Put these amounts of money in order smallest to largest
£1.32 £1.23 £1.03 £3.21 £3.12

Answers

Answer 1

Answer:

£1.03, £1.23, £1.32, £3.12, £3.21

Step-by-step explanation:


Related Questions

This is due in 30 mins pls help me

Answers

I believe the answer is yes. Hope that helps!

Answer:

Yes, it is still a line

Step-by-step explanation:

The slope of the line is not changed, just the y-intercept. It started as a line, therefore translating it up will have it still remain as a line

On Wednesday, 10% of the customers who bought gas at a gas station made additional purchases. There were 250 customers who bought gas. How many of these 250 customers made additional purchases?

Answers

Answer:

25 customers

Step-by-step explanation:

Step one:

given data

we are told that the total customers are 250 in number

and that 10% of customers made additional purchase.

Step two:

what we intend to find is the number that 10% represent in 250

this is shown as

=10/100*250

=0.1*250

=25

The number of customers that made an additional purchase is 25

Answer:

25

Step-by-step explanation:

can you please tell me if i got these right

Answers

Answer:

They are right! Great job!!

can you guys please help me with this and fast?
∛125?

Answers

Answer:

5

Step-by-step explanation:

125 breaks down into 5×5×5, which proves that it's 5.

Answer:

5 is the right answer

Step-by-step explanation:

An ice cream shop sells large cones for $2.50 and small cones for $1.50. Jack has enough money to buy 21 large cones. How many small cones could Jack buy?


plz healp

Answers

Answer:

the answer is 35 small cones

Step-by-step explanation:

2.50 x 21 = 52.50

52.50 / 1.50 = 35

The answer is 14 because 21 divided by 1.50 equals 14

can someone help me fill this out....​

Answers

Answer:

Step-by-step explanation:

First Line:

0, 1//7, 2/7, 3/7, 4/7, 5/7, 6/7, 1, 8/7, 9/7, 10/7

Second Line:

-1/3, 0, 1/3, 1/2, 1, 4/3

Third Line:

0, 1/3, 2/3, 1, 4/3, 5/3, 2

Alinehasaslopeof 1/3 anda y-intercept of –5What isitsequationin slope-intercept form? Write your answer using integers, proper fractions, and improper fractions in simplest form.

Answers

Answer:

[tex]y = \frac{1}{3}x - 5[/tex]

Step-by-step explanation:

Given

[tex]slope\ (m) = \frac{1}{3}[/tex]

[tex]y\ intercept = -5[/tex]

Required

Determine the line equation in slope intercept

The equation of a line in slope intercept is:

[tex]y = mx + b[/tex]

Where

[tex]m = slope = \frac{1}{3}[/tex]

[tex]b = y\ intercept = -5[/tex]

So, [tex]y = mx + b[/tex] becomes

[tex]y = \frac{1}{3}x - 5[/tex]

Simplify the expression:

–3(9 − x) =

Answers

Answer:

Expand  [tex]-3(9-x): -27 + 3x[/tex]

Step-by-step explanation:

[tex]-3(9-x)[/tex]

Apply the distributive law: [tex]a(b-c)=ab-ac[/tex]

[tex]a = -3, b=9, c=x[/tex]

[tex]=-3*9-(-3)x[/tex]

Apply minus - plus rules:

[tex]-(-a)=a[/tex]

[tex]= -3*9+3x[/tex]

Multiply the numbers: [tex]3 * 9 = 27[/tex]

[tex]=-27+3x[/tex]

Hope this helps! If so, may I get Brainliest and a Thanks?

Thank you, have a good one! =)

what is simplified expression for the expression below? 4(x+8)+5(x-3)

A) 9x+5
B) 9x+11
C)9x+17
D) 9x+47

Answers

4(x+8)+5(x-3)

4x+32+5x-15

9x+17

The answer is CCCCCCCC

Evaluate each value expression for the given value of x: 3x-13, x=6

LAST ONE HURRY,FAST!!!!!!!!!!!!!!!!!!!

Answers

Answer:

30

Step-by-step explanation:

The sum of 5 times a number and -6 is 2
How should I write that?

Answers

Answer:

5x-6=2

Step-by-step explanation:

It's math Question i need Your help---)​

Answers

Answer:

1no

125

2no

12.9

hope that this will help u

Adventureland plans on updating the Arcade with some new and improved games.
They plan on purchasing a new Air hockey table for $875.23, a pinball machine for
$622.19, and two arcade racing games for $942.49 each. What is the total cost for the
new games including an 8.75% sales tax? I will give brainiest

Answers

Answer: $3678.36

Step-by-step explanation:

New airball hockey table = $875.23

pinball machine = $622.19

2 arcade racing games = $942.49 each.= $942.49 × 2 = $1884.98

Total amount without sales tax will be:

= $875.23 + $622.19 + $1884.98

= $3382.4

Sales tax = 8.75% × $3382.4

= 0.0875 × $3382.4

= $295.96

Total cost = $3382.40 + $295.96

= $3678.36

The larger of two numbers is two more than five times the smaller number.if the sum of the two numbers is 80 find both number

Answers

Answer:

the smaller number is 13 and the larger number is 67

The larger nail is a dilation of the smaller nail.



Select all statements that are true.

Answers

Answer: the scale factor is 3/4

Step-by-step explanation:

Answer:

whats the rest of the answer?

Step-by-step explanation:

The area of a rectangle is less than 81 square centimeters. The length of the rectangle is 9 centimeters and the width is x centimeters. Select the possible value(s) of x.

Answers

Answer:

Given

The area of a rectangle is less than 81 square centimeters

length 9cm

width =x cm

Step-by-step explanation:

Area of rectangle=length ×width

= 9×X

Area of rectangle is less than 81 cm^2

So 9x-81=0

X=81/9

X=9

So the value of xis 9

Jack earned $6.00 per hour before being given a 3% raise. What was Jack’s new wage after the raise?

Answers

Answer:

$6.18 per hour

Step-by-step explanation:

3% of 6 is 0.18

You can get this number by multiplying 0.03 by 6

Add 0.18 to 6 and that gives Jack $6.18

is (3,2) a solution to 3x + 2y =13​

Answers

Answer: yes

Step-by-step explanation:

(3*3) + (2*2) = 9+4 = 13 which is what the other side of the equation states so it is a solution

Answer:

Yes

Step-by-step explanation:

Plug the 3 into the x and plug the 2 into the y from (3,2)

So you get, 3(3) + 2(2)=13

9+4=13

2. Which of the values of x below will result in lines m and n being parallel?
(1) 41
(3) 20
6x + 14
m
(2) 5
(4) 27
1340
n
REASONING
С.
3
In the diagram shown below, ABC and AABFABCD.

Answers

Answer:

x= 16/3 now change in mixed fractions

no 2

For the value of x =20 will result in lines m and n being parallel

What is Straight line?

a line is an infinitely long object with no width, depth, or curvature. Thus, lines are one-dimensional objects, though they may exist in two, three, or higher dimension spaces.

In the given figure, we need to find the value of x which makes the lines m and n are parallel.

parallel lines are coplanar straight lines that do not intersect at any point. Parallel planes are planes in the same three-dimensional space that never meet.

In the given figure we have two angles 6x+14 and 134.

We need to equate these to find the value of x.

6x+14=134

Subtract 14 from both sides

6x=134-14

6x=120

Divide both sides by 6

x=20

Hence for the value of x =20 will result in lines m and n being parallel

To learn more on Straight lines click:

https://brainly.com/question/29223887

#SPJ2

Kenji is decorating papers with a total of 15 heart stickers and 12 star stickers for the child he is babysitting. If he wants to make all the papers identical, with the same combination of heart and star stickers and no stickers left over, what is the greatest number of pages Kenji can decorate?

Answers

Answer: The greatest number of pages Kenji can decorate = 3

Step-by-step explanation:

Given: Total heart stickers = 15

Total star stickers =12

If all the papers identical, with the same combination of heart and star stickers and no stickers left over.

Then the greatest number of pages Kenji can decorate = GCD(15,12)  [GCD=greatest common divisor]

Since 15 = 3 x 5

12=2 x 2 x 3

GCD(15,12) =3

Hence, the greatest number of pages Kenji can decorate = 3

Where will the lines y= -2/5x + 1 and y= -2/5x - 2 intersect?

Answers

Answer:

Never

Step-by-step explanation:

Their slope is the same so they will go down the same distance every time, and since the first one touches the y-intercept at 1 and the other one touches the y-intercept at -2, it is completely impossible for them to ever intersect

Choose the graph below that represents the following system of inequalities:

y ≥ −3x + 1

y ≤ 1/2 x + 3

Answers

Answer:

the following system of inequalities:

y ≥ −3x + 1

y ≤ (1/2)x + 3

using a graph tool

see the attached figure

the answer is the option

B)Graph of two lines that intersect at one point. Both lines are solid. One line passes through points negative 2, 2 and 0, 3 and is shaded below the line. The other line passes through points 0, 1 and 1, negative 2 and is shaded above the line

Step-by-step explanation:

what is the average minimum wage of this problem. it was due yesterday but I cried because i suck at math and i never turned it in

Answers

Answer:

4.89

Step-by-step explanation:

You don't suck at math, just nobody has explained it good enough or gave you a calculator (working on your computation skills help if that's the problem). For an average, add up all the numbers and divide them by the amount of items you added up.

2 part question!
122.53 rounded to the nearest whole number.
18.59 rounded to the nearest whole number.

Answers

Answer:

1.) 123  2.) 19

Step-by-step explanation:

Both of these numbers would round up since 5+ makes the number before itself add 1.

ROUNDING

=================================================================

There are two rules for rounding:

1. If the number you're rounding is followed by a digit from 0 to 4 drop it

2. If it's followed by a digit from 5 to 9 add 1

Let's see them in action!

1: 122.53 ==> 122.5 ==>123

2: 18.59 ==> 18.6 ==> 19

Learn more;work harder

#Carryonlearning

==============================================================

how many yards are there in 5 miles?

Answers

Answer:

8800

Step-by-step explanation:

Answer:

8800 yards

Step-by-step explanation:

hope it helps

pleaseee helppp



unit test due in 30 minss!!!

Answers

Answer:

Fraction: 81/100

Decimal: 0.81

Percent: 81%

Step-by-step explanation:

A pack of four bags of coffee cost $39.96. How much would 16 bags of coffee cost.
SHOW YOUR WORK

Answers

Answer:

$159.84

What we know - 4 bags cost $39.96

What we need to know - How much 16 bags cost

Step-by-step explanation:

We can solve this by simply knowing how many times 4 goes into 16. We can do this by writing the equation 16 ÷ 4 = 4. We now know that 4 goes into 16 4 times. By doing this we can now multiply $39.96 by 4 to get the cost of 16 bags which is $159.84.

Hope this Helps!!! :) Please comment below with some feedback!

The triangle and the trapezoid share a 15-inch base and a height of 10 inches. A. The area of the trapezoid is less than twice the area of the triangle. Find the values of x. Explain your reasoning.

Answers

Answer:

Possible values of x are whole numbers that are lesser than 15 inches

Step-by-step explanation:

We are given;

Base; b = 15 inches

Height; h = 10 inches

Formula for area of triangle is;

A_tria = ½bh

A_tria = ½ × 15 × 10

A_tria = 75 Sq.in

Now, formula for trapezoid is;

A_trapez = ½(a + b)h

Where a is the side parallel to the base.

We are told that the area of the trapezoid is less than twice the area of the triangle.

Thus;

½(a + 15)10 < 2(75)

Simplifying;

5(a + 15) < 150

Divide both sides by 5 to get;

a + 15 < 150/5

a + 15 < 30

Subtract 15 from both sides to get;

a < 30 - 15

a < 15

Possible values of x are whole numbers that are lesser than 15 inches

Someone plz help me I’m on my last question for delta math. I added a screenshot below

Answers

Answer:

f(x) = -2x – 7 ; if x < -5

-(x + 2)² + 6 ; if -5 ≤ x < 0

√(x) – 1 ; if x ≥ 0

Leslie says that a temperature of -12 °C is colder than a temperature of -20 C because
1-12 <1-20). Is Leslie correct? Explain why or why not.

Answers

Answer:

Leslie is NOT correct

Step-by-step explanation:

Leslie thinks that the number closer to 0 that's in the negatives it smaller because the number is smaller. But actually, the number farther from 0 that's in the negatives is smaller. So, -12 °C is warmer than -20 °C

I hope this helps!

Other Questions
Complete the analogyREBEL : ORTHODOXY :: (A) nonconformist : convention(B) radical : revolution (C) soldier : combat (D) scientist : theory Which statement illustrates bias in scientific research?A zoologist publishes incomplete data on sloths which supports their original hypothesis and notes that more research is required.A botanist publishes data about plant growth that does not support their original hypothesis and is replicable.An ecologist publishes data funded by a construction company which supports their original hypothesis that an endangered animal's territory is not endangered.A microbiologist publishes data funded by the National Institutes of Health that does not support their original hypothesis. Help me please!!! I need a short letter, using basic or simple teems, words, vocabulary. I would like to be Cabinet member perspective. But Natives is also fine with me. Thanks. Please need help Choose the words that complete the following sentence.Direct quotes needaround them, or else it is considered(1 point)O quotation marks/summarizingO quotation marks/plagiarismO parentheses/summarizingO parentheses/plagiarism I love you. You are worth it. What does this quote mean? Thanks! Ayala is making salad dressing. She mixes oil andvinegar in a blender until a smooth consistency isformed. Explain whether this is a heterogeneous or ahomogeneous mixture and why. Help?Jessica must determine how many packages of cookies and cupcakes to buy for her family reunion. Jessica's mother has asked her to buy the same number of each type of item but no more than 100 of each. At the bakery, Jessica finds that cookies are sold in packages of 12 and cupcakes are sold in packages of 9.Use the drop-down menus to select the answers that make each statement true.The greatest number of packages that Jessica can buy is _ packages of cookies and _ packages of cupcakes. explain what happens when particles collide When a story is told from the _____, the narrator has full knowledge of all the characters. omniscient third-person point of view reliable first-person point of view unreliable first-person point of view limited third-person point of view The product of the ages of two adults is 572. Find their ages. Guys, I need help ASAP!! The standard deviation of the following data set is 0.31. 95% of the data would fall in which range?4.3, 5.1, 3.9, 4.5, 4.4, 4.9, 5.0, 4.7, 4.1, 4.6, 4.4, 4.3, 4.8, 4.4, 4.2, 4.5, 4.4Pr (3.88 X 5.12)Pr (2.67 X 5.33)Pr (4.19 X 4.81)Pr (3.57 X 5.43) ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut a student performed an experiment, using a cocktail peanut, before it was burned the peanut half weighed .353 g. After burning the residue weighed .016 g. The energy released by the conjunction increased the temperature of 200. mL of water in the calorimeter by 7.2 degrees Celsius. Calculate the mass of peanut consumed in the combustion. twice the sum of k and 9 is 4 The product of a number and -5 is at least 35. Write as an inequality. who killed the district judge during the revolutionary movementanswer in one sentence Quick question for you all People who complain that video games involve too much sitting are probably old. They probably dont know very much about gaming, either. They dont realize that people can play virtual sports, such as tennis, on video games. There are video games for dancing, too. If people bothered to learn about the different kinds of video games, they would see how wrong they are. This students sample paragraph addresses the counterclaim. Critique this paragraph by answering the questions.What is the counterclaim?Video games are too violent.Video games make people inactive.Video games are different today.What evidence weakens the counterclaim?People who complain are old.Sitting too much is bad for people.There are video games for sports and dancing.What is the tone of the rebuttal?respectfulrudehumorous Mention the type of seeds that undergo hypogeal germination.What do we call the process of permanently stopping babies from breast feeding?plzz help it is due today