In what ways does the migration of women from the global south constitute a shift of gender in transnational migration? Does the engagement of those women in transnational mobility help them access social and economic mobility? Explain your answer.

Answers

Answer 1

Women from the global south are changing transnational migratory gender dynamics.

Women are increasingly traveling alone or as primary migrants. This transformation empowers women to improve their lives and defy gender norms. Transnational movement can assist global South women to advance socially and economically. Women can escape poverty, discrimination, and limited prospects by migrating. Migrating lets women study, work, and support their families. Their destination countries may offer better healthcare, legal protection, and social services. The transnational movement allows women to change gender norms in their home nations and in their new communities. These women empower and transform the economy by working in different fields. Their achievements motivate other women to follow their goals.

To know more about legal protection

https://brainly.com/question/1332725

#SPJ11


Related Questions

match each concept to the correct example. drag each item on the left to its matching item on the right. data fabrication deception plagiarism data falsification trevor uses a famous quote from freud in his paper but does not cite it, as he assumes everyone will recognize the quote.

Answers

Trevor's action is an example of **plagiarism**. Data fabrication, deception, and data falsification do not apply to this situation.

Plagiarism occurs when someone uses another person's work, ideas, or words without proper attribution. In Trevor's case, he used a famous quote from Freud in his paper without citing the source, which is a form of plagiarism. While he may have assumed that everyone would recognize the quote, it is essential to always provide credit to the original source. **Data fabrication** refers to the creation of false data, **deception** involves misleading others, and **data falsification** is the manipulation or alteration of existing data. These terms are not relevant to Trevor's action, as he simply failed to provide a citation for a quote used in his work.

Know more about plagiarism here:

https://brainly.com/question/30180097

#SPJ11

One potential social cost of a stigmatized group member claiming discrimination is that ______________.

Answers

One potential social cost of a stigmatized group member claiming discrimination is that they may face further discrimination and prejudice.

When a member of a stigmatized group claims discrimination, they are essentially pointing out the existence of structural inequalities that exist within society. This can make some people uncomfortable, and they may respond with hostility or defensiveness.

For example, if a Black person claims that they have been discriminated against in the workplace, some of their colleagues or superiors may view them as being overly sensitive or exaggerating the problem. This can lead to further discrimination against the Black person, as well as others who belong to the same stigmatized group.

Another potential social cost of claiming discrimination is that the individual may experience negative consequences in their personal and professional life. For example, they may be passed over for promotions, denied job opportunities, or experience social exclusion from their peers. This can lead to feelings of isolation, frustration, and even depression.

Know more about the discrimination

https://brainly.com/question/1084594

#SPJ11

When they abandoned their
African colonies, many European
nations left which of these
behind?
4
A. governments
B. farms
C. languages

Answers

Answer:

A

Explanation:

I believe the answer is C

____________ is performance based. It is why men are generally taught to avoid being feminine and women are encouraged to be a little masculine.

Answers

The Gender socialization is the process by which individuals learn and internalize the norms, values, behaviors, and expectations associated with their gender.

In many societies, gender socialization is performance-based, meaning that individuals are taught to act in ways that conform to the norms and expectations associated with their gender. For example, men are often taught to avoid feminine traits or behaviors, such as being emotional or nurturing, while women are encouraged to be more masculine, such as being assertive or competitive.


These behaviors are learned and reinforced throughout a person's life, leading to a performance of masculinity or femininity. This concept can help explain why men are taught to avoid feminine traits and why women may be encouraged to display some masculine traits.

To Know more about   Gender socialization

https://brainly.com/question/30679016

#SPJ11

the perception that one's fate is determined by luck reflects

Answers

The perception that one's fate is determined by luck reflects an external locus of control.

Locus of control refers to an individual's belief about the underlying causes of events in their life. Those with an external locus of control attribute outcomes to external factors such as luck, fate, or powerful others, rather than their own actions or abilities. Believing that luck plays a significant role in determining one's fate suggests a belief in external forces beyond one's control.

This perspective can influence a person's attitudes, behavior, and decision-making, as they may feel less agency and personal responsibility for their outcomes. Individuals with an external locus of control may rely more on chance and external circumstances, rather than actively pursuing goals or taking actions to shape their own destiny.

Learn more about perception

https://brainly.com/question/1670120

#SPJ4


Complete Question:

the perception that one's fate is determined by luck reflects what?

"The National Progressive Party, committed to the principle of government by a self-controlled democracy expressing its will through representatives of the people, pledges itself to secure such alterations in the fundamental law of the several States and of the United States as shall insure the representative character of the government."
Progressive Party Platform, 1912
Which of the following groups is most credited with advancing Progressivism?
A
Anarchist activists
B
Recent immigrants
C
Agricultural workers
D
Middle-class women

Answers

The group most credited with advancing Progressivism is D) Middle-class women. During the Progressive Era, women played a crucial role in advocating for social and political reforms.

They worked towards improving living and working conditions, expanding education, and fighting for women's suffrage. Women's organizations such as the National American Woman Suffrage Association (NAWSA) and the Women's Trade Union League (WTUL) played a significant role in the Progressive movement. Women's activism and advocacy efforts helped bring attention to the need for government reforms and influenced the passage of significant legislation, including the 19th Amendment, which granted women the right to vote.

These women played a significant role in promoting progressive reforms, advocating for social change, and working to improve living and working conditions. Through their activism and involvement in various organizations, middle-class women were able to influence public opinion and help bring about significant progress in areas such as education, labor rights, and women's suffrage.

To know more about NAWSA visit :

brainly.com/question/29211614

brainly.com/question/8495616

what is the best way to deliver presentations with authenticity? multiple choice talking about your abilities and achievements to impress your audience finding ways to present your real self to your audience attempting to learn the presentation techniques of great speakers engaging in frequent name-dropping throughout the presentation avoiding the use of notes as they can be perceived as a sign of weakness

Answers

The best way to deliver presentations with authenticity is by finding ways to present your real self to your audience. This means being honest, transparent, and vulnerable when appropriate.

Avoid talking about your abilities and achievements just to impress your audience as this can come across as insincere. Instead, focus on delivering a message that resonates with your audience and provides value to them. Attempting to learn the presentation techniques of great speakers can also be helpful, but it should not come at the expense of your own unique style. Engaging in frequent name-dropping throughout the presentation can be off-putting and may detract from your message. Using notes is perfectly acceptable and can actually help you stay organized and on track during your presentation.

To know more about Audience visit-

brainly.com/question/28566711

#SPJ11

During a lesson on weather fronts, a teacher asks her students to write their observations as she extinguishes a lit wooden match. She then leads a discussion on the path of the smoke. Which of the following is the teacher demonstrating?
A. conduction
B. radiation
C. convection
D. humidity

Answers

The teacher's demonstration of observing the path of smoke from a lit wooden match is a simple yet effective way to introduce the concept of convection to students during a lesson on weather fronts. The teacher is demonstrating convection.

Convection is the transfer of heat through the movement of fluids or gases. In this case, the smoke from the extinguished match is rising due to the warmer air surrounding it. This warm air rises and is replaced by cooler air, creating a convection current. The teacher is asking the students to observe the path of the smoke to understand how convection works.

Conduction is the transfer of heat through direct contact, such as touching a hot stove. Radiation is the transfer of heat through electromagnetic waves, such as the warmth felt from the sun. Humidity refers to the amount of moisture in the air, which can affect the formation of weather fronts but is not directly related to the demonstration given by the teacher.

As a result, this warm air rises while the cooler, denser air sinks, creating a circulation pattern. This movement of air is an example of convection and is relevant to the topic of weather fronts, as it helps students understand the movement and interaction of different air masses.

Know more about the Radiation

https://brainly.com/question/27321229

#SPJ11

True or false: In strongly centralized organizations, decision-making authority is reluctantly delegated to lower-level managers who have little freedom to make decisions.

Answers

True, In strongly centralized organizations, decision-making authority is reluctantly delegated to lower-level managers who have little freedom to make decisions.

In such organizations, decision-making power is typically held by a small group of high-level executives, who may be reluctant to delegate authority to lower-level managers. This can create a culture of top-down control, where decisions are made at the highest levels and then filtered down to lower levels of the organization.

As a result, lower-level managers may have limited opportunities to make decisions that are responsive to local conditions or customer needs. While this approach can create consistency and standardization across the organization, it can also lead to a lack of innovation and agility in responding to changing market conditions.

know more about centralized organizations, here:

https://brainly.com/question/29431299

#SPJ11

You're representing janice in the purchase of a home. under which of the following instances would it be unacceptable to disclose confidential information? a) disclosure is necessary to defend yourself against an accusation of wrongful conduct
b) janice gives you written permission to disclose the information c) the information is made public from a source other than you d) you suspect the disclosure will enable janice to buy a home at a lower price

Answers

As an attorney representing Janice in the purchase of a home, you have a legal and ethical obligation to maintain her confidential information. The correct option is a.

There are certain instances where disclosing confidential information may be necessary or acceptable. In general, you may disclose confidential information if it is necessary to defend yourself against an accusation of wrongful conduct or if Janice gives you written permission to do so.

However, if the information is made public from a source other than you, it is no longer confidential and you may discuss it with others. On the other hand, if you suspect that disclosing confidential information will enable Janice to buy a home at a lower price, it would be unacceptable to disclose such information. This would be considered a breach of your ethical and legal obligations to Janice, and could result in serious consequences.

In conclusion, it is important to be aware of the circumstances under which you can and cannot disclose confidential information as an attorney representing a client in a real estate transaction. The correct option is a.

Know more about the ethical obligation

https://brainly.com/question/29871792

#SPJ11

question which of the following is not a characteristic of hinduism? responses it uses human and animal images in its sacred spaces. it uses human and animal images in its sacred spaces. pilgrims bathe in holy rivers. pilgrims bathe in holy rivers. religious functions most likely take place at home within the family. religious functions most likely take place at home within the family. it is a universalizing religion. it is a universalizing religion. sacred places are established by tradition.

Answers

The characteristic that is not associated with Hinduism is that it is a universalizing religion. Unlike universalizing religions, such as Christianity and Islam, which seek to spread their beliefs and practices to all people, Hinduism is an ethnic religion that is largely confined to the Indian subcontinent.

However, Hinduism does share other characteristics listed, including the use of human and animal images in sacred spaces, pilgrims bathing in holy rivers, religious functions taking place at home within the family, and the establishment of sacred places by tradition. These practices and beliefs are central to the Hindu faith, which is one of the oldest and most complex religions in the world.

To know more about Hinduism visit-

brainly.com/question/2970469

#SPJ11

Which of the following is why managers should NOT hand off the catalyst role to HR?
a. It will enable them to be more successful at the operational part of their jobs.
b. It will help them to focus on the operational part of their jobs.
c. They'll be less able to develop the positive employee relationships necessary for getting engaged and productive employees
d. HR is less qualified to perform the catalyst role.

Answers

The correct answer is option d. HR is less qualified to perform the catalyst role.

Option d states that managers should not hand off the catalyst role to HR because HR is less qualified to perform the catalyst role. This means that HR may not have the necessary expertise, knowledge, or skills to effectively fulfill the responsibilities of the catalyst role.

The catalyst role in an organization involves driving change, fostering innovation, and creating a culture of continuous improvement. It requires strong leadership, strategic thinking, and the ability to influence and inspire others. While HR departments play a crucial role in managing human resources, their primary focus is often on areas such as recruitment, employee relations, and compliance with employment laws and policies.

The catalyst role requires a broader understanding of the organization's strategic objectives, industry trends, and market dynamics. Managers, who have a deep understanding of their business operations and goals, are better positioned to provide the necessary direction and drive change within their teams.

To know more about Human Resources, visit:

https://brainly.com/question/13373254

#SPJ11

Political scientists call voters choices that focus on future behavior___, while those based on past performances are called___. a:partisian voting:issue voting b:issue voting:prospective voting c:retrospective voting:prospective voting d:issue voting:partisian voting
e:prospective voting:retrospective voting

Answers

The correct option is E: prospective voting: retrospective voting.

Political scientists categorize voter choices into two main types: prospective voting and retrospective voting. Prospective voting refers to when voters make their decisions based on the candidates' proposed policies and plans for the future. These voters analyze the candidates' promises and stances on various issues to determine who they believe will best address their concerns and lead the country or jurisdiction forward.

On the other hand, retrospective voting is when voters make their decisions based on the candidates' past performance, either in office or in other roles. These voters assess the accomplishments and failures of incumbents or previous officeholders and vote accordingly. This type of voting helps hold politicians accountable for their actions while in office. Therefore, the correct option is E: prospective voting: retrospective voting.

To know more about the voters visit:

https://brainly.com/question/15834341

#SPJ11

active and dynamic stretching utilize which physiological action

Answers

Active and dynamic stretching primarily utilize the physiological action of muscle contraction and relaxation to increase flexibility, improve range of motion, and enhance athletic performance.

Physiological refers to the processes and functions that occur within living organisms, particularly related to their physical and biochemical aspects. It encompasses the study of how various systems in the body, such as the nervous system, cardiovascular system, respiratory system, and others, function and interact to maintain homeostasis and support life. Physiological processes include activities like metabolism, circulation, respiration, digestion, hormone regulation, and sensory perception. Understanding physiology is crucial for comprehending the mechanisms underlying bodily functions and how they respond to internal and external stimuli.

Learn more about Physiological here:

https://brainly.com/question/14573734

#SPJ11

according to classical-conditioning theory phobias develop as the result of

Answers

According to classical conditioning theory, phobias develop as the result of associative learning, specifically through a process called classical conditioning. The correct answer is the pairing of a neutral stimulus with an aversive or traumatic experience.

Classical conditioning involves learning associations between stimuli. In the case of phobias, a neutral stimulus initially has no inherent fear-inducing qualities. However, through repeated pairings with a negative or traumatic event, the neutral stimulus becomes associated with fear or anxiety. This association creates a conditioned response, which is an automatic fear response triggered by the previously neutral stimulus.

For example, let's consider someone who develops a phobia of dogs. Initially, dogs are a neutral stimulus for them. However, if they experience a traumatic event involving a dog, such as being bitten, the fear and anxiety experienced during that event become associated with dogs. The neutral stimulus (dogs) now elicits a conditioned response (fear) due to the learned association.

Phobias can also develop through vicarious learning, where individuals acquire fears by observing others' fearful reactions. For instance, if someone witnesses a family member reacting with extreme fear towards spiders, they may develop a phobia of spiders through the observation of that fear response.

In summary, classical conditioning theory suggests that phobias develop as a result of associative learning, where a neutral stimulus becomes associated with fear or anxiety due to repeated pairings with an aversive or traumatic experience. This process creates a conditioned response, leading to the development of a phobic response towards the previously neutral stimulus.

To know more about Individual visit-

brainly.com/question/29760960

#SPJ11

should the social community as a whole take priority over the individual rights of its members, or do the individual rights of its members deserve priority over the community? quroan

Answers

This is a complex question that requires a nuanced answer. On one hand, social communities exist to serve their members, and therefore should prioritize the individual rights of their members. However, social communities also have a responsibility to ensure that their content is loaded with integrity and does not harm other members. In this sense, the community as a whole may need to take priority in certain situations to protect the well-being of all its members.

Ultimately, it depends on the specific situation at hand and requires a balance between the individual rights and needs of members and the needs of the community as a whole. The key is to find a way to balance the two so that everyone can feel valued, respected, and supported.
In addressing the question of whether the social community should take priority over individual rights, or vice versa, it is essential to consider the balance between the two. The Quran emphasizes the importance of community and the rights of individuals, promoting harmony and justice.

The social community's well-being is important, as it provides a stable environment for individuals to thrive and contribute. However, prioritizing the community should not come at the expense of individual rights. Upholding individual rights is crucial to ensure that everyone's dignity, freedom, and equality are respected.

Individual rights, on the other hand, should not be given absolute priority, as this could lead to selfish behaviors and harm the community's overall welfare. The Quran teaches that individuals have a responsibility to care for others and contribute to the common good.

In conclusion, both the social community and individual rights should be carefully balanced. The Quran encourages a harmonious coexistence that promotes justice, compassion, and empathy, ensuring that neither the community nor the individual is unfairly prioritized.

To know more about social communities visit:

https://brainly.com/question/9973830

#SPJ11

suppose that the current unemployment rate is 4 percent. the percent who are structually unemployed is 3 percent, and the percent who are frictionally unemployed is 3 percent. therefore, the natural rate of unemployment is percent, and the cyclical unemployment rate is percent.

Answers

The natural rate of unemployment is the sum of the structurally and frictionally unemployed rates. In this case, it would be 3 percent (structurally) + 3 percent (frictionally) = 6 percent.

The natural rate of unemployment is also known as the "full employment" rate, meaning that it is the lowest rate of unemployment that can be sustained without causing inflation.

The cyclical unemployment rate is the difference between the actual unemployment rate and the natural rate of unemployment. In this case, the actual unemployment rate is 4 percent, and the natural rate is 6 percent, so the cyclical unemployment rate is -2 percent (meaning that there is a labor market surplus).

However, it's important to note that this calculation assumes that all factors of unemployment are accounted for. There may be other factors affecting the unemployment rate, such as seasonal fluctuations or changes in government policies, that can impact the cyclical unemployment rate.

Overall, understanding the natural and cyclical rates of unemployment is important for policymakers and economists in determining the health of the labor market and making decisions about economic policies that affect employment.

Know more about the natural rate of unemployment

https://brainly.com/question/13399471

#SPJ11

which of the following results in a violation? a. a3, while dribbling, touches a12, who is standing out of bounds. b. a3, while dribbling, touches b30, who is standing out of bounds. c. a3 is dribbling and the ball touches a12, who is standing on the sideline. d. a3, while holding the ball inbounds, touches an official, who is standing on the end line.

Answers

The correct option is D. In basketball, touching an official while holding the ball inbounds results in a violation. This is because the ball is not allowed to make contact with anyone other than the players and the equipment used during the game.

Options A, B, and C do not result in a violation as long as a3 does not step out of bounds while touching a player or the ball. It is important for players to be aware of these rules to avoid committing violations and giving the opposing team an advantage. In the other scenarios, touching another player (A or B) standing out of bounds or an official on the end line does not constitute a violation while holding or dribbling the ball inbounds.

To know more about inbound touching visit-

brainly.com/question/31866762

#SPJ11

making terrorist or bomb jokes at an airport is one example of illegal speech. group of answer choices true false

Answers

The correct answer is "true."

Making terrorist or bomb jokes at an airport is indeed an example of illegal speech. This behavior is taken very seriously due to the potential threat it poses to public safety and security. Making such jokes can cause panic, disrupt airport operations, and create unnecessary fear and anxiety among passengers and airport personnel.

In many countries, including the United States, making terrorist or bomb jokes at airports is explicitly prohibited by law. It falls under the category of making false threats or false alarms, which is considered a criminal offense. These laws aim to deter individuals from engaging in behavior that may lead to dangerous situations or cause unnecessary disruption in public places.

Airports are high-security areas where any potential threats or suspicious activities are taken seriously. Authorities have a responsibility to ensure the safety of all individuals within the airport premises. Making terrorist or bomb jokes not only violates the law but also disregards the potential consequences and impact it can have on others.

It's important to remember that freedom of speech is not absolute and can be limited when it poses a threat to public safety, incites violence, or disrupts the functioning of critical infrastructure like airports.

To know more about Individual visit-

brainly.com/question/29760960

#SPJ11

What happens to most proposals for amendments made in Congress?
a. most are rejected by states
b. most never make it to the states
c. most become official amendments
d. most just become regular laws

Answers

The most proposals for amendments made in Congress is a. most are rejected by states.

A modification can be proposed via way of means of a two-thirds vote of each Houses of Congress, or, if two-thirds of the States request one, via way of means of a conference known as for that purpose. The modification should then be ratified via way of means of three-fourths of the State legislatures, or three-fourths of conventions known as in every State for ratification. Collectively, participants of the House and Senate commonly recommend round 2 hundred amendments for the duration of every two-yr time period of Congress. Most, however, in no way get out of the Congressional committees wherein they have been proposed.

Thus, option a is the correct option.

To learn more about amendments check the link below-

https://brainly.com/question/687600

#SPJ4

gender sensitive models of training family therapists are aimed at

Answers

Gender-sensitive models of training family therapists are aimed at addressing and integrating gender issues and dynamics in therapeutic practice and promoting gender equity within family therapy sessions.

Gender-sensitive models of training family therapists focus on recognizing and addressing the ways in which gender impacts family relationships, power dynamics, and communication patterns. This approach ensures that therapists are aware of potential gender biases, stereotypes, and inequities that may influence their work with clients. By integrating gender issues into the training process, therapists can better identify and challenge harmful gender-related assumptions and behaviors within families. This promotes a more equitable and supportive therapeutic environment for all family members, regardless of their gender identity or expression.

Additionally, gender-sensitive training encourages therapists to reflect on their own biases and assumptions, enhancing their ability to provide compassionate, inclusive, and effective care to diverse families.

To know more about the Gender-sensitive visit:

https://brainly.com/question/20503649

#SPJ11

Why did some of Georgia’s white land owners oppose including African Americans in the World War I-era Selective Service Act?

Answers

They feared that if African Americans were given the opportunity to serve in the military, they might become emboldened to demand greater civil rights and social equality. Additionally, many white landowners believed that African Americans were not capable of serving in the military and would be a liability in combat.

write a physiological explanation of a process using either a teleological or mechanistic explanation.

Answers

A mechanistic explanation of the process of muscle contraction. Muscle contraction is a complex physiological process that enables movement and is vital for various bodily functions.

Muscle contraction is a complex physiological process in which muscle fibers generate force and shorten in length. It is a fundamental mechanism responsible for movement, stability, and control in the human body. Contraction occurs when the muscle receives signals from the nervous system, stimulating the release of calcium ions from storage sites within the muscle cell.

The process of muscle contraction involves the interaction of two proteins called actin and myosin. These proteins form cross-bridges, with myosin heads attaching to actin filaments and pulling them closer together. This action shortens the sarcomeres, which are the basic functional units of muscle fibers, resulting in overall muscle contraction.

To know more about Muscle contraction refer here :

brainly.com/question/13898974

#SPJ4

which of the following allows for teh attainment of paigets concept of conservation a. sensorimotor thought b. reversibility c. naïve idealism d. the personal fable

Answers

Piaget's theory of cognitive development proposed that children progress through distinct stages of intellectual development, with each stage characterized by specific cognitive abilities and limitations. One of the key concepts in Piaget's theory is conservation, which refers to the understanding that certain properties of an object, such as its volume, mass, or number, remain the same even if its appearance changes.

To answer the question, the term "conservation" must be defined. Conservation refers to the ability to understand that certain physical properties of an object remain the same despite changes in appearance. In other words, conservation is the ability to understand that changes in the appearance of an object do not change its fundamental properties.

The correct answer to the question is "reversibility." Reversibility is the ability to mentally undo an action or operation. For example, if a child is shown two identical glasses filled with the same amount of water and one of the glasses is poured into a taller, thinner glass, the child with the concept of reversibility understands that the amount of water in the two glasses is still the same, even though the taller glass looks like it has more water.

The other options listed in the question are not correct. Sensorimotor thought refers to the stage of cognitive development from birth to age two during which infants use their senses and motor skills to explore and learn about the world around them. Naïve idealism refers to the belief that one's own ideas or beliefs are the only correct ones. Finally, the personal fable refers to the belief that one is unique and invulnerable to harm.

In conclusion, the attainment of Piaget's concept of conservation is facilitated by the ability to mentally reverse an action or operation, known as reversibility. This cognitive ability is typically achieved during the concrete operational stage of development, which occurs between the ages of 7 and 12 years old.

Learn more about Piaget's theory here:

https://brainly.com/question/28469035

#SPJ11

Draw 4 separate circles. Make a cirele graph for the following. Each number represents a circle graph. Make sure you label the graphs.
Circle I: King(1/3), chiefs(1/3),k Maka' ainana (1/3)
Circle I: Chiefs (40%), king(60%)
Circle II: Chiefs(40%), king(Crown lands) (23%), government(37%)
Circle IV: Chiefs(39%), Crown lands(23%), government(37%), kuleana(1%)

Answers

Circle I: King: a third, or 33.33%, Chiefs: 1/3, or 33.33%, Maka'ainana: a third, or 33.3%. Divide Circle I into three equal segments and name them "King," "Chiefs," and "Maka'ainana." Each sector should take up 1/3, or 33.33%, of the whole circle.

A circle is a form made up of all points on a plane that are at a specific distance from the center point. In other words, it is the path a moving point in a plane takes to travel around a curve while maintaining a constant distance from another point.

The radius is the separation between any circle's point and its center. Typically, the radius must be a positive value equal segments . An arc with the symbol =

A degenerate instance is 0 r=0 (a single point). Except as otherwise stated, the topic of this article is circles in Euclidean geometry, more specifically the Euclidean plane.

Learn more about Circle, from :

brainly.com/question/12930236

#SPJ1

an important environmental benefit of open spaces in cities includes

Answers

An important environmental benefit of open spaces in cities includes the promotion of biodiversity and the creation of habitats for wildlife unlike increasing population.

Open spaces such as parks, green roofs, and gardens provide a space for plants and animals to thrive, increasing the overall biodiversity of the city. This can lead to a healthier ecosystem and improved air and water quality. Additionally, open spaces can help mitigate the urban heat island effect by providing shade and reducing the amount of heat absorbed by buildings and paved surfaces.


Hence,  An important environmental benefit of open spaces in cities includes improved air quality, reduced urban heat island effect, and enhanced stormwater management. These spaces contribute to healthier ecosystems and provide a better quality of life for urban residents.

To know more about unlike visit

https://brainly.com/question/31668049

#SPJ11

separation of duties refers to: group of answer choices a. keeping functions across different departments separate. b. individuals who have physical responsibility for assets should not also have access to accounting records. d. preventing top management and lower-level employees from interacting. d. making each manager personally responsible for his/her department.

Answers

Separation of duties refers to the "individuals who have physical responsibility for assets should not also have access to accounting records" The correct option is b.

The practice of dividing critical tasks and responsibilities among different individuals or groups to establish checks and balances, enhance accountability, and mitigate the risk of fraud or errors. It ensures that no single person or entity has complete control or authority over a particular process or function.

Option (b)  is the most accurate answer. This principle highlights the importance of segregating duties between those who handle physical assets, such as inventory or cash, and those who maintain financial records, such as accounting or bookkeeping personnel.

By separating these roles, the organization reduces the risk of misappropriation or manipulation of assets since multiple individuals are involved in the process, and each can act as a check on the other.

The separation of duties principle is crucial for internal control systems within organizations. It helps to prevent conflicts of interest, maintain transparency, and promote integrity. Additionally, it reduces the potential for collusion and increases the likelihood of detecting errors or irregularities through independent verification.

While options (a), (c), and (d) touch on aspects of organizational structure, they do not fully capture the essence of separation of duties. Separation of duties is not solely about departmental separation, preventing interactions between different levels of employees, or making individual managers solely responsible for their departments.

Therefore,  The correct option is b.

To learn more about accounting click here:

https://brainly.com/question/1033546#

#SPJ11

organic intellectual disability describes a genetic disorder or lower level of intellectual functioning caused by brain damage, where as ____ is when no evidence of organic brain damage can be found.

Answers

Organic intellectual disability refers to a genetic disorder or lower level of intellectual functioning caused by brain damage. In contrast, "functional intellectual disability" is when no evidence of organic brain damage can be found.

Unlike organic intellectual disability, which is caused by genetic factors or brain damage, functional intellectual disability is a condition where an individual's intellectual functioning is lower than average, but there is no evidence of structural or neurological damage to the brain. It is often attributed to environmental or social factors, such as poverty, neglect, or lack of access to education.

Functional intellectual disability can range from mild to severe and can affect an individual's ability to learn, communicate, and live independently. While there is no cure for functional intellectual disability, early intervention, education, and support can help individuals with the condition reach their full potential.

This type of disability may arise due to environmental factors, such as inadequate learning opportunities or psychosocial issues, and can still impact an individual's cognitive abilities and daily functioning. Both organic and functional intellectual disabilities require appropriate support and intervention to ensure the individual can reach their  full potential.

To know more about intellectual visit :

brainly.com/question/32278471

#SPJ11

If a distribution is normal, then it is not possible to randomly select a value that is more than 4 standard deviations from the mean.

Answers

FALSE. In a normal distribution, it is possible to randomly select a value that is more than 4 standard deviations from the mean, although it is less likely to occur.

A normal distribution, also known as a Gaussian distribution or bell curve, is a statistical concept that describes a probability distribution of a continuous random variable. It is characterized by a symmetric, bell-shaped curve with a peak at the mean value. In a normal distribution, the data is symmetrically distributed around the mean, with the majority of values falling near the mean and fewer values farther away. The distribution is defined by two parameters: the mean, which determines the center of the distribution, and the standard deviation, which measures the spread or variability of the data. Many natural phenomena and human traits tend to follow a normal distribution, making it a fundamental concept in statistics and probability theory.

Learn more about normal distribution here:

https://brainly.com/question/31116907

#SPJ11

there is no known limit to our group of answer choices metamemory. working memory. long-term memory. short-term memory.

Answers

There is no known limit to our cognitive abilities in terms of memory, including metamemory, working memory, long-term memory, and short-term memory. Metamemory refers to our knowledge and awareness of our own memory processes, while working memory is our ability to hold and manipulate information in our mind for short periods of time. Long-term memory is our capacity to store and retrieve information over extended periods, while short-term memory is the ability to briefly retain information before it is either forgotten or transferred to long-term memory. While research continues to explore the extent of our memory capabilities, it is clear that humans possess remarkable cognitive abilities in this regard.
Your question is: "There is no known limit to our group of answer choices: metamemory, working memory, long-term memory, short-term memory."

Your answer: There is no known limit to our long-term memory. Long-term memory can store vast amounts of information for an indefinite period of time. Unlike working memory and short-term memory, which have limited capacity and duration, long-term memory can continually expand as we learn and experience new things. Metamemory, on the other hand, refers to our awareness of our memory processes and knowledge about our own memory abilities, and is not a type of memory with a specific capacity.

To know more about cognitive abilities visit

https://brainly.com/question/28541749

#SPJ11

Other Questions
msjmc and mgh pharmacies are medium risk compounding facilities. as such, we can assign beyond use dates of refrigerated compounded sterile products of no more than: - 4. Define g(x) = 2x3 + 1 a) On what intervals is g(x) concave up? On what intervals is g(2) concave down? b) What are the inflection points of g(x)? Which of the following correctly describes the complementary base pairing of adenine in both DNA and RNA?1) Adenine pairs with cytosine in DNA and guanine in RNA2) Adenine pairs with thymine in both DNA and RNA3) Adenine pairs with guanine in DNA and cytosine in RNA4) Adenine pairs with uracil in DNA and thymine in RNA5) Adenine pairs with thymine in DNA and with uracil in RNA A jogger running around a rectangular park takes a shortcut back to his car by running 53 meters from one corner to the opposite corner. If the park is 45 meters long, what is the width? A rectangular box with a square base and open top is the hold 1000 in. We wish to use the least amount of material to construct this box in the given shape. What are the dimensions of the box that uses the least material. the heat of vaporization of water is 40.66 kj/mol. how much heat is absorbed when 1.62 g1.62 g of water boils at atmospheric pressure? When mapping the process to acquire a paying customer, you should note whether payment will come from the customer's yearly operating budget or from the customer's long-term capital budget.a. true b. false A ladder is leaning against the top of an 8.9 meter wall. If the bottom of the ladder is 4.7 meters from the bottom of the wall, then find the angle between the ladder and the wall. Write the angle in Let f(x)=x^35x. Calculate the difference quotient f(3+h)f(3)/h forh=.1h=.01h=.01h=.1The slope of the tangent line to the graph of f(x) at x=3 is m=lim h0 f(3+h)f(3)h=The equation of the tangent line to the curve at the point (3, 12 ) is y= On January 1, Year 1, Your Ride Incorporated paid $30,000 cash to purchase a taxi cab. The taxi had a four-year useful life and a $3,700 salvage value. Required a. Determine the amount of depreciation expense that would appear on the Year 1 and Year 2 income statements. b. Determine the amount of accumulated depreciation that would appear on the Year 1 and Year 2 balance sheets. Year 1 Year 2 a Depreciation expense b. Accumulated depreciation S 6,576 $ 13,150 16.850 S 23,425 $ On January 1, Year 1, Your Ride Incorporated paid $30,000 cash to purchase a taxi cab. The taxi had a four-year useful life and a $3,700 salvage value. Required a. Determine the amount of depreciation expense that would appear on the Year 1 and Year 2 income statements. b. Determine the amount of accumulated depreciation that would appear on the Year 1 and Year 2 balance sheets. Year 1 Year 2 a Depreciation expense b. Accumulated depreciation S 6,576 $ 13,150 16.850 S 23,425 $ Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A: 3'-ACTGTTAGA-5' B: 3' -AAATTTGGC-5' C: 3' -ATGCTTTGA-5' D: 5' -GGGACCCGA-3' E: 5' CCCTGGGCT-3' which common aspects of elizabethan drama adhered to neoclassical rules? tell us about a time when you were resistant to change in your current workplace or former workplace. describe the scenario, why were you resistant, and explain the outcome. calcuate the enthalpy change upon converting 2.5g of water at -35.0 c to steam at 140.0 c under a constant pressure of 1 atm. An isolation transformer has the same input and output voltages. a. True b. False Write algorithm and draw a Flowchart to print natural numbers from 1-20 Homo Habilis had relatively short legs. This suggests that it retained a primitive form of bipedalism more similar to australopithecines than modern humans, as is the casewith many of its features.O True False Express the limit as a definite integral on the given interval. lim [5(x) - 3x,*]4x, [2, 8] n[infinity]0 i=1 19 dx 2 are income distributions from a qualified state tuition program taxable Use a change of variables to evaluate the following indefinite integral. 5(x2 + 3x) (6x2 +3) dx .. Determine a change of variables from x to u. Choose the correct answer below. 6 O A. u= x + 3x O B