Question: Does light have an effect on the rate of mitosis in a cell?
Hypothesis: If
then
Independent variable:
Dependent variable:

Answers

Answer 1

Answer:

Hypothesis: IF light is applied, THEN the rate of mitosis will increase

Independent variable: LIGHT

Dependent variable: RATE OF MITOSIS

Explanation:

Hypothesis is a testable explanation given to solve a problem or answer a question. It is usually in the IF, THEN format. A hypothesis of this experiment can read: IF light is applied, THEN the rate of mitosis will increase.

Independent variable is the variable that is changed or manipulated by the experimenter in an experiment. In this experiment, the independent variable is the LIGHT.

Dependent variable is the variable that is measured in the experiment. It is the variable that responds to changes made to the independent variable. In this experiment, the dependent variable is the RATE OF MITOSIS in a cell.


Related Questions

What term describes the strings of ribosomes that are attached to an RNA transcript at one time?
A. release factors
B. spliceosomes
C. transcription factors
D. mutagens
E. polyribosomes

Answers

Answer:

Polyribosomes.

Explanation:

During translation, the subunits of a ribosome surround the transcript and read down stream until they reach the start codon and begin polypeptide synthesis. Once the start codon is exposed, it is available for another ribosome to form around it, thereby initiating another locale for translation. Together the strings of ribosomes are called polyribosomes.

differences between reproduction in mammals and amphibians.​

Answers

Answer:

the answer is a little weird but hope this helps

Explanation:

While all of these animals reproduce sexually (meaning that the species consists of males and females and mating involves the fetilization of eggs by sperm), reptiles and mammals reproduce through internal fertilization (inside the female) whereas amphibians practice external fertilization.

Answer:

While all of these animals reproduce sexually (meaning that the species consists of males and females and mating involves the fetilization of eggs by sperm), reptiles and mammals reproduce through internal fertilization (inside the female) whereas amphibians practice external fertilization

Which statement below does NOT correctly describe water's chemical
properties?

a. Water is a neutral substance - it is neither a base or acid

b. Water is an inert substance

c. Water is not flammable or combustible

d. Water is reactive and catalyzes many reactions that take place inside living things

Answers

Answer:

b.

Explanation:

This is incorrect, because, "water is a powerful accelerator of chemical reactions."

Credit to www.astronno.com

Blood has a lower concentration of hydrogen ions than cellular cytoplasm. What does that tell us about the pH?

Answers

Answer:Acids and bases In the human body, both blood and the cytosol (watery goo) inside of cells have pH values close to neutral. ... A base, in contrast, raises pH by providing hydroxide (OH −start superscript, minus, end superscript) or another ion or molecule that scoops up hydrogen ions and removes them from solution.

Explanation:

Which statement correctly describes transpires during a chemical reaction?

Answers

Answer:

Melting but if it is radiactional is evaporating

When experiencing oxygen debt, why do human cells not carry out the process of alcoholic fermentation?

Answers

I believe the answer is because oxygen is a fuel/input/reactant to alcoholic fermentation.

Christopher Columbus used the presence of suspended seaweed in the ocean to
determine how far away he was from the coast of the Africa. Seaweed, or kelp, is
placed under the Protista kingătom. What type of protist did Columbus see?
a)protozoa
b) slime mold
c) water mold
d) brown algae

Answers

Your answer is d he saw brown algae

Brown algae is the type of protist Columbus saw. Therefore, option (D) is correct.

What are brown algae?

Seaweed is a type of brown algae, which is a type of protist that belongs to the kingdom Protista. Brown algae are large, multicellular algae that grow in the ocean and are often found in shallow, warm waters. They have a complex structure and are made up of many cells that are organized into tissues and organs. Brown algae are photosynthetic, meaning they use sunlight to produce energy and nutrients, and they are an important source of food and habitat for many marine organisms.

Other types of protists include protozoa, which are single-celled, heterotrophic organisms that can move using cilia, flagella, or pseudopodia; slime molds, which are fungi-like organisms that can move and are often found in moist environments; and water molds, which are fungi-like organisms that can grow in water and can cause disease in plants and animals.

Learn more about brown algae, here:

https://brainly.com/question/8717436

#SPJ2

EASY 7TH GRADE SCIENCE FIRST PERSON MARKED BRAINLIEST!!!!

Which information does a student need to differentiate between the speed and the velocity of a vehicle in motion

A. The rate of the motion
B. The direction of the motion
C. The change in the amount of motion
D. The amount of distance traveled during motion

Answers

Answer: The action from a force can cause an object to move or can speed up accelerate, to slow down (decelerate), to stop, or to change direction. Since any change in velocity is considered acceleration, it could be said that a force on an object results in the acceleration of a object.

Explanation:

Answer:

(B) The direction of the motion

Explanation:

Which cellular process breaks down simple sugars to release energy?
O A. mitosis
O B. photosynthesis
O C. respiration
O D. waste elimination

Answers

Answer:

C. respiration

Explanation:

What happens to red blood cells when placed in a hypotonic solution?

Answers

Hope this helps this is what I used when I studied this

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Answers

Answer:

u want step by step?

Explanation:

Open Response 2 part A: Plant cells and fungal cells have many of the
same types of organelles. Structures X and Y are found in both plant cells
and fungal cells. Structure Z is found in plant cells, but not in fungal cells. A
- What is party?
X
Z

Answers

The answer will be z because u can dance and take the L on black kids

How do structures in organisms compare with structures of non-living things such has construction cranes, buildings, ships, airplanes, or bridges?

Answers

They all are able to break down

_______ is where both organisms gain from the interaction. A. Commensalism B. Mutualism C. Predation​

Answers

Answer:

B. Mutualism

Explanation:

Mutual means both parties feel the same way, so they both gain from the interaction. I just looked at the root of the word

Answer:

b . mutualism

Explanation: MUTUALISM IS A FORM  OF SYMBIOSIS  WHEREBY BOTH ORGANISMS INVOLVED BENEFIT FROM THE RELATIONSHIP

if 28% of the bases in a DNA strand are guanine, what percentage are thymine

Answers

Answer:

22%

Explanation:

According to Erwin Chargaff in his complementary base pairing rule, a DNA molecule consists of four nucleotide bases that pair with one another in the follow order: Adenine (A) to Thymine (T), and Guanine (G) to Cytosine (C).

According to Chargaff, the amount of Adenine in the DNA equals the amount of Thymine while the amount of Guanine in the DNA equals the amount of Cytosine. The sum of all the bases equals 100%. That is;

A + T + G + C = 100%

In this question, if 28% of the bases in a DNA strand are Guanine, the amount of Cytosine will also be 28%. Hence,

28% + 28% + A + T = 100

56% + A + T = 100

A + T = 100% - 56%

A + T = 44%

Since, A = T

A/T = 44/2

A/T = 22%

Hence, the amount of Thymine in the DNA strand will be 22%

Spongy tissue is best described as dense smooth and homogenous
True or false

Answers

false, it’s compact

A 10.0 cm3 sample of copper has a mass of 89.6 g. What is the density of copper?

Answers

Answer:

[tex]\boxed {\boxed {\sf d=8.96 \ g/cm^3}}[/tex]

Explanation:

Density can be found by dividing the mass by the volume.

[tex]d=\frac{m}{v}[/tex]

The mass of the copper is 89.6 grams.

The volume is 10 cubic centimeters.

[tex]m=89.6 \ g\\v= 10 \ cm^3[/tex]

Substitute the values into the formula.

[tex]d=\frac{89.6 \ g }{10 \ cm^3}[/tex]

Divide.

[tex]d=8.96 \ g/cm^3[/tex]

The density of copper is 8.96 grams per cubic centimeter.

human rights violated when George Floyd was apprehended​

Answers

Answer:

tell me how to answer it

This is correct . True

Which example has the most kinetic energy a football resting on a kicking tee a hurt football player sitting on the bench a football flying through a goal post a penalty flag on the ground

Answers

Answer:

The football flying through the goal

Explanation:

Kinetic energy is basiaclly moving energy. Since only the football going through the goal is moving, that's the one with the most kinetic energy.  

What process forms water vapor to turn into clouds?​

Answers

Answer:

condensation

Explanation:

The water cycle

evaporation--> condensation--> precipitation-->repeat

HELP ASAP EMERGENCY NEED NOW BRAINLIEST 100 POINTS!
A diagram showing two plates colliding, with one plate moving below the other. What type of plate boundary is illustrated in the image? What is the movement of one plate below another called?

Answers

Answer:

Convergent

Subduction

Explanation:

Answer:

B. convergent

C. subduction

Explanation:

Graves’ Disease is an autoimmune disorder that causes an overproduction of the hormone produced in the thyroid. These hormones are responsible for cellular metabolism. What would this disorder probably result in?

Answers

Answer:

Explanation:

Graves' disease is an autoimmune disorder in which antibodies produced by your immune system stimulate your thyroid to produce too much T4. It's the most common cause of hyperthyroidism. Hyperfunctioning thyroid nodules (toxic adenoma, toxic multinodular goiter or Plummer's disease).

A line passes through the points( -3,-4) and (6,2)

Answers

What are you asking? Slope? If so. You would do change in y over change in x. So subtract 2 and -4 to get positive 6, then subtract 6 and -3 to get positive 9. Your slope is either 1/3 if it’s increasing, or negative 1/3 if it’s decreasing.

Answer:

y = ⅔x - 2

Explanation:

We can solve for a linear equation of a line that passes through these two points by the elimination method and then substitute.

We simply write these two points in the form y = mx + c, where m is the gradient and c is the y-intercept (offset). So:

-4 = -3m + c

2 = 6m + c

____________ -

We can first eliminate c to solve for m and then substitute m back into either equation to solve for c. (See attached image for solving steps)

Then, we get:

m = ⅔

c = -2

so y = ⅔x - 2

HELP!!! MAJOR GRADE!!!!!

Gregor Mendel conducted thousands of genetic experiments using pea plants. Mendel is called the Father of Genetics because it was these studies that lead to the principles of genetics. In one of his many experiments, he crossed purple-flowered pea plants with white-flowered pea plants. Much to his surprise, all of the offspring turned out to be peas with purple flowers in appearance.

Although Mendel used the term factors instead of genes, how did Mendel explain why all the pea plants had purple flowers and not a mixture of white and purple flowers?

A.The offspring received the factors (genes) from both parents, but the genotype for purple flowers dominated over white flower pea plants.

B.The offspring only received the factors (genes) from the parent with the genotype for purple flowers and nothing from the white flower parent.

C.The offspring received the factors (genes) from both parents, but the phenotype for purple flowers dominated over the factor for white flowers.

D. The offspring only received the factors (genes) from the parent with the phenotype for purple flowers and nothing from the white flower parent.

Answers

Answer:

A

Explanation:

The purple gene was dominant, so though the plants got "factors" from both parents, only the purple gene was expressed in their phenotype (purple petals).

A yellow-skinned CHNOPS meets the blue-skinned CHNOPS of their dreams. They get married and have a green-skinned CHNOPS baby. What type of inheritance (Complete dominance, Incomplete dominance, or Co-dominance) is illustrated by this example? Pick the best answer with the correct justification
A.Complete dominance, because it blends
B.Incomplete dominance, because you see two traits
C.Co-Dominance - because it blends D.Co-Dominance, because you see two traits
E.Incomplete dominance, because it blends
F.Complete dominance, because you see two traits​

Answers

Answer:

uwiwiwuwwieh

Explanation:

Answer

co-dominance

recessive

Explanation:

100 on edge trust me!!

Which of the following is the most important reason to maintain a high level of cardiovascular health?
A. A higher level of fitness makes it easier to develop larger muscles.
B. A higher level of fitness makes you more attractive to other people.
C. A higher level of fitness allows you to live a longer, healthier life.
D. A higher level of fitness improves your IQ.

Answers

Answer:

C

Explanation:

I think because the more healthier you are, the longer you'll live

Why is ATP production Constant?

Answers

Regulation
It is vital that the level of ATP in cells remains constant, especially when the demand for energy increases. ... Although high levels of reactive oxygen species lead to cell death and disease, low levels of these species are important for regulating normal cell processes.

Can someone help me with this question please?

Answers

Answer:

B

Explanation:

They use echolocation (sound waves) because they cannot see the bottom of the ocean.

Good luck!

Which best describes the process of insertion?

A.occurs when part of a chromosome breaks off and is placed into the middle of another chromosome

B.occurs when part of a chromosome breaks off and reattaches backward on the same chromosome

C.occurs when part of a chromosome breaks off and does not reattach

D.occurs when part of a chromosome breaks off and attaches to another chromosome

Answers

Answer:

A.occurs when part of a chromosome breaks off and is placed into the middle of another chromosome

Explanation:

Edge 2020

Answer:

A

Explanation:

EDGE2021 :-)

Have a nice day! ^-^

(2) Which of the following describes the movement of particles down/ with a concentration gradient and how ?
Question options:

a)

Osmosis

b)

active transport

c)

diffusion

d)

both osmosis and diffusion

Answers

Answer:

Both osmosis. And diffusion

Other Questions
Which of the following is an example of cultural heritage?A. the language one speaksB. one's intellectual abilityC. the amount of land one ownsD. one's desire to succeed Could anyone write two sentences containing compound phrases with pronouns. (Use a nominative case pronoun in one sentence and an objective case pronoun in the other) could anyone help please?! The measure of angle Q is 75 degrees. Find the measure of angle P. The sideways curvature of the back, know as ______, is usually curved in an "S" or "C" shape only increases over time A) torque B) lumbarC) scoliosis D) posture Im timed help quickly pleaseWhat was the primary way that Arabic texts were made available to audiences who did not read Arabic? Muslim merchants passed Arabic texts along trade routes.Schools were opened for scholars to translate the documents.Scholars translated works from Arabic to Latin so non-Arabs could understand them.Muslim scholars built libraries in Europe so that Europeans could read the texts. can u pls help me with this question HELP1.75^-0.5(3/2)^2.4 Rebekah has $400 to spend on a video game system and games. The system cost $289.99 and each game costs $32.29. How many games can she buy with the game system?A. No more than 2 gamesB. No more than 3 gamesC. No more than 4 gamesD. No more than 5 gamesPLEASE HELP FAST!!!!!!! Chicken costs $3.20 per pound, and beef costs $4.59 per pound. Answer each question and show your reasoning. When purchasing 3 pounds, which meat is more expensive? By how much more expensive is it? How did Anti-federalist influence the U.S system of government? A rectangle has an area of 12 square centimeters and a perimeter of 16 centimeters. which of the following couldd be its dimensions?a. 2 cm and 6 cm b. 3 cm and 8 cmc. 1.5 cm and 8 cmd. 1 cm and 12 cm Taden has made a chart of effective reading and writing skills, Which terms best complete the chart?Reading skillsComprehensioninterpreting cluesFollowing the sequenceWriting skillsGrammar and spellingLegibilityAccuracyReading skills: Organization, Writing skills: Evaluating qualityReading skills: Plagiarism, Writing skills: Entertainment valueReading skills: Entertainment value, Writing skills: PlagiarismReading skills: Evaluating quality, Writing skills: Organization If a plant with chlorosis is unable to perform photosynthesis, what products (includeBOTH) are not being made? What is the slope of the line? PLEASE HELP ME I'LL GIVE BEAINLIST!! Which was an obstacle in building the National (Cumberland) Road? American Indians attacked the crews building the road.Roads had to be built by hand with picks and shovels.The Spanish blockaded the Mississippi River.Workers had to build a bridge over the Grand Canyon. What can we conclude about similarities and differences in short-term and long-term memory based on the way coding occurs in both? What is the slope of the line that intersects this two points (12,2), (-7,5) Who was responsible for the Battle of Little Bighorn? A watering can dispenses water at the rate of 0.20 gallon per minute. The original volume of water in the can was 8 gallons. Which set of ordered pairs shows the volume of water in the can in gallons (y), as a function of time in minutes (x), from the first minute after can starts dispensing water? (1 point){(7.8, 1), (7.6, 2), (7.4, 3)}{(1, 7.8), (2, 7.6), (3, 7.4)}{(8.0, 1), (7.8, 2), (7.6, 3)}{(1, 8.0), (2, 7.8), (3, 7.6)} A ___________ is a long chain of amino acids, while a __________ is a long chain of sugars.