

What process forms water vapor to turn into clouds?​

Answers

Answer:

condensation

Explanation:

The water cycle

evaporation--> condensation--> precipitation-->repeat

What is an example of the lithosphere?​

Answers

Answer:

Rocky Mountain range in western North America.

Explanation:

Lithosphere is defined as the rock and crust surface that covers the Earth.

The lithosphere is the solid, outer part of the Earth. The lithosphere includes the brittle upper portion of the mantle and the crust, the outermost layers of Earth’s structure. It is bounded by the atmosphere above and the asthenosphere (another part of the upper mantle) below.

Although the rocks of the lithosphere are still considered elastic, they are not viscous. The asthenosphere is viscous, and the lithosphere-asthenosphere boundary (LAB) is the point where geologists and rheologists—scientists who study the flow of matter—mark the difference in ductility between the two layers of the upper mantle. Ductility measures a solid material’s ability to deform or stretch under stress. The lithosphere is far less ductile than the asthenosphere.

There are two types of lithosphere: oceanic lithosphere and continental lithosphere. Oceanic lithosphere is associated with oceanic crust, and is slightly denser than continental lithosphere.

How the Lithosphere Interacts with Other Spheres

The cool, brittle lithosphere is just one of five great “spheres” that shape the environment of Earth. The other spheres are the biosphere (Earth’s living things); the cryosphere (Earth’s frozen regions, including both ice and frozen soil); the hydrosphere (Earth’s liquid water); and the atmosphere (the air surrounding our planet). These spheres interact to influence such diverse elements as ocean salinity, biodiversity, and landscape.

For instance, the pedosphere is part of the lithosphere made of soil and dirt. The pedosphere is created by the interaction of the lithosphere, atmosphere, cryosphere, hydrosphere, and biosphere. Enormous, hard rocks of the lithosphere may be ground down to powder by the powerful movement of a glacier (cyrosphere). Weathering and erosion caused by wind (atmosphere) or rain (hydrosphere) may also wear down rocks in the lithosphere. The organic components of the biosphere, including plant and animal remains, mix with these eroded rocks to create fertile soil—the pedosphere.

The lithosphere also interacts with the atmosphere, hydrosphere, and cryosphere to influence temperature differences on Earth. Tall mountains, for example, often have dramatically lower temperatures than valleys or hills. The mountain range of the lithosphere is interacting with the lower air pressure of the atmosphere and the snowy precipitation of the hydrosphere to create a cool or even icy climate zone. A region’s climate zone, in turn, influences adaptations necessary for organisms of the region’s biosphere.

Answer:

Mountains, fields, rocks, cliffs, etc.

Hope this helps! Have a great day

Explanation:

Which statement correctly describes transpires during a chemical reaction?

Answers

Answer:

Melting but if it is radiactional is evaporating

What happens to red blood cells when placed in a hypotonic solution?

Answers

Hope this helps this is what I used when I studied this

A 10.0 cm3 sample of copper has a mass of 89.6 g. What is the density of copper?

Answers

Answer:

[tex]\boxed {\boxed {\sf d=8.96 \ g/cm^3}}[/tex]

Explanation:

Density can be found by dividing the mass by the volume.

[tex]d=\frac{m}{v}[/tex]

The mass of the copper is 89.6 grams.

The volume is 10 cubic centimeters.

[tex]m=89.6 \ g\\v= 10 \ cm^3[/tex]

Substitute the values into the formula.

[tex]d=\frac{89.6 \ g }{10 \ cm^3}[/tex]

Divide.

[tex]d=8.96 \ g/cm^3[/tex]

The density of copper is 8.96 grams per cubic centimeter.

How do structures in organisms compare with structures of non-living things such has construction cranes, buildings, ships, airplanes, or bridges?

Answers

They all are able to break down

A line passes through the points( -3,-4) and (6,2)

Answers

What are you asking? Slope? If so. You would do change in y over change in x. So subtract 2 and -4 to get positive 6, then subtract 6 and -3 to get positive 9. Your slope is either 1/3 if it’s increasing, or negative 1/3 if it’s decreasing.

Answer:

y = ⅔x - 2

Explanation:

We can solve for a linear equation of a line that passes through these two points by the elimination method and then substitute.

We simply write these two points in the form y = mx + c, where m is the gradient and c is the y-intercept (offset). So:

-4 = -3m + c

2 = 6m + c

____________ -

We can first eliminate c to solve for m and then substitute m back into either equation to solve for c. (See attached image for solving steps)

Then, we get:

m = ⅔

c = -2

so y = ⅔x - 2

Which cellular process breaks down simple sugars to release energy?
O A. mitosis
O B. photosynthesis
O C. respiration
O D. waste elimination

Answers

Answer:

C. respiration

Explanation:

Blood has a lower concentration of hydrogen ions than cellular cytoplasm. What does that tell us about the pH?

Answers

Answer:Acids and bases In the human body, both blood and the cytosol (watery goo) inside of cells have pH values close to neutral. ... A base, in contrast, raises pH by providing hydroxide (OH −start superscript, minus, end superscript) or another ion or molecule that scoops up hydrogen ions and removes them from solution.

Explanation:

Open Response 2 part A: Plant cells and fungal cells have many of the
same types of organelles. Structures X and Y are found in both plant cells
and fungal cells. Structure Z is found in plant cells, but not in fungal cells. A
- What is party?
X
Z

Answers

The answer will be z because u can dance and take the L on black kids

if 28% of the bases in a DNA strand are guanine, what percentage are thymine

Answers

Answer:

22%

Explanation:

According to Erwin Chargaff in his complementary base pairing rule, a DNA molecule consists of four nucleotide bases that pair with one another in the follow order: Adenine (A) to Thymine (T), and Guanine (G) to Cytosine (C).

According to Chargaff, the amount of Adenine in the DNA equals the amount of Thymine while the amount of Guanine in the DNA equals the amount of Cytosine. The sum of all the bases equals 100%. That is;

A + T + G + C = 100%

In this question, if 28% of the bases in a DNA strand are Guanine, the amount of Cytosine will also be 28%. Hence,

28% + 28% + A + T = 100

56% + A + T = 100

A + T = 100% - 56%

A + T = 44%

Since, A = T

A/T = 44/2

A/T = 22%

Hence, the amount of Thymine in the DNA strand will be 22%

Which statement below does NOT correctly describe water's chemical
properties?

a. Water is a neutral substance - it is neither a base or acid

b. Water is an inert substance

c. Water is not flammable or combustible

d. Water is reactive and catalyzes many reactions that take place inside living things

Answers

Answer:

b.

Explanation:

This is incorrect, because, "water is a powerful accelerator of chemical reactions."

Credit to www.astronno.com

Graves’ Disease is an autoimmune disorder that causes an overproduction of the hormone produced in the thyroid. These hormones are responsible for cellular metabolism. What would this disorder probably result in?

Answers

Answer:

Explanation:

Graves' disease is an autoimmune disorder in which antibodies produced by your immune system stimulate your thyroid to produce too much T4. It's the most common cause of hyperthyroidism. Hyperfunctioning thyroid nodules (toxic adenoma, toxic multinodular goiter or Plummer's disease).

Can someone help me with this question please?

Answers

Answer:

B

Explanation:

They use echolocation (sound waves) because they cannot see the bottom of the ocean.

Good luck!

Which of the following is the most important reason to maintain a high level of cardiovascular health?
A. A higher level of fitness makes it easier to develop larger muscles.
B. A higher level of fitness makes you more attractive to other people.
C. A higher level of fitness allows you to live a longer, healthier life.
D. A higher level of fitness improves your IQ.

Answers

Answer:

C

Explanation:

I think because the more healthier you are, the longer you'll live

Why is ATP production Constant?

Answers

Regulation
It is vital that the level of ATP in cells remains constant, especially when the demand for energy increases. ... Although high levels of reactive oxygen species lead to cell death and disease, low levels of these species are important for regulating normal cell processes.

Proteins and carbohydrates have many functions in the body of an organism. Specific proteins and carbohydrates perform specific tasks. Information about

a protein and a carbohydrate is given below.

Ferritin

Ferritin is a protein containing Iron, which is

needed by all living things. Iron is found

In hemoglobin and in cytochromes, which

function in metabolism. Free iron can

damage proteins, lipids, and nucleic acids.

Glycogen

Glycogen is a carbohydrate that consists of

glucose molecules. It can be hydrolyzed as

glucose as needed by an organism.

How are ferritin and glycogen similar in their primary functions for an organism?

O Both store materials needed by the organism.

Both store energy used by the organism.

Both support the structure of the organism.

O Both store information for the organism.

Answers

Answer:

Both store materials needed by the organism.

Explanation:

Proteins and carbohydrates are two biomolecules present in living organisms. They perform varying functions in the body of an organism. According to this question, a specific protein (ferritin) and carbohydrate (glycogen) is described.

Ferritin is a protein molecule containing Iron (Fe). Iron is needed by living organisms as it plays a vital role in organism's metabolism. On the other hand, glycogen is a carbohydrate molecule that is made up of glucose molecules, needed by living organisms.

Based on the description of the two biomolecules provided, they are similar in their primary functions for an organism in the sense that THEY BOTH STORE MATERIALS (glucose and iron) NEEDED BY AN ORGANISM.

Which best describes the process of insertion?

A.occurs when part of a chromosome breaks off and is placed into the middle of another chromosome

B.occurs when part of a chromosome breaks off and reattaches backward on the same chromosome

C.occurs when part of a chromosome breaks off and does not reattach

D.occurs when part of a chromosome breaks off and attaches to another chromosome

Answers

Answer:

A.occurs when part of a chromosome breaks off and is placed into the middle of another chromosome

Explanation:

Edge 2020

Answer:

A

Explanation:

EDGE2021 :-)

Have a nice day! ^-^

Question 1 of 10
What do proteins, carbohydrates, and lipids have in common?
O A. They are all made of chains of nucleic acids.
O B. They all use peptide bonds to bind amino acids.
O C. They are all formed from the same elements.
O D. They all contain the instructions for building organisms.

Answers

Answer: They are all formed from the same elements.

Answer: the answer is c

Explanation:

EASY 7TH GRADE SCIENCE FIRST PERSON MARKED BRAINLIEST!!!!

Which information does a student need to differentiate between the speed and the velocity of a vehicle in motion

A. The rate of the motion
B. The direction of the motion
C. The change in the amount of motion
D. The amount of distance traveled during motion

Answers

Answer: The action from a force can cause an object to move or can speed up accelerate, to slow down (decelerate), to stop, or to change direction. Since any change in velocity is considered acceleration, it could be said that a force on an object results in the acceleration of a object.

Explanation:

Answer:

(B) The direction of the motion

Explanation:

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Answers

Answer:

u want step by step?

Explanation:

Give the mRNA strand for the following DNA strand: ATACGATA
A. TATGCTAT
B. UAUGCUAU
C. TUTCGAUA
D. UATGCUAT

Answers

Answer:

every t is changed to u, the rest is the same.

Explanation:

B. UAUGCUAU

B) UAUGCUAU
B is going to be your answer

HELP ASAP EMERGENCY NEED NOW BRAINLIEST 100 POINTS!
A diagram showing two plates colliding, with one plate moving below the other. What type of plate boundary is illustrated in the image? What is the movement of one plate below another called?

Answers

Answer:

Convergent

Subduction

Explanation:

Answer:

B. convergent

C. subduction

Explanation:

Which example has the most kinetic energy a football resting on a kicking tee a hurt football player sitting on the bench a football flying through a goal post a penalty flag on the ground

Answers

Answer:

The football flying through the goal

Explanation:

Kinetic energy is basiaclly moving energy. Since only the football going through the goal is moving, that's the one with the most kinetic energy.  

(2) Which of the following describes the movement of particles down/ with a concentration gradient and how ?
Question options:

a)

Osmosis

b)

active transport

c)

diffusion

d)

both osmosis and diffusion

Answers

Answer:

Both osmosis. And diffusion

A yellow-skinned CHNOPS meets the blue-skinned CHNOPS of their dreams. They get married and have a green-skinned CHNOPS baby. What type of inheritance (Complete dominance, Incomplete dominance, or Co-dominance) is illustrated by this example? Pick the best answer with the correct justification
A.Complete dominance, because it blends
B.Incomplete dominance, because you see two traits
C.Co-Dominance - because it blends D.Co-Dominance, because you see two traits
E.Incomplete dominance, because it blends
F.Complete dominance, because you see two traits​

Answers

Answer:

uwiwiwuwwieh

Explanation:

Answer

co-dominance

recessive

Explanation:

100 on edge trust me!!

fill in the complementary bases according to the base-pair rule.

a | t | c | c | g | a | t | a | g | c | t | t | a | g

Answers

t/a/g/g/c/t/a/t/c/g/a/a/t/c

Christopher Columbus used the presence of suspended seaweed in the ocean to
determine how far away he was from the coast of the Africa. Seaweed, or kelp, is
placed under the Protista kingătom. What type of protist did Columbus see?
a)protozoa
b) slime mold
c) water mold
d) brown algae

Answers

Your answer is d he saw brown algae

Brown algae is the type of protist Columbus saw. Therefore, option (D) is correct.

What are brown algae?

Seaweed is a type of brown algae, which is a type of protist that belongs to the kingdom Protista. Brown algae are large, multicellular algae that grow in the ocean and are often found in shallow, warm waters. They have a complex structure and are made up of many cells that are organized into tissues and organs. Brown algae are photosynthetic, meaning they use sunlight to produce energy and nutrients, and they are an important source of food and habitat for many marine organisms.

Other types of protists include protozoa, which are single-celled, heterotrophic organisms that can move using cilia, flagella, or pseudopodia; slime molds, which are fungi-like organisms that can move and are often found in moist environments; and water molds, which are fungi-like organisms that can grow in water and can cause disease in plants and animals.

Learn more about brown algae, here:

https://brainly.com/question/8717436

#SPJ2

What term describes the strings of ribosomes that are attached to an RNA transcript at one time?
A. release factors
B. spliceosomes
C. transcription factors
D. mutagens
E. polyribosomes

Answers

Answer:

Polyribosomes.

Explanation:

During translation, the subunits of a ribosome surround the transcript and read down stream until they reach the start codon and begin polypeptide synthesis. Once the start codon is exposed, it is available for another ribosome to form around it, thereby initiating another locale for translation. Together the strings of ribosomes are called polyribosomes.

Why does it take longer for your body to break down complex carbohydrates than simple carbohydrates?

Answers

Explanation:

complex carb pack more nutrients are simple carbs that are high in fiber and digest more slowly this makes them more ceiling which means a good option to for weight control

The small intestine is where carbohydrates are chemically broken down, instead of the stomach. The disaccharides and pancreatic amylase complete the chemical cleavage of digestible carbs.

What are the complex carbohydrates in the body?

The building blocks of large polysaccharides are lengthy, complicated chains of sugar molecules.

Peas, beans, whole grains, and vegetables are examples of foods that are sources of complex carbohydrates. The body converts simple and complex carbohydrates into glucose (blood sugar), which is then used as fuel.

Longer-lasting blood glucose increase and longer-lasting energy elevation are produced by complex carbs.

Therefore, complex carbs are more efficient in giving the body energy, which is the main purpose of carbohydrates.

Learn more about complex carbohydrate here:

https://brainly.com/question/9384195

#SPJ2

Other Questions
100 point question Read the event from Esperanza Rising.Which best describes Esperanza's response to theevent?AbelIsabel introduced Esperanza to Irene and Melina, twowomen who were hanging clothes to dry on a long linestretched between the cabins and a tree. Irene hadlong gray hair tied in a tail. Melina didn't look mucholder than Miguel and she already had a baby of herown.O Esperanza is homesick when she hears Melinatalking.O Esperanza is excited to talk about friends in her oldhometown.O Esperanza is angry that she had to leave Mexico.O Esperanza is uncomfortable talking to poorworkers."We heard the story of how you came fromAguascalientes," said Melina. "My husband is fromthere. He used to work for Seor Rodrguez." Most of the early settlements in Arabia were locatedA along the coasts.B along the rivers.C near the lakes.D on the southern border. 50% of 70Help!! It's due by 10:00pm!! In a particular country railroad miles have been on the decline and the miles of roads in the highway system have been increasing. The function y=-1250.2x + 142,602 represents the railrond miles, while the function y=501.5x + 158,449 models the number ofhighway miles. For each function, x is the number of years after 1995b. Find the year in which it is estimated that the number of the country's railroad miles and the number of the country's highway miles were the same.It is estimated that the number of railroad miles and the number of highway miles were the same during the year ___.(Round down to the nearest your) Someone please help due in 5 minutes! Help please ASAP Thank you if receiver travels 54 yards in 9 seconds whats the average speed 20 POINTS!!!!!!!!!!!! AND BRAINLIEST!!!!!!!!!!!!!Imagine life in Canada. Write a journal entry from the point of view of a sled dog. write at least 10 sentences. The recently released iPhone XS Max comes in three different storage sizes: 64GB, 256GB, and 512GB. The price of the 64GB phone is $1,099. If prices were proportional to the phone's storage size, how much would the 256GB phone and the 512GB phone cost The thoughts and ideas of enlightenment philosophers, such as john locke inspired Jefferson to write about what type of right in the declaration of independenceA) intangible rights B) unalienable rightsC) human rights D) civil rights its for science but its got math involvedits got to do with speed, time, and distance H shows the ratio of pencils to pens sold at the school bookstore. If the bookstore sells 15 pencils, what is the ratio of pencils to pens sold written as a fraction? answer for brainly, any absurd or incorrect answers will be flagged and deleted. this is geometry proofs "When you are content to be simply yourself and don't compare or compete, everyone will respect you." This quote best matches the philosophy of: There are 5 lunch choices in a hospital cafeteria: Salad, Pizza, Spaghetti, Sub Sandwiches and Soup. The percentage of people that chose Pizza is 25%. If 50 people chose pizza, what is the total number of people at ate lunch? Ruth won young star award in which year ? In the sentence below, how does the underlined word affect the tone? "When the leaves are turning bright colors," It implies the writer's disinterest. It is neutral, and has little effect. It creates a cheerful tone. It signals danger. What two electron carrying particles does the electron transport chain use to get the energy it needs tomake ATP? what is principal in simple intrest Select the transformations of g(x) = |- 2x + 6| in relation to the parent function.A) Translated right 3 unitsB) Translated left 3 unitsC) Reflected over y-axisD) Reflected over x-axisE) Vertical StretchF) Horizontal Compression