Answer:
Cellular respiration produces the energy cells need to function, in the form of ATP.
Explanation:
Which is an environmental factor that would MOST LIKELY have an adverse impact on the stability of an ecosystem?
The climate change would most likely exhibit an adverse influence on the stability of an ecosystem.
Climate change impacts on ecosystems:Climate change influences ecosystems in numerous ways. Warming may make the species to migrate to higher elevations or latitudes where temperatures are more favorable.
Climate change is resulting in the elevation of sea level, resulting in intrusion of seawater into the freshwater system, which is forcing the key species to relocate. Thus, removing the prey or predators, which are essential for the stability of the ecosystem.
Due to climate change, the vegetative biomes in the United States is predicted to change across 5 to 20 percent by 2100. A specific species due to climate change ca ripple through a food web and influence a broad array of other species, thus, disrupting the food web.
Change in climate and shift in ecological conditions could support the spread of parasites, pathogens, and diseases with potentially adverse influences on agriculture, human health, and fisheries. Climate change, along with pollution and habitat destruction is one of the stressors, which can result in the extinction of species.
Thus, climate change is the environmental factor, which would most likely exhibit an adverse influence on the stability of the ecosystem.
Find out more information about the impact of climate change on the ecosystems here:
https://brainly.com/question/11607190
Graves’ Disease is an autoimmune disorder that causes an overproduction of the hormone produced in the thyroid. These hormones are responsible for cellular metabolism. What would this disorder probably result in?
Answer:
Explanation:
Graves' disease is an autoimmune disorder in which antibodies produced by your immune system stimulate your thyroid to produce too much T4. It's the most common cause of hyperthyroidism. Hyperfunctioning thyroid nodules (toxic adenoma, toxic multinodular goiter or Plummer's disease).
please hellp asappppp In an area with very tall trees shading an understory of shorter trees, all of which have epiphytes growing on them, which of the following other conditions are most likely to exist as well?
It is near 30° latitude north or south or on the leeward side of a mountain range.
Moist air is rising over the area.
Night temperatures are much colder than daytime temperatures.
The soil has a thick layer of decomposed, nutrient-rich organic material.
There is an extremely high diversity of species in the area.
There is little rainfall and frequent fires regularly cut the vegetation to the ground.
4 and 6
1 and 3
2 and 5
3 and 4
please please give me the brainlyest answer
Sand dollars are radially symmetrical and have an internal skeleton but no backbone. Which phylum do sand dollars belong in?
chordates
echinoderms
arthropods
mollusks
Answer:
echinoderms
Explanation:
they are in the same family as starfish and sea urchins
Answer:
echinoderms
Explanation:
I hope this helps
Metal atoms tend to give away valence electrons when they bond with non metals atoms what type of bond will form between the metal and nonmetal atoms and why does this bond form
(A) a covalent bond will form because electrons are transferred
(B) a iconic bond will form because electrons are transferred
(C) a covalent bond will form because electrons are shared
(D) a iconic bond will form because electrons are shared
Answer:
Answer is B
Explanation:
due to ionic bonds transferring electrons in order to be stable
Answer:
b 2
Explanation:
human rights violated when George Floyd was apprehended
Answer:
tell me how to answer it
Explain how one celled organisms get oxygen in water.
Answer:
n unicellular organisms, oxygen diffuses across the cell membrane into the cell. Carbon dioxide diffuses out of the cell once the concentration of carbon dioxide is higher inside the cell than it is outside of the cell. Some micro-organisms, including some bacteria and fungi, can survive without oxygen.
Explanation:
HELP!!! MAJOR GRADE!!!!!
Gregor Mendel conducted thousands of genetic experiments using pea plants. Mendel is called the Father of Genetics because it was these studies that lead to the principles of genetics. In one of his many experiments, he crossed purple-flowered pea plants with white-flowered pea plants. Much to his surprise, all of the offspring turned out to be peas with purple flowers in appearance.
Although Mendel used the term factors instead of genes, how did Mendel explain why all the pea plants had purple flowers and not a mixture of white and purple flowers?
A.The offspring received the factors (genes) from both parents, but the genotype for purple flowers dominated over white flower pea plants.
B.The offspring only received the factors (genes) from the parent with the genotype for purple flowers and nothing from the white flower parent.
C.The offspring received the factors (genes) from both parents, but the phenotype for purple flowers dominated over the factor for white flowers.
D. The offspring only received the factors (genes) from the parent with the phenotype for purple flowers and nothing from the white flower parent.
Answer:
A
Explanation:
The purple gene was dominant, so though the plants got "factors" from both parents, only the purple gene was expressed in their phenotype (purple petals).
A 10.0 cm3 sample of copper has a mass of 89.6 g. What is the density of copper?
Answer:
[tex]\boxed {\boxed {\sf d=8.96 \ g/cm^3}}[/tex]
Explanation:
Density can be found by dividing the mass by the volume.
[tex]d=\frac{m}{v}[/tex]
The mass of the copper is 89.6 grams.
The volume is 10 cubic centimeters.
[tex]m=89.6 \ g\\v= 10 \ cm^3[/tex]
Substitute the values into the formula.
[tex]d=\frac{89.6 \ g }{10 \ cm^3}[/tex]
Divide.
[tex]d=8.96 \ g/cm^3[/tex]
The density of copper is 8.96 grams per cubic centimeter.
HELP ASAP EMERGENCY NEED NOW BRAINLIEST 100 POINTS!
A diagram showing two plates colliding, with one plate moving below the other. What type of plate boundary is illustrated in the image? What is the movement of one plate below another called?
Answer:
Hello There!! :D
Explanation:
Your answers are:
1. Convergent
2. Subduction
Hope this helps you!! ♥️♥️♥
- abakugosimp
Answer:
A. Convergent
B. Subduction
Explanation:
What type of plate boundary is illustrated in the image?
✔ convergent
What is the movement of one plate below another called?
✔ subduction
Two amino acids unite by forming a(n) bond between them and releasing a molecule of . The union of many amino acids forms a macromolecule called a .
Answer:
Protein/nucleic acid/Carbohydrates/lipid
The correct and most appropriate words to fill in the blanks are: peptide, water and protein.
An amino acid can be defined as a simple organic chemical compound that is made up of an acidic carboxyl group (COOH), a basic amino group ([tex]NH_2[/tex]), and a variable (unique) side chain group.
Generally, an amino acid is typically named after two (2) of its functional groups and these are:
An acidic carboxyl group (COOH): it acts like an acid.A basic amino group ([tex]NH_2[/tex]): it acts like a base.
Basically, a peptide bond is formed between two amino acids when they unite. Also, this chemical reaction lead to the release of a molecule of water.
Finally, the union of many amino acids forms a macromolecule called a protein.
In conclusion, protein is a macromolecule which is formed as a result of the union of many amino acids.
Read more: https://brainly.com/question/14681125
Which of the following is the most important reason to maintain a high level of cardiovascular health?
A. A higher level of fitness makes it easier to develop larger muscles.
B. A higher level of fitness makes you more attractive to other people.
C. A higher level of fitness allows you to live a longer, healthier life.
D. A higher level of fitness improves your IQ.
Answer:
C
Explanation:
I think because the more healthier you are, the longer you'll live
if 28% of the bases in a DNA strand are guanine, what percentage are thymine
Answer:
22%
Explanation:
According to Erwin Chargaff in his complementary base pairing rule, a DNA molecule consists of four nucleotide bases that pair with one another in the follow order: Adenine (A) to Thymine (T), and Guanine (G) to Cytosine (C).
According to Chargaff, the amount of Adenine in the DNA equals the amount of Thymine while the amount of Guanine in the DNA equals the amount of Cytosine. The sum of all the bases equals 100%. That is;
A + T + G + C = 100%
In this question, if 28% of the bases in a DNA strand are Guanine, the amount of Cytosine will also be 28%. Hence,
28% + 28% + A + T = 100
56% + A + T = 100
A + T = 100% - 56%
A + T = 44%
Since, A = T
A/T = 44/2
A/T = 22%
Hence, the amount of Thymine in the DNA strand will be 22%
differences between reproduction in mammals and amphibians.
Answer:
the answer is a little weird but hope this helps
Explanation:
While all of these animals reproduce sexually (meaning that the species consists of males and females and mating involves the fetilization of eggs by sperm), reptiles and mammals reproduce through internal fertilization (inside the female) whereas amphibians practice external fertilization.
Answer:
While all of these animals reproduce sexually (meaning that the species consists of males and females and mating involves the fetilization of eggs by sperm), reptiles and mammals reproduce through internal fertilization (inside the female) whereas amphibians practice external fertilization
_______ is where both organisms gain from the interaction. A. Commensalism B. Mutualism C. Predation
Answer:
B. Mutualism
Explanation:
Mutual means both parties feel the same way, so they both gain from the interaction. I just looked at the root of the word
Answer:
b . mutualism
Explanation: MUTUALISM IS A FORM OF SYMBIOSIS WHEREBY BOTH ORGANISMS INVOLVED BENEFIT FROM THE RELATIONSHIP
The part of the eye through which light travels
to the lens is the:
A iris.
B optic nerve.
C retina.
D pupil.
Answer: B optic nerve.
Explanation:
How are karyotypes utilized in diagnostic medicine?
1 page essay
Answer: they are used usually in the congotitus form of medicine
Explanation: connecus
EASY 7TH GRADE SCIENCE FIRST PERSON MARKED BRAINLIEST!!!!
Which information does a student need to differentiate between the speed and the velocity of a vehicle in motion
A. The rate of the motion
B. The direction of the motion
C. The change in the amount of motion
D. The amount of distance traveled during motion
Answer: The action from a force can cause an object to move or can speed up accelerate, to slow down (decelerate), to stop, or to change direction. Since any change in velocity is considered acceleration, it could be said that a force on an object results in the acceleration of a object.
Explanation:
Answer:
(B) The direction of the motion
Explanation:
i need help
i need ideas. Basically, you Create a story to teach class of 2024 and 2025 how to be good students. but its an Extra Credit Opportunity - Student Fable assignment.
i cant think of any ideas
What property is being shown in the picture below?
a. capillary action
b. adhesion
c. cohesion
d. all of the above
And explain why.
Nitrogenous bases are located on both stands of the DNA double helix. What is the significance of the nitrogenous bases?
Answer:
the nitrogenous bases form hydrogen bonds between opposing DNA strands to form the rungs of the Twisted ladder or double helix of DNA or biological catalysts that is found in the nucleotides.
Explanation:
hope this helps :]
HELP ME POR FAVOR WILL GIVE BRAINLIEST AND YOU GET 25 POINTS, WHAT A STEALLLL.. ok
Which sequence best explains the relationship between DNA and protein structure and function?
DNA → gene → protein → trait
DNA → amino acid triplets → protein → trait
DNA base triplets → amino acid sequence → protein folding pattern → protein shape and function
DNA shape → amino acid sequence → protein shape and function
ty <33
Answer:
DNA base triplets → amino acid sequence → protein folding pattern → protein shape and function
Explanation:
From Google:
"The Rules of Protein Structure. The function of a protein is determined by its shape. The shape of a protein is determined by its primary structure (sequence of amino acids). The sequence of amino acids in a protein is determined by the sequence of nucleotides [base triplet] in the gene (DNA) encoding it."
Spongy tissue is best described as dense smooth and homogenous
True or false
Which of the following is NOT a stage of the Cell Cycle (somatic cells)?
1. Cytokinesis
2. Meiosis
3. Interphase
4. Mitosis
Answer:
Meiosis
Explanation:
Only reproductive cells/gametes use meiosis.
Which statement below does NOT correctly describe water's chemical
properties?
a. Water is a neutral substance - it is neither a base or acid
b. Water is an inert substance
c. Water is not flammable or combustible
d. Water is reactive and catalyzes many reactions that take place inside living things
Answer:
b.
Explanation:
This is incorrect, because, "water is a powerful accelerator of chemical reactions."
Credit to www.astronno.com
Open Response 2 part A: Plant cells and fungal cells have many of the
same types of organelles. Structures X and Y are found in both plant cells
and fungal cells. Structure Z is found in plant cells, but not in fungal cells. A
- What is party?
X
Z
GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were
Answer:
u want step by step?
Explanation:
What is the lock and key theory of enzyme-substrate binding?
Answer:
Quick Reference. A theory to explain the mechanism of enzymatic reactions, in which it is proposed that the enzyme and substrate(s) bind temporarily to form an enzyme–substrate complex. The binding site on the enzyme is known as the 'active site' and is structurally complementary to the substrate(s).
Blood has a lower concentration of hydrogen ions than cellular cytoplasm. What does that tell us about the pH?
Answer:Acids and bases In the human body, both blood and the cytosol (watery goo) inside of cells have pH values close to neutral. ... A base, in contrast, raises pH by providing hydroxide (OH −start superscript, minus, end superscript) or another ion or molecule that scoops up hydrogen ions and removes them from solution.
Explanation:
When experiencing oxygen debt, why do human cells not carry out the process of alcoholic fermentation?