Solve seven and five ninths minus three and nine elevenths.

( Im giving extra POINTS and BRAINLIEST on this one!! 0v0 )

A) three and seventy three ninety ninths

B) three and fifty five ninety ninths

C) four and fifty five twentieths

D) four and seventy three twentieths


(Here is an image if needed) :

Solve Seven And Five Ninths Minus Three And Nine Elevenths.( Im Giving Extra POINTS And BRAINLIEST On

Answers

Answer 1

It is 3 73/99

I just used a fraction calculator lol

Answer 2

Answer:

It is 3 73/99


Related Questions

Find the least common multiple of 7,9 and 21

Answers

Free LCM Calculator determines the least common multiple (LCM) between 9 and 21 the smallest integer that is 63 that is divisible by both numbers. Least Common Multiple (LCM) of 9 and 21 is 63.
...
Prime Factorization of 21.
3 21
7 7
1

(3x-15)(2x+7) what is x

Answers

Answer:

The chosen topic is not meant for use with this type of problem. Try the examples below.

2 = |3x|

−4/5x + 1/25 = 0

3x = 4 − x

Answer

Step-by-step explanation:

This has to be equal to something in order to solve it. I'm going to guess that it is equal to 0

(3x-15)(2x+7) = 0

That means that

3x - 15 = 0

3x = 15

x = 15/3

x = 5

or

2x + 7 = 0

2x = - 7

x = -7/2

x = - 3.5

The only other thing I can think of that this could equal is multiplying the two binomials together.

3x * 2x = 6x^2

3x*7 = 21x

-15*2x = - 30x

-15 * 7 = - 105

6x^2 - 7x - 105

But that does not solve for x.

Name the two congruent angles. Be sure to use three letters to name each angle.

Answers

Answer:

b and c

Step-by-step explanation:

looking at the markings

Answer:

The person above is correct. It is b and c.

Step-by-step explanation:

This is because both sides are equal. And while this isn't the best explanation,  my reasoning is because if you were to cut it in two and flip one side over the other side they would be equal. Also since all sides are not equal all are not the same angle. Apologies if this doesn't make sense, I am not good and explaining stuff. Best of luck on the assignment.

The problems in this lesson review basic arithmetic skills.

Answers

Answer:

false

Step-by-step explanation:

please some help me with this.​

Answers

X=14

every triangle equals 180 when adding all the angles together 72+36 = 108 So 180-108 = 72 (also note this is an isosceles triangle)

Now 72-16 = 56
56÷4 = 14

a snail crawls 3/4 inches in 1/5 of a minute how long will it take the snail to crawl 1/2 in?

Answers

Answer:

15/4

Step-by-step explanation:

Whenever you are working with a question of rate where two different quantities are being compared, the required units will indicate which quantity is to be divided by which.

3/4 divided by 1/5

3/4 times 5/1 (multiply reciprocal)

=15/4

I havent done this in a while so im not entirely sure.

A nursery owner buys 9 panes of glass to fix some damage to her greenhouse. The 9 panes cost
$25.65. Unfortunately, she breaks 2 more panes while repairing the damage. What is the cost of
another 2 panes of glass?
Another 2 panes of glass cost $____

Answers

Step-by-step explanation:

so first you would ave to find the  unit rate,so 25.65/9=$2.85 then you would multiply 2.85*2 for the other 2 that she broke. You would get $5.70 add that to the 25.65 you  would get $31.35. the two panes of glass=$5.70 and altoger with the two pans of glass you would get $31.35

Consider the function shown on the graph. Complete the statements to make them true

Answers

Answer:

Domain: x ≥ -5

Range: y ≥ -2

Step-by-step explanation:

The domain are the set of x-values of the function that are plotted on the x-axis. The domain of the graph given are x-values that are equal to or greater than -5.

Therefore:

✅Domain: x ≥ -5

The range from the graph given the y-values plotted on the y-axis against their corresponding x-values that are equal to or greater than -2.

Therefore:

✅Range: y ≥ -2

Liam solved the equation 72=8⋅b. His work is shown. What error did Liam make?

Answers

Hdjalvekfbdkalalalala lalalallala lalalal

50pesos de 100 cuánto es el porciento​

Answers

It is 50% because it is half of the total

Answer:

50%

Step-by-step explanation:

El 100% es 100  

Y X es 50  

Entonces si 50 es la mitad de 100

Seria 50%

please help me ig :/

Answers

Answer:

either A&C of B&C

Step-by-step explanation:

why i think that is because perpendicular lines are defined as two lines that meet or intersect each other at right angles (90°). and both A&C of B&C are (90°).

⚠️⚠️⚠️⚠️NEED HELP MARKING PEOPLE AS BRAINLIST!

Answers

Answer:

I think its C

Step-by-step explanation:

Thats my guesa

Please help me thanks.

Answers

y=(-2x)+5

Step-by-step explanation:

can someone teach me how to isolate variables in algebra

Answers

Here are the steps to isolate variables in algebra

anyone know thisssss​

Answers

See the attachment.....

Factor the algebraic expression 18a + 14 18a + 14 = (Factor completely.)

Answers

Answer:

You cannot factor that any more.

Step-by-step explanation:

The equation is as simple as it can be.

URGENT WILL GIVE BRAINLIEST——-Which of the following functions is quadratic?

Answers

Answer:

D

Step-by-step explanation:

6. Which equation or inequality represents the following description? & Multiply the quantity 2 more than a number by 8. The result is at least 12 times the number subtracted from 76.
A. 8(2n) < 76 - 12
B. 8n + 2 = 12n - 76
C. 8(n + 2) > 76 - 12n
D. 8(2n) = 76 – 12n​

Answers

Answer:C it’s bc it says at least 12 time the number subtracted from 76

Step-by-step explanation:

If it’s wrong sry if your gonna be mean to me just work it by your self don’t use brainly

PLEASE HURRY What is the slope of the line?

Group of answer choices

y = -3/4x - 1

y = 4/3x - 1

y = -3/4x + 1

y = -4/3x + 1

Answers

It’s y=-3/4x-1 because it is

By which rule are these triangles congruent?

Answers

Answer:

sss

Step-by-step explanation:

Question 1
2 (4x - 1) + 6
Equivalent to what

Answers

Answer:

2 (4x - 1) + 6 = 8x + 4 = 4(2x+1)

Step-by-step explanation:

2 (4x - 1) + 6

= (2*4x + 2*-1) + 6

= 8x - 2 + 6

= 8x + 4

= 4/(2x+1)

Answer:

4(2x+1)

Step-by-step explanation:

First, factor it out:

2(4x-1+3)

Then calculate:

2(4x+2)

Factor out 2:

2 • 2(2x+1)

Then finally multiply:

4(2x+1)

A store pays $49.14 for an easel. The Store markes up the price by %50. What is the amount the make-up

Answers

Answer:

$56.51

Step-by-step explanation:

Given parameters:

Cost price by the store = $49.14

Amount of mark up = 50%

Unknown:

Make- up price  = ?

Solution:

Since the price was increased by 50% more, to find the mark up price, we can find 50% of the cost price and add the value to the cost price.

Also;

 Make-up price  =( 1 + [tex]\frac{50}{100}[/tex] ) x $49.14

                           = 1.15 x $49.14

                            = $56.51

we cannot survive without water give reason why​

Answers

Answer:

Because we don't have life without water it is precious

Find the slope of the line graphed below.

Answers

Answer:

(rise/run) 5/4

decimal ver: 1.25

Answer:

[tex]\frac{5}{4}[/tex]

Step-by-step explanation:

The line passes trough the points (2, 2) and (-2, -3).

[tex]m=\frac{rise}{run}=\frac{-3-2}{-2-2}=\frac{-5}{-4} =\boxed{\frac{5}{4}}[/tex]

Hope this helps.

The difference between five halves of a number and 17 is 48

Answers

Answer:

let the number be X

it's five Half's = 5/2×x

by the condition

5/2x-17 =48

X = 48×-85/2

X = 24 × -85

If the difference between five halves of a number and 17 is 48 then the number is 26.

What is a numerical expression?

A numerical expression is a mathematical statement written in the form of numbers and unknown variables. We can form numerical expressions from statements.

Given, The difference between five halves of a number and 17 is 48.

Assuming the number to be 'n'.

(5/2)x - 17 = 48.

5x - 34 = 96.

5x = 130.

x = 26.

learn more about numerical expressions here :

https://brainly.com/question/29199574

#SPJ5

There are 40 students in a class.
Each student walks to school or cycles to school or gets the bus to school
There are 22 girls in the class.
9 of the girls walk to school.
7 of the boys cycle to school.
6 of the 10 students who get the bus to school are boys.
Find the number of these students who walk to school.

Answers

Step-by-step explanation:

Total no. of students = 40

Total no. of girls = 22

Total no. of boys = 40 - 22 = 18

No. of girls walking to school = 9

No. of girls who cycle to school = 22 - 9

No. of boys who cycle to school = 7

No. of students who take the bus = 10

(6 boys and 4 girls)

No. of boys who walk to school = 18 - (7 + 6) = 5

Total no. of students who walk to school = 9 + 5 = 14

The number of students who walked to school was 14 students

What is an Equation?

Equations are mathematical statements with two algebraic expressions flanking the equals (=) sign on either side.

It demonstrates the equality of the relationship between the expressions printed on the left and right sides.

Coefficients, variables, operators, constants, terms, expressions, and the equal to sign are some of the components of an equation. The "=" sign and terms on both sides must always be present when writing an equation.

Given data ,

The equations will be ,

Let the total number of students in the class be A = 40 students

The number of girls in the class = 22 students

The number of boys in class = total number of students - number of girls

                                                = 40 - 22

                                                = 18 students

Now ,

The number of girls who walked to school = 9 students

The number of boys who cycled to school = 7

So , remaining boys = 18 - 7

                                 = 11 students

The number of boys who take bus to school = 6 students

So , remaining boys = 11 - 6

                                 = 5 students

Therefore , the remaining boys in the class walks to school = 5 students

So , the equation will be

And , the total number of students who walked to school =
number of boys in the class that walks to school + number of girls who walked to school

Total number of students who walked to school = 9 + 5

                                                                                = 14 students

Hence , The number of students who walked to school was 14 students

To learn more about equations click :

https://brainly.com/question/10413253

#SPJ2

simplify the like terms

-2x\:+\:3y\:-\:3xy\:+2yz\:-\:3x^2y\:+5x\:-\:4y+3xy

Answers

Answer:

[tex]-2x+3y-3xy+2yz-3x^2y+5x-4y+3xy = 3x-y+2yz-3x^2y[/tex]

Step-by-step explanation:

Given

[tex]-2x+3y-3xy+2yz-3x^2y+5x-4y+3xy[/tex]

Required

Simplify

[tex]-2x+3y-3xy+2yz-3x^2y+5x-4y+3xy[/tex]

We start by collecting like terms

[tex]-2x+5x-4y+3y+3xy-3xy+2yz-3x^2y[/tex]

Then simplify like terms:

[tex]3x-y+0+2yz-3x^2y[/tex]

[tex]3x-y+2yz-3x^2y[/tex]

Conclusively, when [tex]-2x+3y-3xy+2yz-3x^2y+5x-4y+3xy[/tex] is simplified, the result is [tex]3x-y+2yz-3x^2y[/tex]

Hence:

[tex]-2x+3y-3xy+2yz-3x^2y+5x-4y+3xy = 3x-y+2yz-3x^2y[/tex]

Assume that SAT scores are normally distributed with mean 1518 and standard deviation 325. Round your answers to 4 decimal placesa. If 100 SAT scores are randomly selected, find the probability that they have a mean less than 1500.b. If 64 SAT scores are randomly selected, find the probability that they have a mean greater than 1600c. If 25 SAT scores are randomly selected, find the probability that they have a mean between 1550 and 1575d. If 16 SAT scores are randomly selected, find the probability that they have a mean between 1440 and 1480.e. In part c and part d, why can the central limit theorem be used even though the sample size does not exceed 30?

Answers

Answer:

a. 0.2898

b. 0.0218

c. 0.1210

d. 0.1515

e. This is because the population is normally distributed.

Step-by-step explanation:

Assume that SAT scores are normally distributed with mean 1518 and standard deviation 325. Round your answers to 4 decimal places

We are using the z score formula when random samples

This is given as:

z = (x-μ)/σ/√n

where x is the raw score

μ is the population mean

σ is the population standard deviation.

n is the random number of samples

a.If 100 SAT scores are randomly selected, find the probability that they have a mean less than 1500.

For x = 1500, n = 100

z = 1500 - 1518/325/√100

z = -18/325/10

z = -18/32.5

z = -0.55385

Probability value from Z-Table:

P(x<1500) = 0.28984

Approximately = 0.2898

b. If 64 SAT scores are randomly selected, find the probability that they have a mean greater than 1600

For x = 1600, n = 64

= z = 1600 - 1518/325/√64.

z= 1600 - 1518 /325/8

z = 2.01846

Probability value from Z-Table:

P(x<1600) = 0.97823

P(x>1600) = 1 - P(x<1600) = 0.021772

Approximately = 0.0218

c. If 25 SAT scores are randomly selected, find the probability that they have a mean between 1550 and 1575

For x = 1550, n = 25

z = 1550 - 1518/325/√25

z = 1550 - 1518/325/5

z = 1550 - 1518/65

= 0.49231

Probability value from Z-Table:

P(x = 1550) = 0.68875

For x = 1575 , n = 25

z = 1575 - 1518/325/√25

z = 1575 - 1518/325/5

z = 1575 - 1518/65

z = 0.87692

Probability value from Z-Table:

P(x=1575) = 0.80974

The probability that they have a mean between 1550 and 1575

P(x = 1575) - P(x = 1550)

= 0.80974 - 0.68875

= 0.12099

Approximately = 0.1210

d. If 16 SAT scores are randomly selected, find the probability that they have a mean between 1440 and 1480

For x = 1440, n = 16

z = 1440 - 1518/325/√16

= -0.96

Probability value from Z-Table:

P(x = 1440) = 0.16853

For x = 1480, n = 16

z = 1480 - 1518/325/√16

=-0.46769

Probability value from Z-Table:

P(x = 1480) = 0.32

The probability that they have a mean between 1440 and 1480

P(x = 1480) - P(x = 1440)

= 0.32 - 0.16853

= 0.15147

Approximately = 0.1515

e. In part c and part d, why can the central limit theorem be used even though the sample size does not exceed 30?

The central theorem can be used even though the sample size does not exceed 30 because the population is normally distributed.

Arianna is deciding between two different movie streaming sites to subscribe to. Plan A costs $32 per month plus $1 per movie watched. Plan B costs $7 per month plus $2 per movie watched. Let AA represent the monthly cost of Plan A if Arianna watches xx per month, and let BB represent the monthly cost of Plan B if Arianna watches xx movies per month. Write an equation for each situation, in terms of x,x, and determine the number of monthly movies watched, x,x, that would make the two plans have an equal monthly cost.

Answers

Answer:

25 movies

Step-by-step explanation:

First, create the monthly costs for both plans:

Plan A:

A = x + 32

Plan B:

B = 2x + 7

Set these two expressions equal to each other, and solve for x:

x + 32 = 2x + 7

32 = x + 7

25 = x

So, the two plans will have an equal monthly cost after 25 movies.

Answer:

25 movies watched

Step-by-step explanation:

Where x is movies watched

AA = 1x + 32

BB = 2x + 7

Which step is the most efficient way to find the solution of p + 5 > -13

Answers

Answer:

subtracting 5 from both sides

Step-by-step explanation:

please mark brainliest lol :)

Answer:

p>-18

Step-by-step explanation:

The most efficient way to find the solution of p+5>-13 is to subtract 5 from both sides, getting p>-18

Other Questions
simply parmanent tissue real life application please help it's for my project Question 8 (1 point)Choose the correct form of the verb in the preterite. 1. Yo _________ (organizar) bien las cosas en la maleta. aorganiz borganizaste corganiz dorganic Please select the word from the list that best fits the definitionDoctors appointment today at 3:20pma.term calendarsb. weekly schedulec. daily organizer hellpppppp please I will give brainliest DUE 10:00 PM HELP ASAP. When Sarah left your house this morning her cell phone was 80% charged and then it started to lose 8% charge for each hour there after write an equation for B in terms of tea representing the charge remaining in series battery as percentage t hours after Sara left her house A news report says that 9% of middle school students are on the track team. There are 600 students in your middle school How many students in your school would you expect to be on the track team? HE Pad SATTE BAR HG West nus SAUNA w 1 PLEASE HELP! THIS A TIMED QUIZ!!Scientists found an artifact that has 25% of Carbon-14 left. Based on how much Carbon-14 is remaining, how old is the artifact that was found?A). 17,100 yearsB). 5,700 yearsC). 22,800 yearsD). 11,400 years Please help asap! Ill give brainliest!What theme does the excerpt convey?It is right to be wary of the unknown.Pride interferes with progress.Manners must be displayed in all situations.Strange animals cannot be trusted. What is your response? Why do u think sunny asks so many questions? anyone out there an expert on dreams?? Estimate 511 x 637 by first rounding each number so that it only has 1 nonzero digit. what would you do when you grow up?*Career* And explain why! During a formal group discussion, participants should be prepared toO lead the conversation and prompt others to speak. O persuade others to agree with their viewpoint. O interrupt other speakers when necessary. O take turns both listening and speaking. This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive How do you do this question?