Pls help due today, would be greatly appreciated.

Pls Help Due Today, Would Be Greatly Appreciated.

Answers

Answer 1
For the first 2 rows it’s going to be the dominant phenotype. So “purple flowers” for the 1st and 2nd row and white flowers for the last one. For the first row on #17 it’s going to be “FF “and “ff” for the 2nd. Tongue roller is “TT” and non tongue roller is “tt.”

Related Questions

Which adaptation is most likely found in tropical trees?

Answers

Answer:

birds and squirrels

Explanation:

Answer:

The leaves of forest trees have adapted to cope with high rainfall. Many tropical rainforest leaves have a drip tip. It is thought that these drip tips enable rain drops to run off quickly.

Hope this helped!!!

How is the ocean affected by the releasing of excess carbon?

Answers

Answer:

Explanation:

Because of human-driven increased levels of carbon dioxide in the atmosphere, there is more CO2 dissolving into the ocean. The ocean's average pH is now around 8.1 , which is basic (or alkaline), but as the ocean continues to absorb more CO2, the pH decreases and the ocean becomes more acidic.

How does the large intestine help the body excrete wastes?
It reabsorbs water from filtrate.
It forms urine.
It removes urea from the body.
It processes undigested food into feces.

Answers

Answer:

It processes undigested food into feces.

Explanation:

Answer:

D. It processes undigested food into feces.

Explanation:

Correct on EDGE 2021!

The diagram shows part of an aquatic food web
for a stable lake ecosystem in Connecticut.
Turtles
Large fish
Small fish
Aquatic insects
Tadpoles
Water fleas
Rotifers
Algae
What is the source of energy for the algae?
A waves
B. sunlight
C. bacteria
D. rotifers, water fleas and tadpoles

Answers

Answer:

Sunlight

Explanation:

I just got it wrong because of the wacko below or above me gave me the wrong answer

Algae possess chlorophyll in their cells. They use carbon dioxide in a manner that is analogous to how we use food. Thus, option B is correct.

What is a characteristic feature of algae?

By converting light energy to chemical energy through the process of photosynthesis, carbon dioxide and water are transformed into organic molecules.

Nearly all algae engage in the process, and in fact, much of what is currently known about photosynthesis was first uncovered through research on the green alga Chlorella.

Like other plants, algae benefit from sunlight, therefore denying them of it will limit or even completely stop their growth. For several days, completely shading the tank or aquarium from light is essential.

Therefore,  algae require sunshine because algae can photosynthesize, or use sunlight to change carbon dioxide into biological material.

Learn more about algae here:

https://brainly.com/question/13921782

#SPJ2

Plants make sugar from sunlight through ______.
A. Phloem

B. photosynthesis

C. Xylem

D. osmosis

Answers

Answer:

B. Photosynthesis

Explanation:

Photosynthesis is the process plants go through to make glucose, also known as sugar.


Question 4
Blood sugar homeostasis plays an important role in our health and well-being. If
blood sugar levels get too low or high, there are serious health complications that
can result. Which two body systems regulate blood sugar levels? Click on the correct
answers.

Select 2 correct answer(s)

A-Nervous System
B-Musculoskeletal System
C-Respiratory System
D-Digestive System

Answers

Nervous and digestive system

Some evidence on the safety of vaccines.

Answers

Answer:

The safety an​d effectiveness of vaccines​ are under constant study. Because vaccines are designed to be given routinely during well-child care visits, they must be extraordinarily safe. Safety testing begins as soon as a new vaccine is contemplated, continues until it is licensed, and is monitored indefinitely after licensure.

Explanation:

Answer:

well

Explanation:

Before a vaccine is ever recommended for use, it’s tested in labs. This process can take several years. FDA uses the information from these tests to decide whether to test the vaccine with people.

During a clinical trial, a vaccine is tested on people who volunteer to get vaccinated. Clinical trials usually start with 20 to 100 volunteers, but eventually include thousands of volunteers. These tests can take several years and answer important questions like:

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

How might we predict whether their next child will show the trait of albinism?

Answers

Answer:

By taking the baby to a doctor so that they can doi testing to see if you child has problems or heathy

Explanation:

The baby might need some shots

Scientific research shows that our global climate is changing. The global sea level is rising and ocean temperatures are...

Answers

the global sea level is rising and ocean temperatures are Increasing

Freckles are a dominant trait in humans. Both of the girls have the genotype FF for freckles. If either one marries a man with no freckles, what are the chances that their children will have freckles?
A. 0%
B. 50%
C. 75%
D. 100%
The answer is D. 100%

Answers

Answer: 50%

Explanation: 2 out of 4 of possible offspring will have a genotype (Ff) that results in a dominant phenotype. ff = recessive non-freckled offspring.

how does geosphere effect the rock cycle?​

Answers

Hydrosphere and Atmosphere: The erosion of rocks, a major part of the rock cycle and change in the geosphere over time, turns rock into sediment and then, sometimes, to sedimentary rock. ... Different combinations of sedimentary rocks form in environments with different climate conditions.

what are the two effects of world war one?

Answers

Answer:

1. Loss of almost an entire generation of young men by Europe.

2. Nationalism raised in the colonial empires

Explanation:

The First World War leads to destruction of empires. Numerous new nation-states were created. United States were forced to become a world power that in turn lead to the rise of Hitler and Soviet communism.

Effects of world war one are as follows:

1. Loss of almost an entire generation of young men by Europe.

2. Nationalism raised in the colonial empires

The energy needed for the changes in the water cycle to take place comes
from__.
A. wind
B.green plants
C.nitrogen
D.the sun

Answers

It’s D. I got it right lol

Question 5
Some human cells can perform anaerobic respiration for limited amounts of time, such as during periods of heavy exercise. Use the results of your experiment to explain how anaerobic respiration could benefit human survival.

Answers

Answer:

My experiment showed that energy production, or respiration, occurred in yeast even when little oxygen was present. During exercise, the lungs must work hard to take in oxygen, which then circulates to the body parts that need it. The ability to preform anaerobic respiration for short periods of time allows humans to sustain activity, even when oxygen is limited in the body.

Explanation: from plato, so change it a bit.

The experiment showed that energy production, or respiration, occurred in yeast even when little oxygen was present. During exercise, the lungs must work hard to take in oxygen, which then circulates to the body parts that need it. The ability to preform anaerobic respiration for short periods of time allows humans to sustain activity, even when oxygen is limited in the body.

What is anaerobic respiration ?

Anaerobic respiration is respiration using electron acceptors other than molecular oxygen (O2). Although oxygen is not the final electron acceptor, the process still uses a respiratory electron transport chain.

In aerobic organisms undergoing respiration, electrons are shuttled to an electron transport chain, and the final electron acceptor is oxygen. Molecular oxygen is an excellent electron acceptor. Anaerobes instead use less-oxidizing substances such as nitrate (NO−3), fumarate (C4H 2O2−4), sulfate (SO2−4), or elemental sulfur (S). These terminal electron acceptors have smaller reduction potentials than O2. Less energy per oxidized molecule is released. Therefore, anaerobic respiration is less efficient than aerobic.

Learn more about  anaerobic respiration

https://brainly.com/question/13943624

#SPJ2

List and describe three methods of nonpoint pollution control.
1.
2.
3.

Answers

Answer:

1. Protect drinking water by using less pesticides and fertilizers.

2. Reduce soil erosion by using conservation practices and other applicable best management practices.

3. Use planned grazing systems on pasture and rangeland.

Which of the following applications of genetic engineering is preventative and helps
individuals fight infection before its onset?

A)Insulin production
B)Vaccine production
C)Stem cell therapy
D)Gene therapy

Answers

B I think(sorry if you get this wrong)
The answer is B very sure

Bacteria Natural Selection

Answers

Answer:

Bacterial resistance arises through the simple process of natural selection. Bacteria divide rapidly, but DNA replication is imperfect. In the presence of antibiotics, while most bacteria are killed, a small number of resistant mutants may survive and take over.

Explanation:

When bacteria are initially exposed to an antibiotic, those most susceptible to the antibiotic will die quickly, leaving any surviving bacteria to pass on their resistant features

Don’t understand need help

Answers

Answer:

I think c

Explanation:

I took the quiz but I m not sure

Type _ blood is the universal donor
Type _ blood is the universal recipient

Answers

Answer:

Type O- blood is the universal donor

Type AB- blood is the universal recipient

Type O negative is universal donor
Type AB positive is the universal receiver

Identify the products of cellular respiration.

Answers

Answer:

Water and carbon (IV) oxide

PLEASE HELP ITS DUE IN 3 HOURS!! 6. Match the correct definition to each vocabulary term:


Answers

Answer:

In order from top to bottom

C

A

E

D

B

Explanation:

1) Reflection is when a ray hits something reflective then bounces back. For example, light reflects off a mirror, which is why you can see yourself in a mirror.

2) Wavelength measures the size of a wave. It is measured from the crest or trough of one wave to the crest or trough of another.

3) Refraction occurs when waves go through different mediums at different speeds. This is why a straw looks bent when in water.

4) Frequency is a way of measuring the speed of a wave. It shows how many waves pass every unit of time.

5) Absorption means that all of the waves were absorbed into the medium and none of them passed through.

State one important precaution regarding the apparatus used in all food tests​

Answers

Answer:

WEAR A LAB COAT TO PROTECT YOUR CLOTHES AGAINST THESE CHEMICALS, AND SAFETY GLASSES TO PROTECT EYES, UNLESS YOU ARE A SPECTACLE WEARER. (EXCEPT WET GLASSWARE, AND EMPTY CHEMICAL BOTTLES!). BE ESPECIALLY CAREFUL WITH HOT LIQUIDS AND WATERBATHS. KEEP CHEMICAL BOTTLES OFF THE BENCH, AND DO NOT CONTAMINATE PIPETTES

Explanation:

PLEASEEEE HELPPPPPPPPPPP
Professor Marcus has identified a new species of beetle in the Amazon Rainforest. The professor then investigates the process of gene expression in the cells of the beetle. Which is an expected result of the investigation?

A The processes of transcription and translation are unique in the beetle.

B The process of translation in the beetle is similar to other organisms, but involves a unique genetic code.

C The process of transcription in the beetle is similar to other organisms, but involves a unique set of nucleic acids in mRNA.

D The processes of transcription and translation, including the genetic code, are the same in the beetle as in nearly all other organisms.

Answers

Answer:

D The processes of transcription and translation, including the genetic code, are the same in the beetle as in nearly all other organisms.

Explanation:

Transcription is the cellular process where a specific DNA fragment called 'gene' is used as a template to create a complementary RNA molecule, usually a messenger RNA (mRNA). Subsequently, this mRNA is then used to synthesize a polypeptide chain (i.e., a protein) in the ribosomes. In eukaryotic organisms such as, in this case, beetles, both transcription and translation are essentially the same processes, and the genetic code used in the protein synthesis is also the same. The difference between beetles is the variation among DNA nucleotide sequences (genomes) which are used as templates to synthesize mRNAs, thereby their final products (proteins) are also different.

True or False?

It takes about the one million years for
the magma to complete one circular
convection flow.

Answers

Answer:

False, since it takes more than one million years

Explanation:

Speeds can be faster for small-scale convection occurring in low-viscosity regions beneath the lithosphere, and slower in the lowermost mantle where viscosities are larger. A single shallow convection cycle takes on the order of 50 million years, though deeper convection can be closer to 200 million years.

An organism, like a plant, that can make its own food is called (choose all
that are correct)
A. a heterotroph.
B. an autotroph.
C. a producer
D. a decomposer.

Answers

Answer:

B  

Explanation:

B. Autotroph

Explanation: An organism that produces its own nutrients from inorganic substances or from the environment instead of consuming other organisms.

3. Compare and contrast the movement produced by each of the three types

Answers

Answer:

strike-slip is when the blocks have mostly moved horizontally, normal is when a dip-slip fault in which the block above the fault has moved downward relative to the block below, and thrust is when the hanging wall moves up relative to the footwall.

There are three faults. Normal faults originate from the divergent boundary. Reverse faults originate from the convergent boundary. Strike-slip fault originate from transforming boundary.

What are the three types of fault?

We can differenciate three types of faults,

Normal fault ⇒ originate from divergent movementReverse fault ⇒ originate from convergent movementStricke-slip fault ⇒ originate from transforming movement

What are the boundary types?

I. Divergent:

This boundary occurs when two plates separate and molten material rises from the mantle creating a new crust.

The hot material creates a new seabed between the separating plates, expanding the sea bottom.

II. Convergent.

Collision area between two plates. Two oceanic plates might collide, or one oceanic plate with a continental one.

In this last case, the oceanic crust sinks under the continental plate, and magma rises to the surface by crevices.

The thicker and older plate subduces under the other plate.

III. Transforming.

The plates slide laterally with each other, and they are usually called faults.

It is associated, in general, with the oceanic ridge, although it might also occur in the continental plate.

No rocky material is either destroyed or formed.

When the plates move and produce a displacement of one transforming limits from side to side, earthquakes occur.

The movement breaks the crust and originates pronounced fractures.

You can learn mor about the movement produced by the three types of faults at

https://brainly.com/question/8548987

https://brainly.com/question/15441752

#SPJ2

Which sequence shows a correct pathway for the
flow of energy in a food chain?
A) bacteria → grass → fox → owl
B) grass grasshopper → frog - snake
C) fungi - beetle → algae - mouse
D) algae → snake → duck → deer

Answers

I think is B because the grasshopper is eaten by the frog and the frog is eaten by the snake.

The sequence grass →  grasshopper frog →  snake shows a correct pathway for the flow of energy in a food chain (Option B).

In a food chain, primary producers (e.g., plants and algae) generate organic compounds and energy that enter into the chain.

The primary consumers (e.g., herbivores) are organisms that eat primary producers.

Subsequently, secondary consumers (e.g., carnivores) are organisms that eat primary consumers and so successively in all the levels.

In conclusion, the sequence grass →  grasshopper frog →  snake shows a correct pathway for the flow of energy in a food chain (Option B).

Learn more in:

https://brainly.com/question/16065961

Newyork is near 40 degrees N. What general direction is air moving in Newyork

Answers

Answer:

The air in New York moves to the north.  

Explanation:

At a global level, it occurs unequal warming of the atmosphere, which depends on many factors and varies with latitude. These temperature differences occur because solar radiation reaches the earth differently at different latitudes degrees. The result is the formation of convective cells of atmospheric air circulation: Hardley cell, Ferrel cell, and Polar cell.    

The term convective cell refers to air getting warm, expanding, getting less dense, and ascending. During ascension, it gets colder because of the change in high, contracting, becoming thicker. Finally, it descends.

In each hemisphere, warm air ascends at the equator and approximately at 60º latitude. Cold air descends at approximately 30º latitude and the poles. These air masses circulation generates superficial winds that blow toward the equator between 0º-30º, and toward the poles between 30º-60º lat.  

Ferrel cell occurs between 30º and 60º latitude. At 30º lat, the cold air coming from the north in the tropopause meets the cold air coming from 0º, and both descend to lower altitudes due to its density and low temperature. When these air masses reach the ground, they diverge.  One part goes to 0º lat, while the other part goes forward to the north.  As it moves north, it gets warmer for being at lower altitudes. At 60º, this warm air coming from the 30º meets the polar air coming from 90º, and as it is warmer it ascends again. When it ascends to the tropopause, it is pushed by new air and moves to the south again. While doing so, it loses heat and becomes denser, descending again at 30º.  And so the cycle starts all over again. New York is located at 40º latitude approximately, so air goes forward to the north pole near the ground, but at 60º it elevates again. New York is then affected by the Ferrel cell.        

In the attached image you will find the three cells, circulating in different directions.  

Why is it important for DNA replication to be a
highly regulated process?

Answers

Answer:

Here you go

Explanation:

DNA replication is regulated to ensure all chromosomes replicate once and only once per cell cycle.Cell cycle regulation by protein phosphorylation ensures that pre-RC assembly can only occur in G1 phase, whereas helicase activation and loading can only occur in S phase.

Other Questions
how am i supposed to add subtitles to a video without have to waist money??? What factors contributed to the large human Loss in the Civil War? Whose bedroom is this. Whoch detail from the passage indicates that the narrator realizes her father has a kindly motive for his collecting Please Help!!!!You are part of a sales group that has been asked to give a presentation. Before you begin, what should you and your group do?A. Figure out who is the best public speakerB. Buy the best software on the market.C. Look into file sharing options so that everyone can work on the same file at the same time. D. Ask if you have to give a slide presentation, . What is the answer. Please dont send me links. I seriously need help. Please help i will give brainliest and 5 * and 20 points for the best answerread the story and answer the two quetions1. What mood is conveyed by this excerpt?A. SuperiorB. DominantC. HopefulD. Heroic2. Read the following dictionary entryrestraint/rstrnt/ noun 1. ameasure or condition that keeps someone under control 2. depriving or restricting a person of freedom 3. a device which limits or prevents movement 4. self-controlWhich definition best matches the use of the word restraint?A. Definition 1B. Definition 2C. Definition 3D. Definition 4i don't want to see any linkif i do you will be reported 82,78,86,82,94,84,90.What is the mode Choose the correct definition. Group of answer choices Sensitivity refers to the probability that a test correctly classifies as positive individuals who have preclinical disease. Sensitivity refers to the probability that a test correctly classifies individuals without preclinical disease as negative Specificity refers to the probability that a test correctly classifies individuals with preclinical disease as positive Specificity refers to the probability that a test correctly classifies as positive individuals who have preclinical disease. geometry multiple choice(will mark brainliest) can anyone guess what game i was playing by the looks of it Please answer and not give me links that make me download a whole bunch of stuff then just turn out to be an inappropriate picture (Yeah that's happened to me twice on here :/) The iodide in a sample that also contained chloride was converted to iodate by treatment with an excess of bromine: The unused bromine was removed by boiling; an excess of barium ion was then added to precipitate the iodate: In the analysis of a 1.54-g sample, 0.0596 g of barium iodate was recovered. Express the results of this analysis as percent potassium iodide. A custom fish tank shaped like a rectangular prism needs to have a length of 21 inches, a width of 16 inches and hold a volume of 6758 cubic inches. What height must the tank be made to meet these specifications? Complete the equation so that it represents the proportional relationshipshown in the table. Use the formula to find the simple interest:$34,100 at 4% for 3 years Write a summary for the article Funny women flourish in female-written comedies Bill launched a model rocket, and estimated its height h, in feet, after 1 seconds. His results are shown in the table.Time to 1 2 3 4Height, h 0 110 190 240 255Bill's data can be modeled by the function h(t) = -16t2 + 128t.Which value is the best prediction for the height of the rocket after 5.5 seconds? A. 150 ftB. 180 ftC. 220 ftD. 250 ftE 260 ft P=(L+B), then B=_____? 1+1=just like the question and give brainliest please i need points Which of the following statements accurately describe the HarlemRenaissance?1. It was a period of outstanding literary creativity.II. It helped redefine African-American expression.III. It was a result of the great migration of African Americans from southernto northern cities.IV. It took place from 1941 to 1949.OA. I and Ill onlyB. I, II, and Ill onlyOC. II and IV onlyD. I, II, and IV onlyE. II, III, and IV only