If a = -9 and b = 4, what is the value of a + b ?
A. -5
B. 5
C. -13
D. 13

Answers

Answer 1

Answer:

A. -5

Step-by-step explanation:

-9 + 4 = -5

hope this helps


Related Questions

Mason breaks on average 1.5 pencils each day. How many pencils will he break in a school week?

Answers

Answer:

how long is the school week??

Answer:

He will break 7.5 pencils during a 5-day school week!

What is the domain of this function in the graph below?

What is the interval?

Answers

Domain in interval: [6,infinity)

I need help I dont wear to start

Answers

Answer:

Yes! it is there are straight across from each other and will never touch Hope I helped!


Mark the additive inverse of each integer!

Answers

Answer:

12, -12

21, -21

-11, 11

17, -17

-21, 21

additive inverse is when the sign changes either to a negative or positive.

therefore

12, -12
21,-21
-11 , 11
17, -17
-21, 21

Tommy bought stamps at the post office. Some of the stamps had a snowflake design, some had a truck design, and some had a rose design. Tommy bought 14 snowflake stamps. He bought 5 more truck stamps than snowflake stamps, and 5 fewer rose stamps than truck stamps. How many stamps did Tommy buy in all? Show your work, how you came up with the answer.

Answers

Answer:

47

Step-by-step explanation:

s = Number of stamps with snowflake design = 14

Number of stamps with truck design is 5 more than snowflake design

[tex]t=s+5\\\Rightarrow t=14+5\\\Rightarrow t=19\ \text{stamps}[/tex]

Number of stamps with rose design is 5 fewer than truck stamps

[tex]r=t-5\\\Rightarrow r=19-5\\\Rightarrow t=14\ \text{stamps}[/tex]

Total number of stamps

[tex]s+t+r=14+19+14\\ =47[/tex]

So total number of stamps Tommy bought is 47.

What is the slope of the line through (-7,-8)(−7,−8)

Answers

Answer:

the slope would be 0

Step-by-step explanation:

this is because those are the same 2 points

Calcula el numero de vueltas ,por minuto que, da la polea pequeña mienta la grande da 40 vueltas . Sabiendo que cada polea gira de manera que el radio y el numero de vueltas son inversamente proporcionales

Answers

Esta pregunta esta incompleta

Pregunta completa

Calcula el número de vueltas por minuto que hace la polea pequeña mientras que la grande hace 40 vueltas. Sabiendo que cada polea gira de manera que el radio y el número de vueltas son inversamente proporcionales.

El radio de la polea pequeña = 3 cm.

El radio de la polea grande = 9 cm

Answer:

120 vueltas por minuto

Step-by-step explanation:

El radio y el número de vueltas son inversamente proporcionales.

Por lo tanto

R = Radio

T = El número de vueltas por minuto

R ∝ 1 / T

R = k / T

Donde k es constante de proporcionalidad

Polea grande

R = 9 cm

T = 40 vueltas

9 = k / 40

k = 9 × 40

k = 360

Debemos encontrar el número de vueltas para la polea pequeña, por lo tanto,

R = k / T

k = 360, R = 3 cm

3 = 360 / T

3 × T = 360

T = 360/3

T = 120 vueltas

El número de vueltas de la polea pequeña = 120 vueltas por minuto

Solve 2|x + 2| – 3 ≥ 0

Answers

Answer:

2x+1

Step-by-step explanation:

Answer

[tex]x[/tex] [tex]\geq[/tex] [tex]-\frac{1}{2}[/tex]

Step-by-step explanation:

I'm learning this to but I hope this helps :)

Find −523−16. Write your answer as a mixed number in simplest form.

Answers

Answer:

(-523) - 16 is -539

Step-by-step explanation:

mathmathmathmathmsthmatj

The area of a circle, in terms of π, is 196π m2.
Find the value of the radius.

Answers

Step-by-step explanation:

if area of circle = pi times radius^2,

area of circle divided by pi = radius^2

so, square root (area of circle divided by 2) = radius.

so, 196pi = m2

approx 616

616=m2

sqrt 616 =m

approx value of radius is 25 or 24.8

pls mark this as brainliestttt

Estimate 7 x 522 ns

Answers

3.866 microseconds? 7 x 522 nano seconds = 3.86600 ms

3.86400 hope that helped

私はこれをGoogle翻訳を使って書き留めています。地面からうんちをすくい取ります。今やれ!

Answers

Answer:

yessssss

Step-by-step explanation:

thanks ;p;p;

What are the x-intercepts of the function y = x2 - X - 6?

Answers

Answer:(3,0) , (-2,0)

Step-by-step explanation:To find the x-intercept, substitute in  0 for y and solve for x

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

[tex]f(x) = {x}^{2} - x - 6 [/tex]

[tex]f(x) = (x - 3)(x + 2)[/tex]

[tex]0 = (x - 3)(x + 2)[/tex]

_________________________________

Hint :

[tex]a \times b = 0[/tex]

[tex]a = 0 \: \: \: or \: \: \: b = 0[/tex]

_________________________________

Thus ;

[tex] x - 3 = 0[/tex]

Add sides 3

[tex]x - 3 + 3 = 0 + 3[/tex]

[tex]x = 3[/tex]

Or

[tex]x + 2 = 0[/tex]

Subtract sides 2

[tex]x + 2 - 2 = 0 - 2[/tex]

[tex]x = - 2[/tex]

Thus the x-intercepts are (( - 2 )) and (( 3 )) .

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

A recent survey by the alumni of a major university indicated that the average salary of 10,000 of its 300,000 graduates was $125,000. What is the Population?

Answers

Answer:

The population is the total number of the universities  graduates  i.e [tex]N = 300,000[/tex]

Step-by-step explanation:

From the question we are told that

  The number of students that are consider is  n = 10,000

   The total number of graduates is  [tex]N = 300,000[/tex]

  The mean is [tex]\= x = \$125 , 000[/tex]

Here the population is The total number of graduates with value  [tex]N = 300,000[/tex], this is because a population is the pool from with a sample is drawn and in this case the pool is [tex]N = 300,000[/tex] while the sample with is drawn is  n = 10,000

 

IM IN NEED OF HELP .!!Antonio is at Best Buy and all TV's are 30% off. He finds a 75" OLED that he
wants, the price is $1500. What is the discount amount and how much did he
pay for the TV? Write and equation

Answers

Answer:

$450. The amount Antonio bought the tv for was $450.

Step-by-step explanation:

If all the tv's are 30%, multiple 30 by the price of the tv he wants, giving you 45000. Then, divide by 100 because a percent is out of a hundred, giving you $450

Formula:

(30x1500)/100

The three-digit number "ab5" is divisible by 3. How many different three-digit numbers can "ab5" represent?

Answers

Answer:

30

Step-by-step explanation:

I can't prove this, but I can tell you the answer.

30.

a = 100 s  digit

b = 10 s digit

5 is always the units digit.

I'm pretty sure that 30 is the correct answer.

What an interesting question. If I find out how it is done, I'll post it in the comments.

I can say this much.

a + b + 5 must be divisible by 3.

a = 1     b = 9     + 5

a = 1     b = 6     + 5

a = 1     b = 3     + 5

a = 1     b = 0 +  5

===============

Three more are obtained by interchanging the 100s and 10s digit except for b = 0

a = 9     b=1    + 5

a = 6     b =1   + 5

a = 3     b= 1   + 5

==================

a = 2    b = 2 + 5

a = 2    b = 5  + 5

a = 2    b = 8  + 5

only 2 more are obtained by interchanging the 10s and 100s digit

=============

a = 3   b = 4    +5

a = 3   b = 7    +5

You can't go any further. You get 2 more by interchanging the b and a digits.

=============

I hope you see what I've done here. I don't think this is an exact proof, but it is an exhaustive search.

HELP PLEASE ILL GIVE U 26 POINTS

Christo graphs AB with endpoints A( -3, -2 ) and B ( -1, -2 ) what are the endpoints of the image after a reflection of AB across the x axis?

1. (-3,2) and (-1,2)

2.(-3.-2) and (-1,-2)

3. (1,-2) and (3,-2)

4. (2,3) and (2,1)

5. none of the above

Answers

Answer:

1. (-3,2) and (-1,2)

Step-by-step explanation:

Reflection over x axis results in change y-coordinates to opposite sign and x-coordinates remain as is

So the coordinates become:

A(-3, -2) → A'(-3, 2)B(-1, -2) → B'(-1, 2)

Correct option is the first one

2(t+1)=10 what does t equal

Answers

Answer:

t = 4

Step-by-step explanation:

1. 2*t = 2t

2. 2*1 = 2

3. 2t+2 = 10

4. 10-2 = 8

5. 2t = 8

6. 8/2 = 4

7. t = 4

Answer:

t = 4

Step-by-step explanation:

2(t + 1) = 10

2t + 2 = 10

2t = 10 - 2

2t = 8

t = 8 ÷ 2

t = 4

-TheUnknownScientist

Given: m∠PRS = 2x + 12
m∠SRT = 6x + 8
∠PRS and ∠SRT are a linear pair

Prove: m∠PRS = 52

-make sure to include statements and reasonings like it shows in the screenshot

Answers

Answer:

See Below.

Step-by-step explanation:

1) Given:

[tex]\angle PRS\text{ and } \angle SRT \text{ are a linear pair.}[/tex]

2) Definition of Linear Pair:

[tex]m\angle PRS+m\angle SRT=180[/tex]

3) Given:

[tex]m\angle PRS=2x+12[/tex]

4) Given:

[tex]\displaystyle m\angle SRT=6x+8[/tex]

5) Substitution Property:

[tex](2x+12)+(6x+8)=180[/tex]

6) Combine Like Terms:

[tex]8x+20=180[/tex]

7) Subtraction Property of Equality (subtract 20 from both sides):

[tex]8x=160[/tex]

8) Division Properety of Equality (divide both sides by 8):

[tex]x=20[/tex]

9) Given (this step is optional. You don’t have to include this):

[tex]m\angle PRS=2x+12[/tex]

10) Substitution:

[tex]\displaystyle m\angle PRS=2(20)+12[/tex]

11) Multiplication:

[tex]m\angle PRS=40+12[/tex]

12) Addition:

[tex]m\angle PRS=52[/tex]

Answer:

sorry i dont realy understand that

Step-by-step explanation:

A line has a slope of -3/4 and passes through the point (-5, 4). Which is the equation of the line?

Answers

Answer: A

Step-by-step explanation:

y-4 = -3/4(x+5)

y = -3/4x+1/4

Answer: the equation is y= 3/4 times + 1/4 is your answer

how do you write 6.4 × 10^1 in standard form?

Answers

Answer:

64

Step-by-step explanation:

6.4 * 10^1

is the same as:

6.4 * 10

= 64

The ratio of blueberries to strawberries in a fruit salad is 4:3. If there are 45 strawberries in a salad, how many blueberries are there.. Blueberries 4 Strawberries 3

Answers

Answer:

60 blueberries

Step-by-step explanation:

Given the ratio of blueberries to strawberries in a fruit salad to be 4:3. The total ratio = 4+3 = 7

If there are 45 strawberries in the salad then we can first calculate the total mixture of both as shown;

amount of strawberries = 3/7 * x = 45

x is the total amount of mixture

from the expression;

3x/7 = 45

cross multiply

3x = 7*45

3x = 315

x = 315/3

x = 105

The amount of blueberries present = 105 - 45 = 60

Hence the amount of blueberries present is 60 blueberries

What is the square root of 40000 step by step
Thx for everything that answers

Answers

The answers 200 of u have an iPhone u can ask siri what the square root of whatever number is and it will tell u the correct answer

What is the solution to the equation?
Pls help ASAP

Answers

Answer: 12 1/2

Step-by-step explanation:

its easy bruh what grade you in this is 6th grade stuff

Please Help!!!!!!!!!!
Is each line parallel, perpendicular, or neither parallel nor perpendicular to a line whose slope is 2/5?
line n, with slope -5/2
line m, with slope 5/2
line p, with slope 2/5

Answers

Answer:

Step-by-step explanation:

n is perpendicular. - 1/(2/5) = - 5/2. n is the negative reciprocal of the given line.

m is neither.

p is parallel to the given line. For example y = 2/5x

and y = 2/5 x + 9  are parallel to each other.

Which of the following expressions is equal to (2g)5?

10 · g · g · g · g · g

2g · 2g · 2g · 2g · 2g

2 · g · g · g · g · g

10g

Answers

Answer:

The answer is choice b.

Step-by-step explanation:

I took a quiz with the exact same question on it. hopefully I'm not too late ! <3

The expression is;

⇒ 2g * 2g * 2g * 2g * 2g

Option 2 is true.

Given that;

The expression is;

⇒ (2g)⁵

We have to find the equivalent expression.

What is Powers of a number?

The powers of a number is express how many time the numbers are repeated.

The expression is;

⇒ (2g)⁵

Since, The power of 2g is five.

Hence, It can be repeat five times as,

(2g)⁵ = 2g * 2g * 2g * 2g * 2g

Hence, The equivalent expression is;

⇒ 2g * 2g * 2g * 2g * 2g

Option 2 is true.

Learn more about Powers of a number visit:

https://brainly.com/question/28400450

#SPJ2

Write the equation that represents a 15% increase of $120.

Answers

Answer:

$138

Step-by-step explanation:

if 100 is 15 then you add 1.15 or 1% of 15

Can someone please help me with this problem ? I would love y’all forever !

Answers

-1= 1
0= 3
1= 5
2= 7
3= 9

pls help ill give brainlist

Answers

Answer:

F

Step-by-step explanation:

The rise is 8 and run is 6

Answer:

The answer is J) y=-4/3x+8

matt is playing a game. he gains 7 points, loses 10 points, gains 2 points, and then loses 8 points. what is the final score?

Answers

Answer:

-9 points

Step-by-step explanation:

He starts at 0 but gains 7 [7] then loses 10 [-3] gains 2 [-1] and loses 8 [-9]

negative 9 points i just took it and it’s correct
Other Questions
Which detail is relevant for an argument to make drivers who run through red lights pay a fee? Even though everyone knows that going through red lights is illegal, they do it anyway. The current fines, which are being used to maintain roads, are generating a lot of money for the city. People do not feel safe on the street because they know drivers are not stopping at red lights. The current fines are not high enough to discourage drivers from going through red lights. simply parmanent tissue real life application please help it's for my project Question 8 (1 point)Choose the correct form of the verb in the preterite. 1. Yo _________ (organizar) bien las cosas en la maleta. aorganiz borganizaste corganiz dorganic Please select the word from the list that best fits the definitionDoctors appointment today at 3:20pma.term calendarsb. weekly schedulec. daily organizer hellpppppp please I will give brainliest DUE 10:00 PM HELP ASAP. When Sarah left your house this morning her cell phone was 80% charged and then it started to lose 8% charge for each hour there after write an equation for B in terms of tea representing the charge remaining in series battery as percentage t hours after Sara left her house A news report says that 9% of middle school students are on the track team. There are 600 students in your middle school How many students in your school would you expect to be on the track team? HE Pad SATTE BAR HG West nus SAUNA w 1 PLEASE HELP! THIS A TIMED QUIZ!!Scientists found an artifact that has 25% of Carbon-14 left. Based on how much Carbon-14 is remaining, how old is the artifact that was found?A). 17,100 yearsB). 5,700 yearsC). 22,800 yearsD). 11,400 years Please help asap! Ill give brainliest!What theme does the excerpt convey?It is right to be wary of the unknown.Pride interferes with progress.Manners must be displayed in all situations.Strange animals cannot be trusted. What is your response? Why do u think sunny asks so many questions? anyone out there an expert on dreams?? Estimate 511 x 637 by first rounding each number so that it only has 1 nonzero digit. what would you do when you grow up?*Career* And explain why! During a formal group discussion, participants should be prepared toO lead the conversation and prompt others to speak. O persuade others to agree with their viewpoint. O interrupt other speakers when necessary. O take turns both listening and speaking. This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive