plz help quick. the sum of two numbers is 11. Three times the first number minus the second number is -3. what are the numbers? can i plz have work too?

Answers

Answer 1

Answer:

the first number is 2, the second number is 9 :)

I already answered this on your last question ;-;

Step-by-step explanation:

I wrote this on a piece of paper:

3 times ? minus ? = -3

And then I just kept replacing the question marks with what adds up to 11 until i got the answer lol.

Answer 2
The awnser is 5 because 3 times 5 is 15 minus 3 is 11

Related Questions

answer this please please pls ya

Answers

Answer:

A

Step-by-step explanation:

took the test

i wil give you a brainlyest if you help me and five stars simplify the expression like terms 2(x+6)+3x+4=

Answers

Answer: 5x + 16

Step-by-step explanation: distribute, add the numbers, and combine like terms.

Answer:

x = -3.2

Step-by-step explanation:

First, solve parenthesis:

2(x+6)+3x+4= 0  (Given)

2x + 12 + 3x + 4 = 0   (distributive property of equality)

Then, you comibine like terms:

2x + 12 + 3x + 4 = 0

5x + 16 = 0 (Combining like terms)        

And then, move the variables to the left and constants to the right:

5x + 16 = 0

5x = -16 (Subtraction property of equality) You subtract 16 from both side, since the variable is on the right already you leave it that way.

Finally, you divide both sides to get  the answer ( solve for X):

5x = -16

x = -3.2 (division property of equality)

There is your answer!

Hope this helps!

Derrick really wants to earn at least $330 at the Bike Shop. He earns $150 per week plus $15.50 for each bicycle that he assembles. How many bikes will he need to assemble this week in order to earn at least $330? (be careful when rounding in a real world problem to make sure that your answer works) Question 1 options: 10 bikes , 11 bikes , 12 bikes , 13 bikes

Answers

Answer: He will need to assemble 12 bikes, because 12 x 15.50 = $186 and $186 + 150 = $336

Step-by-step explanation: Don't need one :)) it's basic math

330-150= 180 then divide 180 by 15.50 and you will get 11.6129 and you can round that to 12 bikes

How the Right of Occupancy can be transferred or exchanged.

Answers

It can be transferred

Michael decided to make French toast. He finds a recipe that calls for the following ingredients:

FRENCH TOAST
8 slices of bread
4 eggs
2 cup of milk
1 teaspoon of cinnamon

Which of the following comparison statements describe how much milk is used for the slices of bread used (There are 2 correct answers)?
A.1/4 cup of milk for every 1 slices of bread
B.2 cup of milk for every 8 slice of bread
C.1 cup of milk for every 1 slice of bread
D.1 cup of milk for every 1/8 slice of bread
E.4 cups of milk for every 1 slice of bread

Answers

The answer is B, two cups of milk for every 8 cups of bread.

This is because when using a recipe you want to make sure to get the proportions right and the ratio of milk to bread is 2:8
The answer is B for sure good luck

In a day there are 86,400 seconds. Write this number in scientific notation.

Answers

8.64x10^4 is how it’s written in scientific notation

Answer: 86,400 in scientific notation is 86.4* 10^3

During a snowstorm, the temperature drops from 0 degrees F to -7 degrees F in 7 hours. On average, by how many degrees is the temperature change per hour?
(Will give brainliest for correct and most accurate answer.)

Answers

Answer:

-1°F

Step-by-step explanation:

simplify the expression 4x24

Answers

Answer:

96

Step-by-step explanation:

4*24 = 96

it’s 96! all you had to do was long multiplication! (4x4=16, bring up the 1. 4x2=8 8+1=9)
1
24
x 4
96

A cold water faucet can fill the bathtub in 12 minutes, and a hot water faucet can fill the bathtub in 18 minutes. The drain can empty the bathtub in 24 minutes. If both faucets are on and the drain is open, how long would it take to fill the bathtub?

The answer is not 10.3, I dunno why

Answers

Add 12+18=30 divide it by 2 because your putting them in the same tub make sure 15 minutes to fill the hot tub.

PLS HELP ASAP PLS AND TY

Answers

Answer:65

Step-by-step explanation:85-20=65

so hard

Answer:

65 feet

Step-by-step explanation:

85-20=65

3 ½ x 2/5 *
Three and one half times two fifths. which one is it .
2 points
10/14
14/10
35/4
4/35

Answers

Answer:

Step-by-step explanation:

[tex]3\frac{1}{2}=\frac{(3*2)+1}{2}=\frac{7}{2}\\\\\\3\frac{1}{2}*\frac{2}{5}=\frac{7}{2}*\frac{2}{5}=\frac{14}{10}[/tex]

He was a newcomer in the land, a chechaquo, and this was his first winter. The trouble with him was that he was without imagination. He was quick and alert in the things of life, but only in the things, and not in the significances.

What do you believe the author is trying to explain and tell the reader?

Tip: Think about what the author is wanting you to understand with the underlined sections. Fully develop your thoughts to answer this question.

Answers

Answer:

The author is trying to tell us that you need an imagination

Step-by-step explanation:

Create a proportion using the form = to represent the following word problem.

15 is 1 [tex]\frac{1}{2}[/tex] % of what number?

Answers

It’s 7 because 15 divided by 2, half is 7.5 then u get 7

help pls <33 pic provided

Answers

Answer:

(-10,-4) (10,2)

Step-by-step explanation:

Answer:

y= 4/1x+3

Step-by-step explanation:

y=mx+b

first identify "b", which is where the line crosses the y-axis, in the graph we can see it does so at unit 3.

b= 3

next, we will find where the line crosses any point on the graph perfectly, such as coordinate (1, 7). Now use unit 3 on the y-axis as your reference point, we can see coordinates (1, 7) is 4 units up and 1 unit to the right from our reference point. This indicates our "m",

m= 4/1

therefore, y=4/1x+3

A hot air balloon ascended to a height of 35 meters 2 minutes after launch. After some time, the balloon's altitude began to change by −3 1/4 meters every minute for 9 minutes. To avoid a tree, the hot air balloon flew up by 5 1/2 meters. What is the new altitude of the hot air balloon? I’m super confused! Please helpp.

Answers

10.25 maybe i could be incorrect

Chris paddles 5 miles down a stream in 3 hours. How far will she have paddled in 9 hours at this rate?

Answers

Answer: 15 miles

Step-by-step explanation: 5 miles / 3 hours = 1.6

1.6 x 9 = 15

15 Miles, you multiply 5 x 3 = 15!

Melissa did 10 math problems on 3 different days and she did 20 problems on 2 other days. How many problems did she complete in all? Choose the expression that is a correct translation of the problem.
(3 x 2) + (10 x 20)
(3 x 2) x (10 x 20)
(3 x 10) + (2 x 20)
(3 + 2) + (10 + 20)

Answers

Answer: 3 x 10 + 2 x 20

Step-by-step explanation:

Answer:

(3 + 2) + (10 + 20)

-hope this is correct and if not i hope it at least helped but have a good rest of your day:)

Step-by-step explanation:

consider the equation 8x-2y=24. Select True or False for each statement.

Answers

Answer:

c

Step-by-step explanation:

the answer is c hehehe

What is the distance between (2, -1) and (-1, -5) on the coordinat plane?

a. 7 units
b. 6 units
c. 5 units
d. 4 units

Answers

Answer:

D

Step-by-step explanation:

i think 4 units so d

Think about how you can use absolute value notation to express the distance between two points on a coordinate graph. For each pair of points below, find the distance between the given points and express your work using absolute value symbols.

(4, 9) and ( –5, 9)
(7, –1) and (7, –4)
(0, 9) and (0, –7)
(4, –8) and (–10, –8)

Answers

1. |4| + |-5| = 9
2. |-1| + |-4| = 5
3. |9| + |-7| = 16
4. |4| + |-10| = 14

Hope that helps :)

Reflection/Math please help

Answers

Answer:

Step-by-step explanation:

A' = (-4, 1)

B' = (-7, 2)

C' = (-2, 8)

D' = (-2, 3)

what the other guy said

Evaluate −4x−y+4 when x=−1/4 and y=3.
The value of the expression is .
(pls stay off here if you dont know how to do this because idk if yall know how it feels to fail math but im failing an trynna get t up.... pls stay off if u dont know)

Answers

-4(-1/4)-3+4
-4/1(-1/4)-3+4
(4/4)-3+4
1-3+4
-2+4
2
the answer is for the expression is 2

11020+12 In base 3

pls help

Answers

Answer:

I would help but this question is hard lol

Step-by-step explanation:

It’s 142 because 12020+12 is 142 I did some research

I haven't started learning variables, and stuff like that yet in class, and I wanna be ahead, so can somebody teach me?

Answers

Answer:

Step-by-step explanation

its really simple u replace the letter with the value they have given u

t= 6

= 6x6-20-32u

u=1/4

=36-20-32x1/4

Hey, so in this case, the variable are t and u.
They gave you the numbers that each variable represents. Which are:
t=6 and u=1/4
So now what you need to do is, replace the variables with the numbers they represent in the equation. So it’s gonna be:
6(6)-20-32(1/4)
So now use PEMDAS to calculate. PEMDAS (parentheses - exponents - multiplication - decision - addition - subtraction)

So multiply 6 with 6, and then multiple 32 with 1/4.
36-20-8
Now subtract to get the answer.

Answer:
36-20-8= 8

The answer is 8

You have 2 different savings accounts. For Account​ A, the simple interest earned after 3 months is $0.90. For Account​ B, the simple interest earned after 18 months is $22.50. If the interest rate is 3.6%for Account A and 2.5% for Account​ B, how much is the principal in each​ account? Which account earned you the most interest the first​ month? Explain your answer.

Account A has a principal of ​$BLANK. (Round to the nearest dollar as​ needed.)

Answers

You have to round it to 21 which is the answer

Think About the Process

The local movie theater decided to raise the ticket price 25%. The original ticket price was ​$12.Set up the percent equation to find the amount by which the ticket price rose. Then find the amount.
(answer this and please show your work thank you)

Set up the percent equation. Choose the correct answer below.
A. y = 25% ÷ 12
B. y = 25% × 12
C. y = 12 ÷ 25%
D. y = 12 + 25%

Answers

Answer:

a

Step-by-step explanation:

i passed grade 6 lol

Answer:

A UwU

Step-by-step explanation:

Hope I helped

Create a proportion using the form = to represent the following word problem.

78% of what number is 42?

Answers

Answer :
x = 53.85

Step by step explanation:
If 78% of x (some numbers) is equal to 42, then we must set this as an equation to find it.

1) Rewriting 78% as a fraction and considering that when we say 78% of some number (x) we mean a product.
78% = 78/100 ➡️ 78/100x = 42

2) Then we can go on :
100 * 78/100x = 42 * 100
78x = 4200
78x/78 = 4200/78 ➡️ x = 53.85

3) Alternatively, simply dividing 42 by 0.78 (78%) would come to the same result :

42/0.78 = 53.85
To get the solution, we are looking for, we need to point out what we know.

1. We assume, that the number 42 is 100% - because it's the output value of the task.
2. We assume, that x is the value we are looking for.
3. If 42 is 100%, so we can write it down as 42=100%.
4. We know, that x is 78% of the output value, so we can write it down as x=78%.
5. Now we have two simple equations:
1) 42=100%
2) x=78%
where left sides of both of them have the same units, and both right sides have the same units, so we can do something like that:
42/x=100%/78%
6. Now we just have to solve the simple equation, and we will get the solution we are looking for.

7. Solution for what is 78% of 42

42/x=100/78
(42/x)*x=(100/78)*x - we multiply both sides of the equation by x
42=1.28205128205*x - we divide both sides of the equation by (1.28205128205) to get x
42/1.28205128205=x
32.76=x
x=32.76

the area of a base of a cylindrical water tank is 12π square feet. the volume of water in the tank is dependent on the height of the water (h) and is represented by the function V(h) = 12π h
part a - find V to the power of -1 (h)
part b - what will the height of the water be when the volume reacher 420π cubic feet

Answers

Answer:

Step-by-step explanation:

V^-1(h)is find inverse function=h / 12π

V=12πh=420π

h=420π/12π=35 feet

The inverse of the function V(h) is V⁻¹(h) = h / (12π). And the height of the water is 35 feet.

What is the volume of a right circular cylinder?

Let r be the radius and h be the height of the cylinder. Then the volume of the cylinder will be given as,

V = π r²h cubic units

A cylindrical water tank's base measures 12π square feet. The volume of water in the tank is proportional to its height (h) and is represented by the function V(h) = 12π h.

The inverse of the function V(h) is given as,

h = 12π V⁻¹(h)

V⁻¹(h) = h / (12π)

If the volume is 420π cubic feet. Then the height of the water is given as,

420π = 12π h

h = 420π / 12π

h = 35 feet

The inverse of the function V(h) is V⁻¹(h) = h / (12π). And the height of the water is 35 feet.

More about the volume of the cylinder link is given below.

https://brainly.com/question/12763699

#SPJ2

pls help asap i need help plz
The table below shows the number of cookies in different numbers of packs:
Number of Packs Number of Cookies
2 6
3 9
4 12
5 25

Is this true or false? The numbers in the table represent a proportional relationship.

Answers

Answer:

False, It was till Pack 5 it was going up 3 every pack but at 5 it went up 13 cookies.

It is False , that’s ur answerrr

PLEASE HELP ME I'LL MARK BRAINLIEST!!!! I KNOW THE ANSWER ISN'T 2/6

Answers

Answer:

The answer would be 1/3.

Step-by-step explanation:

You chose 2/6 but you can simplify it to 1/3

Answer:

2/6 aka simplfy 1/3

Step-by-step explanation:

is 1/3

Other Questions
What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive How do you do this question? Abdul made $252 for 12 hours of work.At the same rate,how many hours would he have to work to make $105 XYZ Corporation, whose common stock is currently selling for $40 per share, is having a rights offering. The terms of the offering require 10 rights plus $35 to subscribe to one share of stock. Compute the theoretical value of a right before the ex-rights date. Est ce que quelqu'un pourrait bien corriger mon expression ecrite ou donner son avie dessus s'il vous plait A $10,000 bond with 18%/year, compounded semi-annually (interest is paid every six month) is available in the market. The bond matures in 10 years. The closest PW of this bond if the purchaser can earn 12%/year, compounded quarterly is:_____. My annoying brother likes to drive me crazy. There is no other who is that lazy. He whines to my mom night and day, until eventually gets his way. What is a sister to do, when he screams til he's blue? There is no way to win, for he gets under your skin. He does his best to kill all joy. Oh, how my brother does annoy! What is the tone of the poem PLZ HELP!!!Will mark brainliest44. Show that the quadrilateral with vertices A(0,0), B(a,0), C(a + b, c) and D(b, c) is a parallelogram. hehe i need help with the whole quiz basically:IFind the decimal that is equivalent to: A. 1.714 B. 0.583 C. 0.0583 D. 6. Another engine reaches its top speed from rest in 7.5 s. It is able to perform 250,000 J of wok inthat time How much power does this engine have in that time? The Yellow River is often called the cradle of Chinese civilization. It was along the banks of the Yellow River where the Chinese civilization first formed. The Yellow River is 3,395 miles long, making it the sixth longest river in the world. It is also called the Huang He River.Early Chinese farmers built small villages along the Yellow River. The rich yellow-colored soil was good for growing a grain called millet. The farmers of this area also raised sheep and cattle. Ancient China: Geography,Ken NelsonUsing context clues, which statement best defines the phrase "cradle of Chinese civilization?the place where the longest river in China startsthe place where most people in ancient China livedthe place where people in China began a farming culturethe only place in ancient China where people could farm What is an accurate statement about many of the first Africans to come to Louisiana?They came voluntarily.They were skilled laborers. They came in search of domestic work. They knew how to grow crops. Carter was given a box of assorted chocolates for his birthday. Each night, Carter treated himself to some chocolates. Carter ate 5 chocolates each night and there were originally 30 chocolates in the box. Write an equation for C,C, in terms of t,t, representing the number of chocolates remaining in the box tt days after Carter's birthday. When a space shuttle was launched, the astronauts on board experienced an acceleration of 29.0 m/s2. If one of the astronauts had a mass of 60.0 kg, what net force in Newtons did the astronaut experience? Which equation below has no solution?A) 3(6x + 8) = 24 + 18xB) 8(x + 4) = 12x - 6C) 5x - 4 = 2(4x + 8) - 3x can somebody do 4 and 5 for me iliketurtles2000 hi iananswer this question anyone pleaseFind: 113 23The quotient is 5 and . Which detail from the excerpt best shapes the central idea that Latino and Latina history covers a wide variety of experiences?A. Latino/as have established missions and businesses . . . .B. Others trace their ancestry to Spanish-speaking or indigenous peoples . . . .C. It is impossible to tell the experiences of these various groups with a single history.D. They include the experiences of people with cultural, religious, and linguistic traditions . . . .