Nadia is mountain climbing. She started at an altitude of 19.26 feet below sea level and then changed her altitude by climbing a total of 5,437.8 feet up from her initial position. What was Nadia’s altitude at the end of her climb? 3,511.8 feet above sea level 5,245.2 feet above sea level 5,418.54 feet above sea level 5,457.06 feet above sea level

Answers

Answer 1

Answer:

5418.54

Step-by-step explanation:

because yes


Related Questions

If x = 4, what is the value of 4/5 (2 + 7) − 2/3 (2 + 7)?
A 2
B 5
C 15
D 22

Answers

Answer:

d=56

Step-by-step explanation:

A bag contains 28 colored marbles. There are 5 blue marbles, 9 red marbles, 11 yellow
marbles, and 3 clear marbles. What is the ratio of red marbles to yellow marbles?

Answers

Answer:

9:11

Step-by-step explanation:

9 red marbles to (or ":") 11 yellow marbles

Answer:

9/11

Step-by-step explanation:

because a ratio is a comparison between two numbers by division.

A rectangular pool has a length of 200 ft. You're building a model. Using a scale
factor of 1725, what is the scale length of your model? *

Answers

Answer:

1.4 inches.

Step-by-step explanation:

Given that the length of the pool = 200 ft.

Scale factor = 1725.

As,

[tex]\text{Scale factor }=\frac{\text{Original length}}{\text{Scaled length}}[/tex]

So,

[tex]\text{Scaled length} = \frac{\text{Original length}}{\text{Scale factor}}[/tex]

By using the given values, we have

{Scaled length} [tex]= \frac{200}{1725} ft.=0.116 ft.[/tex]

As 1 foot = 12 inch,

So, scaled length = 0.116 x 12 = 1.4 inches.

Hence, the scale length of the model = 1.4 inches.

300/12.500000000000000000​

Answers

Answer: 24

Step-by-step explanation: Hope this helps.

Write the equation of the exponential function given two points: (1,6) (3,96)

Answers

Answer:

y = 3/2 ⋅  4^x

Step-by-step explanation:

I hope this helped! please mark as brainliest

raise the product of 36 and 9 to the power of the sum of 2 and 4

Answers

Answer:

1.15683 1381 * 10^15

Step-by-step explanation:

To get the answer, first, get the product of 36 and 9

This can be obtained by multiplying 36 with 9

36 * 9 = 324

We then raise 324 to the power of the sum of 2 and 4

The sum of 2 and 4 is gotten by adding 2 to 4

So,

2 + 4=6

Therefore, 324 raised to the power of 6

= 1.15683 1381 * 10^15

why did my dog eat my cat???​

Answers

Answer:

'Cause he was yummy and cats are ugly.

Answer- I think so, but you should cut it open and find out, it could be brutal

what is the answer to 7+1+10t

Answers

Answer:

18

Step-by-step explanation:

Help plzzzz will give brainliest

Answers

Answer:

It's positive.

Step-by-step explanation:

There are many reasons.... but one of the obvious ones is that it would've shown negative, correct?

It’s positive. Both the x and y axis continue to go up

The length of a rectangle is 3 more than 3 times its width. The perimeter of the rectangle is 174 inches. What is the length of the rectangle?

Answers

Answer:

l = w + 3cm

l = w + 3cmp = 2l + 2w = 58cm

l = w + 3cmp = 2l + 2w = 58cm

l = w + 3cmp = 2l + 2w = 58cm Solve by substitution:

l = w + 3cmp = 2l + 2w = 58cm Solve by substitution:2l + 2w = 58 ⇒ 2(w + 3) + 2w = 58

l = w + 3cmp = 2l + 2w = 58cm Solve by substitution:2l + 2w = 58 ⇒ 2(w + 3) + 2w = 58⇒ 2w + 6 + 2w = 4w + 6 = 58

l = w + 3cmp = 2l + 2w = 58cm Solve by substitution:2l + 2w = 58 ⇒ 2(w + 3) + 2w = 58⇒ 2w + 6 + 2w = 4w + 6 = 58⇒ 4w = 52 ⇒ w = 13

l = w + 3cmp = 2l + 2w = 58cm Solve by substitution:2l + 2w = 58 ⇒ 2(w + 3) + 2w = 58⇒ 2w + 6 + 2w = 4w + 6 = 58⇒ 4w = 52 ⇒ w = 13

l = w + 3cmp = 2l + 2w = 58cm Solve by substitution:2l + 2w = 58 ⇒ 2(w + 3) + 2w = 58⇒ 2w + 6 + 2w = 4w + 6 = 58⇒ 4w = 52 ⇒ w = 13 Plug back in:

l = w + 3cmp = 2l + 2w = 58cm Solve by substitution:2l + 2w = 58 ⇒ 2(w + 3) + 2w = 58⇒ 2w + 6 + 2w = 4w + 6 = 58⇒ 4w = 52 ⇒ w = 13 Plug back in:l = (13cm) + 3cm = 16cm

l = w + 3cmp = 2l + 2w = 58cm Solve by substitution:2l + 2w = 58 ⇒ 2(w + 3) + 2w = 58⇒ 2w + 6 + 2w = 4w + 6 = 58⇒ 4w = 52 ⇒ w = 13 Plug back in:l = (13cm) + 3cm = 16cmStep-by-step explanation:

I hope this helps you.

If the measure of the width is 21 inches. Then the measure of the length of the rectangle will be 66 inches.

What is a rectangle?

It is a polygon with four sides. The total interior angle is 360 degrees. A rectangle's opposite sides are parallel and equal, and each angle is 90 degrees. Its diagonals are all the same length and intersect in the center.

The length of a rectangle is 3 more than 3 times its width. The perimeter of the rectangle is 174 inches.

Then the length of the rectangle will be

We have

L = 3W + 3

Then the perimeter will be

   P = 2(L + W)

174 = 2 (3W + 3 + W)

87 = 4W + 3

84 = 4W

 W = 21 inches

Then the length will be

L = 3W + 3

L = 3 x 21 + 3

L = 63 + 3

L = 66 inches

More about the rectangle link is given below.

https://brainly.com/question/10046743

#SPJ2

Please help with the problem in the picture ^ I’ll give brainliest if you give me a small explanation! :)

Answers

Answer:

96 loaves

Step-by-step explanation:

6 hours is 360 minutes. Divide that by 45 min equals 8. If he can bake 12 every 45 min, then he can bake 8 x 12 loaves in 6 hours or 96 loaves.

Answer:

A, 96 loaves of bread

Step-by-step explanation:

So first off, since the rate is in minutes and not hours, you would first find how many minutes are in 6 hours. 60 minutes per hour multiplied by 6 hours gets you 360 minutes. You would now divide 360 by 45, and that would get you 8. You now have 8 units of 45 minutes, if that makes sense. You would now multiply 8 by 12, and get 96 loaves of bread.

Find the slope of the line passing through the points (-4,9) and (-4,-6).

Answers

Answer:

Indefinite answer

Step-by-step explanation:

Use formula

Y2 - y1 over x2 - x1

Guess what -4 - -4 gets cancelled and denominator becomes 0

The sum of 13 and twice a number and is it linear

Answers

Answer:

Step-by-step explanation:

The number is already defined as ' h '. "Twice" means times by 2. So, 13 and twice 'h' are being added together. Here 13 and h are to be added, and the answer is doubled.

The perimeter of the triangle is 350 units. Find the measure of each side (label your answers).

Answers

Answer:

125, 105, 120

Step-by-step explanation:

You would first make an equation with what you know:

x + 45 + x + 25 + x + 40 = 350.

Now, you would simplify and add like terms.

3x + 110 = 350

Now, you would subtract 110 from both sides.

3x = 240

Now, you would divide both sides by 3.

x = 80

Now that you know what x is, simply plug it in to the respective equations for all three sides.

x + 45 would become 80 + 45, and add up to 125.

x + 25 would become 80 + 25, and add up to 105.

x + 40 would become 80 + 40, and add up to 120.

To check your work, you would now add the three totals.

125 + 105 + 120 = 350.

Find the circumference of a circle with a radius of 19 inches. Give an exact answer.
Provide your answer below:

Answers

Answer:

119.38

Step-by-step explanation:

Answer:119.3805208 inches

Step-by-step explanation:

1) Which statement below is equivalent to - 15 - 12? Ex choice. a) - 15 + 12=-3 b) -15 +-12=-27 c) 15 - 12=3 d) 15--12=-27 ANSWER: EXPLAIN:​

Answers

ANSWER: B
It’s equivalent to -15-12

HOPEFULLY MY LAST ONE!!!!

What is the slope?

Simplify your answer and write it as a proper fraction, improper fraction, or integer.

Answers

Answer:

1/3

Step-by-step explanation:

Rise/run

10/30

I hope this is right and that it helps.

Use these points to find out the slope: (10,60) , (40,70)
Slope: 1/3

(HELP! MARKING BRAINLIEST) At 2pm, a store had sold 15 packs of toilet paper. By 5pm, the store had sold 57 packs of toilet paper. What is the average rate of change?

Answers

Answer:

14 packs per hour

Step-by-step explanation:

The store sold 57 - 15 = 42 packs of toilet paper in 3 hours.

42 packs in 3 hours = 42/3 = 14 packs per hour

0.3, 0.08, 0.003, 0.83
In order from smallest to largest

Answers

0.003, 0.08, 0.3, 0.83

Answer:

0.003, 0.08, 0.3, 0.83

Which is a simplified form of the expression -6a + 2(2a + 2)?
A. -2a + 4
B. -2a – 4
C. 2a + 4
D. 2a – 4

Answers

Answer:

A.

Step-by-step explanation:

We have the expression:

[tex]-6a+2(2a+2)[/tex]

First, let’s distribute the 2 on the right:

[tex]=-6a+2(2a)+2(2)[/tex]

Multiply:

[tex]=-6a+4a+4[/tex]

Now, combine like terms:

[tex]=-2a+4[/tex]

Hence, our answer is A.

Answer:

a

Step-by-step explanation:

3x + 6y = 42 and -7x + 8y = -109 solve by elimination

Answers

Answer:

Point Form

(15,-1/2

Equation Form

x=15 and y= -1/2

Step-by-step explanation:

ucjvlvjcyxgxjglhlchzfzhckcj​

Answers

Answer:

Huhuhuhhuh?!!!

Step-by-step explanation:

LOL.. What's that?

Answer: approximately oihfviauegfvyabgfiubaqvuoa

Step-by-step explanation:

first you gotta ohgnvailuerfhivlugehiuvlh the fepoghvapirugv93hrv9igp

then once thats done you edjfahuilurevh the p8eufhavipuhgfv8i7uh to the rfugvhligauerhgiuvlwhreaoiuvh

finally, you ifujevhoaiug the iujhfliauerhgifu with the oifuhewiuasrhfi and uirjewg it to the iudfhvailkvkaebrfvilhjb, and you get your answer

Does the graph represent a function?

Answers

I believe the answer is No, the graph doesn’t represent a function. It has more than one of the same x value.

is 16-7=4+5 true, false, or open?

Answers

Answer:

open

Step-by-step explanation:

Answer:

This is True.

Step-by-step explanation:

16-7=9

5+4=9

same ting

there are 17 boxes each box holds 42. how many packets of sweets are there in total?

Answers

Answer: 714

Step-by-step explanation:

42 • 17 = 714

divide to check if it is correct

714 ÷ 42 = 17 or 714 ÷ 17 = 42

hope it helps!

Answer:

No.of sweets in one box = 42

No.of sweets in 17 boxes = 42 x 17

                                          = 714

107 is what percent of 160.9?
(HELP NOW PLS)

Answers

Answer:

66.5%

Step-by-step explanation:

107/160.9 = 0.665001 = 66.5%

What is 31.99 divided by 5.99 in long division? Explain & I will mark as brainliest

Answers

Answer:

Its 5.3405  I think:>

Step-by-step explanation:

The length of a rectangle is 3 more than 3 times its width. The perimeter of the rectangle is 174 inches. What is the length of the rectangle?

Answers

Answer:

180

Step-by-step explanation:

just add 174 to 3 +3 then ya will find ya andwer

help me asap please!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

D. should be the answer

Ha, Asa and Aas are correct because there is only one known side, and two known angles, making these postulates correct.

A taxi company charges $2.25 for the 1st mile and then $0.20 per mile for each additional mile, or F= $2.25+ $0.20 (m-1) where F is the fare and m is the number of miles. If Juan’s taxi fare is $7.65 ,how many miles did he travel in the taxi?

Answers

Answer:

28

Step-by-step explanation:

F=2.25+0.20(m-1)

7.65=2.25+0.20(m-1)

5.4=0.20(m-1)

5.4/0.20=0.20(m-1)/0.20

27=m-1

28=m

Other Questions
Which statement illustrates bias in scientific research?A zoologist publishes incomplete data on sloths which supports their original hypothesis and notes that more research is required.A botanist publishes data about plant growth that does not support their original hypothesis and is replicable.An ecologist publishes data funded by a construction company which supports their original hypothesis that an endangered animal's territory is not endangered.A microbiologist publishes data funded by the National Institutes of Health that does not support their original hypothesis. Help me please!!! I need a short letter, using basic or simple teems, words, vocabulary. I would like to be Cabinet member perspective. But Natives is also fine with me. Thanks. Please need help Choose the words that complete the following sentence.Direct quotes needaround them, or else it is considered(1 point)O quotation marks/summarizingO quotation marks/plagiarismO parentheses/summarizingO parentheses/plagiarism I love you. You are worth it. What does this quote mean? Thanks! Ayala is making salad dressing. She mixes oil andvinegar in a blender until a smooth consistency isformed. Explain whether this is a heterogeneous or ahomogeneous mixture and why. Help?Jessica must determine how many packages of cookies and cupcakes to buy for her family reunion. Jessica's mother has asked her to buy the same number of each type of item but no more than 100 of each. At the bakery, Jessica finds that cookies are sold in packages of 12 and cupcakes are sold in packages of 9.Use the drop-down menus to select the answers that make each statement true.The greatest number of packages that Jessica can buy is _ packages of cookies and _ packages of cupcakes. explain what happens when particles collide When a story is told from the _____, the narrator has full knowledge of all the characters. omniscient third-person point of view reliable first-person point of view unreliable first-person point of view limited third-person point of view The product of the ages of two adults is 572. Find their ages. Guys, I need help ASAP!! The standard deviation of the following data set is 0.31. 95% of the data would fall in which range?4.3, 5.1, 3.9, 4.5, 4.4, 4.9, 5.0, 4.7, 4.1, 4.6, 4.4, 4.3, 4.8, 4.4, 4.2, 4.5, 4.4Pr (3.88 X 5.12)Pr (2.67 X 5.33)Pr (4.19 X 4.81)Pr (3.57 X 5.43) ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut a student performed an experiment, using a cocktail peanut, before it was burned the peanut half weighed .353 g. After burning the residue weighed .016 g. The energy released by the conjunction increased the temperature of 200. mL of water in the calorimeter by 7.2 degrees Celsius. Calculate the mass of peanut consumed in the combustion. twice the sum of k and 9 is 4 The product of a number and -5 is at least 35. Write as an inequality. who killed the district judge during the revolutionary movementanswer in one sentence Quick question for you all People who complain that video games involve too much sitting are probably old. They probably dont know very much about gaming, either. They dont realize that people can play virtual sports, such as tennis, on video games. There are video games for dancing, too. If people bothered to learn about the different kinds of video games, they would see how wrong they are. This students sample paragraph addresses the counterclaim. Critique this paragraph by answering the questions.What is the counterclaim?Video games are too violent.Video games make people inactive.Video games are different today.What evidence weakens the counterclaim?People who complain are old.Sitting too much is bad for people.There are video games for sports and dancing.What is the tone of the rebuttal?respectfulrudehumorous Mention the type of seeds that undergo hypogeal germination.What do we call the process of permanently stopping babies from breast feeding?plzz help it is due today 2) look closely at article XLVII. Rephrase it in your own words. How do you think this impacted the unity among slaves during the revolution?Please I need help!