The discoveries of ___ gave Holland a claim for colonization.
John Calvin
Henry Hudson
Marco Polo
Leif Ericson
Vicente Pinzon

Answers

Answer 1

The findings made by Henry Hudson opened the door for further colonization in Holland. Option B i.e "Henry Hudson"

This is further explained below.

Who is Henry Hudson?

Henry Hudson was, in general, an English explorer who was responsible for discovering North America.

His first work was with English merchants, and at that period he journeyed through North America in quest of a route that would bring him to Asia via the Northwest Passage.

In conclusion, during the latter part of his life, Hudson worked for the Dutch West India Company.

In the end, he made it to North America, where he is credited with discovering Manhattan Island and making his way up the Hudson River all the way to Hudson Bay.

He also is credited with being the first European to arrive in North America.

These geographical features, as one would reasonably expect, have been given their name in recognition of the area in which they are found.

His travels cleared the way for Dutch colonization in what is now known as North America. His discoveries led to the discovery of the Americas.

Read more about Henry Hudson

https://brainly.com/question/7670

#SPJ1


Related Questions

What have been the benefits of NAFTA? Who has benefited?

Help!

Answers

Answer: NAFTA promoted trade in all the countries that joined it.

Explanation: Countries got a lot of revenue from this, and they boosted their economy.

What was the purpose of the Fort Laramie Treaty with the Sioux?

A. to prevent further battles with the Sioux
B. to collect taxes from the Sioux
C. to build a road in Sioux land to gold-mining areas
D. to obtain complete government control over the Sioux

Answers

Answer:

In the spring of 1868 a conference was held at Fort Laramie, in present day Wyoming, that resulted in a treaty with the Sioux. This treaty was to bring peace between the whites and the Sioux who agreed to settle within the Black Hills reservation in the Dakota Territory.

Explanation:

So (A) is your answer

Russia or German pick and vote

Answers

Answer:

RUSSIA

Explanation:

HELP!!!!!!!!!
Part I: Short Answer Questions (20 points)

1. How were the classical Mesoamerican civilizations of Olmec and Maya similar? Include at least two examples of similarities and two examples of differences between these civilizations. Be sure to support your argument with evidence from the course. (4 points)

Answers

Answer:

The Olmec and the Maya both settled in the lands of Mexico. The Maya were one of the first Mesoamerican civilization, starting around 2600 B.C. The Olmec established themselves around 1400B.C. They were very good at farming, art, and mathematics.

Using complete sentences, explain how the progressive movement influenced labor laws and rights. Make sure to include provisions set by the progressive movement for workers.

Answers

Answer:

Responses may vary but should include some or all of the following information:  Prior to the labor rights set by the progressive movement, there were many issues with child labor, unsafe working conditions, and long hours. The provisions that were set up alleviated many of these issues. The work day was shortened to eight hours in mines and other public work projects. Children under the age of 15 were not allowed to work in hazardous areas. No girls were allowed to work in underground mines and neither were boys under the age of 16. Also, the chief mine inspector had to have at least eight years of experience working in mines. Finally, convict labor was prohibited throughout the state, and the Department of Labor was established.

Explanation:

hope tht could help!

Describe the cliff dwellings of the Ancient Puebloans, and explain the advantages those dwellings may have offered?

Answers

They were in walls on steep cliffs. Easy to defend and protection from winter weather.

Do the states that have the highest and lowest amount of slaves have anything in common ?

The highest states is New Jersey , New York , Virginia

The lowest states are Maryland , Massachusetts , Maine

Answers

Answer:

In the United States before 1865, a slave state was a state in which the slave trade was legal, while a free state was one in which it was not. There were some enslaved persons in most free states in the 1840 census, and the Fugitive Slave Act of 1850 specifically stated that an enslaved person remained enslaved even when she or he fled to a free state. Between 1812 and 1850, it was considered important that the number of free and slave states were kept in balance, so new states were admitted in pairs.

Answer correctly for brainliest
NEED ASAP

Answers

June Solstice (Approximately June 20-21)

The June solstice begins summer in the Northern Hemisphere and winter in the Southern Hemisphere. This day is the longest of the year in the Northern Hemisphere and the shortest of the year in the Southern Hemisphere.

North Pole: The North Pole (90 degrees north latitude) receives 24 hours of daylight, as it has been daylight at the North Pole for the last three months (since the March Equinox). The sun is 66.5 degrees off the zenith or 23.5 degrees above the horizon.

Arctic Circle: It is light 24 hours a day north of the Arctic Circle (66.5 degrees north) on the June solstice. The sun at noon is 43 degrees off the zenith.

Tropic of Cancer: On the June Solstice the sun is directly overhead the Tropic of Cancer (23.5 degrees north latitude) at noon.

Equator: At the equator (zero degrees latitude), the day is always 12 hours long. At the equator, the sun rises daily at 6 a.m. local time and sets at 6 p.m. local time. The sun at noon at the equator is 23.5 degrees off the zenith.

Tropic of Capricorn: In the Tropic of Capricorn, the sun is low in the sky, at 47 degrees from the zenith (23.5 plus 23.5).

Antarctic Circle: At the Antarctic Circle (66.5 degrees south), the sun makes the briefest of appearances at noon, peeking at the horizon and then instantaneously disappearing. All areas south of the Antarctic Circle are dark on the June Solstice.

South Pole: By June 21, it has been dark for three months at the South Pole (90 degrees south latitude).

September Equinox (Approximately September 22-23)

The September equinox marks the beginning of fall in the Northern Hemisphere and spring in the Southern Hemisphere. There are 12 hours of daylight and 12 hours of darkness at all points on the earth’s surface on the two equinoxes. Sunrise is at 6 a.m. and sunset is at 6 p.m. local (solar) time for most points on the earth’s surface.

North Pole: The sun is on the horizon at the North Pole on the September equinox in the morning. The sun sets at the North Pole at noon on the September equinox and the North Pole remains dark until the March equinox.

Arctic Circle: Experiences 12 hours of daylight and 12 hours of darkness. The sun is 66.5 degrees off the zenith or 23.5 degrees above the horizon.

Tropic of Cancer: Experiences 12 hours of daylight and 12 hours of darkness. The sun is 23.5 degrees off the zenith.

Equator: The sun is directly overhead the equator at noon on the equinox. On both equinoxes, the sun is directly over the equator at noon.

Tropic of Capricorn: Experiences 12 hours of daylight and 12 hours of darkness. The sun is 23.5 degrees off the zenith.

Antarctic Circle: Experiences 12 hours of daylight and 12 hours of darkness.

South Pole: The sun rises at the South Pole after the Pole has been dark for the past six months (since the March equinox). The sun rises to the horizon and it remains light at the South Pole for six months. Each day, the sun appears to rotate around the South Pole at the same declination angle in the sky.

December Solstice (Approximately December 21-22)

The December solstice marks the beginning of summer in the Southern Hemisphere and is the longest day of the year in the Southern Hemisphere. It marks the beginning of winter in the Northern Hemisphere and is the shortest day of the year in the Northern Hemisphere.

North Pole: At the North Pole, it has been dark for three months (since the September equinox). It remains dark for another three (until the March equinox).

Arctic Circle: The sun makes the briefest of appearances at noon, peeking at the horizon and then instantaneously disappearing. All areas north of the Arctic Circle are dark on the December solstice.

Tropic of Cancer: The sun is low in the sky, at 47 degrees from the zenith (23.5 plus 23.5) at noon.

Equator: The sun is 23.5 degrees from the zenith at noon.

Tropic of Capricorn: The sun is directly overhead the Tropic of Capricorn on the December solstice.

Antarctic Circle: It is light 24 hours a day south of the Antarctic Circle (66.5 degrees north) on the June solstice. The sun at noon is 47 off the zenith.

Arctic Circle: Experiences 12 hours of daylight and 12 hours of darkness. The sun is 66.5 off the zenith and low in the sky at 23.5 degrees above the horizon.

Tropic of Cancer: Experiences 12 hours of daylight and 12 hours of darkness. The sun is 23.5 degrees off the zenith.

Tropic of Capricorn: Experiences 12 hours of daylight and 12 hours of darkness. The sun is 23.5 degrees off the zenith.

Antarctic Circle: Experiences 12 hours of daylight and 12 hours of darkness.

South Pole: The sun sets at the South Pole at noon after the Pole has been light for the past six months (since the September equinox). The day begins on the horizon in the morning and by the end of the day, the sun has set.

How did Muhammad seek guidance?

Answers

Answer:

Muslims also seek guidance from the Hadith , which are writings about the life of the Prophet Muhammad. ... They teach Muslims how to live their lives, and to understand and follow the teachings of the Qur'an.

Explanation:

Answer:

Very vague question probably won't get an answer

Explanation:

What did the Egyptians learn
from the Hyksos? How might
this have helped the Egyptians
after they had driven the
Hyksos from their land?

Answers

Answer:

The Hyksos (/ˈhɪksɒs/; Egyptian ḥqꜣ(w)-ḫꜣswt, Egyptological pronunciation: hekau khasut, "ruler(s) of foreign lands"; Ancient Greek: Ὑκσώς, Ὑξώς) were people of probable Levantine origin, who established the Fifteenth Dynasty of Egypt based at the city of Avaris in the Nile delta, from where they ruled the northern part of the country. While the Hellenistic Egyptian historian Manetho portrayed the Hyksos as invaders and oppressors, modern Egyptology no longer believes that the Hyksos conquered Egypt in an invasion. Instead, Hyksos rule had been preceded by groups of Canaanite peoples settled in the eastern delta who probably seceded from central Egyptian control near the end of the Thirteenth Dynasty.

Explanation:

1) What are the three branches of the US Government?​

Answers

Answer:Legislative—Makes laws (Congress, comprised of the House of Representatives and Senate)

Executive—Carries out laws (president, vice president, Cabinet, most federal agencies)

Judicial—Evaluates laws (Supreme Court and other courts)

I got you Brainliest please

Answer:

Executive, Legislature, and Judicial

Explanation:

Which country surrounds Lesotho?
A. Swaziland
B. South Africa
C. Botswana
D. Namibia

Answers

Answer:

B. south Africa

Explanation:

Answer:

B South Africa

Explanation:

Lesotho is completely surrounded by South Africa, making it one of only three countries in the world that are enclaved within another country; the other two are San Marino and Vatican City, both located within Italy. The total length of the South African border is 909 kilometres (565 mi).

Explain one similarity and one difference between the Indus River Valley and Ancient China?

Answers

Answer:

ndus Valley Civilization

State-Building

Not much is known about the Indus Valley city governments.

There is evidence of a central government through city planning and similar layouts of all of the cities in this civilization.

Rajahs and Indus Priests were in charge of the government.

Geography

This civilization was twice the size of Texas.

Harrappa and Mohenjodaro were the main cities.

These cities are in present day Pakistan.

More Geography

Arid climate

Temperature Ranges from 32-100 degrees Fahrenheit

Rainfall ranges from 5" to 20"

People depend on Indus River and Asian Monsoons.

Technology and Interactions

Standardized weights, measures, architectural styles and sizes of bricks

The land was very fertile but this was a big risk for disease.

Culture

There were no palaces, temples, elaborate graves, kings or a warrior class.

Ceremonial bathing, ritual burning and yoga positions were part of the Indus Valley Culture.

The language of the Indus Valley Civilization has not been deciphered yet.

Religion was a big part of how the cities were operated. Religion was involved in government because the priests were involved in government.

Agriculture

The economic foundation of the Indus Valley Civilization was their irrigated agriculture.

These people domesticated animals such as pigs, horses and camels.

They harvested crops like cotton, sesame, peas, barley, wheat and rice.

Trade was extensive within the merchant class. Cities traded with each other and with other regions.

There was a big dock in which sea-going ships could trade with other areas like Persia, Southern India and Afghanistan.

Ancient China

State-Building

Chinese rulers, called emperors, based their government on the Confucian model, this was led by example.

Legalists stressed strength, not goodness, as a ruler's greatest virtue.

Daoists rejected the everyday world, and believed that government was better when it was governed the least.

The Great Wall of China was built by Shi Huangdi, The Great Wall is a political structure.

help meeeeeeeeeeeee plzzzzzzzzzzzzzzzzzzz

Answers

Answer:

Ernest Hemingway

Explanation:

He was notable for novels like The Sun Also Rises, A Farewell to Arms, For Whom the Bell Tolls, and The Old Man and the Sea, which won the 1953 Pulitzer. In 1954, Hemingway won the Nobel Prize. He did s..uic..id.e on July 2, 1961, in Ketchum, Idaho.  Ernest Hemingway's initial book is The Sun Also Rises, which arrives from a verse in the Bible. The name is an appropriate depiction both of the depression of the Lost Generation of which Hemingway was a part as well as the potential for idealism in the continual rising of the sun.

What enabled wheat and apples to become key crops in Washington?

Answers

Answer:

Irrigation

Explanation:

Washington's region typically receive very little rainfall. If the farmers relied on nature alone, many parts of Washington will most likely have to experience constant crop failure due to drought.

Irrigation allow these farmers to collect water from Columbia, Yakima, and Snake River watersheds. The water that they took from irrigation made them able to provide enough water for the crops to grow without having to rely on rain. Because of this, various types of crops such as apples and wheat can grow pretty well in Washington.

what was the purpose of Zheng He's voyages? Choose three correct answers.

Answers

Answer:

A D E have a blessed day and remember don't be toxic to people

Exploration and Diplomacy: Zheng He's voyages aimed to establish diplomatic and trade relations with other nations. Hence option B is correct.

The Chinese emperor, Zhu Di, sought to expand China's influence, showcase its power, and enhance its prestige by engaging in diplomatic missions and establishing tributary relationships with foreign states.

Maritime Trade: Zheng He's expeditions were also driven by the goal of expanding China's maritime trade network. The voyages allowed the Chinese to establish trade routes, acquire valuable goods, and promote economic growth by facilitating commerce with various countries across Asia, Africa, and the Indian Ocean region.

Display of Power and Prestige: Another objective of Zheng He's voyages was to demonstrate the might and grandeur of the Chinese Empire.

Learn more about Zheng He's voyages here

https://brainly.com/question/17293439

#SPJ2

what was the purpose of Zheng He's voyages? Choose three correct answers.

Exploration and Diplomacy

Power and Prestige

To establish trade routes and expand Chinese influence in the Indian Ocean region.

To spread Chinese culture and establish diplomatic relations with other civilizations.

To explore and gather geographical knowledge of distant lands.

Look at the map.


A map of Germany divided into 4 zones, each controlled by either Great Britain, Russia, the United notes, or France. Berlin is in the Russia zone, and is itself divided into 4 sections controlled by the same countries.

Which of the following statements best describes the reason why West Berlin was vulnerable to Soviet threats after World War II?
The Soviet Union was the only nation that occupied the city of Berlin after the war.
West Berlin was surrounded by the Soviet zone, far from the areas occupied by other Allied nations.
France, Great Britain, and the United States refused to split the occupation of the city of Berlin with the Soviet Union.
Berlin was located in West Germany, which was under constant threat of attack by the Soviet Union.


answer is B) West Berlin was surrounded by the Soviet zone, far from the areas occupied by other Allied nations.

Answers

Hola mates there is no map..

Answer:

here is the map for the question above.

Where did the plague originate

Answers

Answer:

It originated in Asia...

Explanation:

Research two of the missions in California, Texas, New Mexico. Write short report about what you learn. Include information on the founders, history, and activities and life of the mission

Answers

The correct answer to this open question is the following.

Missions in California.

Since 1769, Spanish Mission appeared in the territory of California.

Fray Junípero Serra was a renowned priest, a Franciscan missionary, opened the San Diego mission in California, where priests evangelized Native American Indians into Catholicism.

Another Franciscan mission established in California was the one named San Antonio de Padua, in Monterey, California. It was established in 1771. It was also founded by Jinípero Serra.

In the case of Texas, one of the most renowned missions is the Alamo, in San Antonio, Texas. It was founded in 1781 by Spanish Fray Antonio de Buenaventura Olivers. It was used to evangelize people in the Texas territory into Catholicism.

Another important mission was San Juan Capistrano, founded by the Franciscans in 1716 in the east part of Texas.

In New Mexico, the Spanish priests founded the San Miguel Mission in 1610, in Santa Fe. There, they built a small church that is considered to be the oldest church in the United States territory.  Another important Mission was the San Francisco de Asis Mission, built-in 1772, in Taos, New Mexico. It was a place where Indians received instruction on the Catholic religion and other educational activities.

Use the drop-down menus to complete each sentence about Muslim scholars in medicine. Al-Razi is best known for writing about Ibn Sina wrote to describe the human body and treatments for disease​

Answers

Answer:

1: Best known for writing about dangerous diseases

2: Ibn Sῑnā wrote The Canon of Medicine

Correct on Edge 2021

Answer:

a b

Explanation:

marking brainliest!!!!!!!

Answers

Answer:

B is correct

Explanation:

The Soviets created the Warsaw Pact, ostensibly as a 'defensive alliance', as a propaganda exercise in response to the creation of NATO.

How did the American Revolution contribute to the French Revolution?


The Treaty of Paris that ended the American Revolution made France unstable and led to revolution.The Treaty of Paris that ended the American Revolution made France unstable and led to revolution. , ,

French soldiers from the American Revolution returned home and began a rebellion to overthrow the government.French soldiers from the American Revolution returned home and began a rebellion to overthrow the government. , ,

The debt that France gained during the American Revolution brought on an economic crisis that caused a revolution.The debt that France gained during the American Revolution brought on an economic crisis that caused a revolution. , ,

Britain began a revolution in France because it was upset over France’s support for the American Revolution.

Answers

Answer:

c.The debt that France gained during the American Revolution brought on an economic crisis that caused a revolution.The debt that France gained during the American Revolution brought on an economic crisis that caused a revolution.

which statement best explains why Russia adopted the political ideology being referenced in the passage

Answers

Answer:

where is the passage

Explanation:

Answer:

The answer is B) discontentment after years of monarchist rule

Explanation:

Read the excerpt from The Riddle of the Rosetta Stone by James Cross Giblin.

Some of these scholars made otherwise significant contributions to the world's knowledge of ancient Egypt. A German priest of the 1600s, Athanasius Kircher, wrote the first grammar and vocabulary of Coptic, the language of Christian Egypt. These books were to prove of great value when the hieroglyphs were eventually deciphered.

But Kircher's ideas about the hieroglyphs themselves were even farther off the mark than those of Horapollo. Looking at a certain group of symbols—which actually stood for the name of a pharaoh—Kircher let his imagination run wild. Without any evidence to support him, he said that the hieroglyphs meant "The blessings of the god Osiris are to be procured by means of sacred ceremonies, in order that the benefits of the river Nile may be obtained."

Which sentence from this excerpt contains evidence that supports the claim?

But Kircher's ideas about the hieroglyphs themselves were even farther off the mark than those of Horapollo.
A German priest of the 1600s, Athanasius Kircher, wrote the first grammar and vocabulary of Coptic, the language of Christian Egypt.
Looking at a certain group of symbols—which actually stood for the name of a pharaoh—Kircher let his imagination run wild.
Some of these scholars made otherwise significant contributions to the world's knowledge of ancient Egypt.
It's like they exact same thing as the question I got before it but some of the things are backward. wth

Answers

Answer:

B:A German priest of the 1600s, Athanasius Kircher, wrote the first grammar and vocabulary of Coptic, the language of Christian Egypt.

Explanation:

i got it right in EDGE

What is your worst memory?

Answers

Answer:

One time i bought a new knife and when i tried to open it it slit my thumb and i lost all nerves in my thumb and sometimes if it hits it in the right place it gets this weird tingly feeling.

Explanation:

My worst memory is my mother telling me I'm a disappointment. I remember when I was 13, I was going through some things, so of course I wasn't happy. One day, on the way to the store, she said "Just because you're miserable, doesn't mean you have to make everyone else miserable. You're being selfish. This isn't how I raised you. I am truly disappointed." I try to forget it, but it won't go away. Every time I think of it, I remember exactly when, where, and how she said it. I cry just thinking about it. Ever since, my self-esteem lowered, and lowered, and lowered, to the point I wanted to die. Remember to defend yourself. Thank you for reading.

HELP ME!!!!!!!!!!!!!!

Answers

Answer:

the warsaw pact

Explanation:

is this edmentum? If it is then its correct.

If anyone wants to do this then go ahead. I would appreciate it. If not, well, i dont blame you.
p.s. doesn't have to be good at all.

Write a paragraph explaining what you feel is going to happen to you now
that the 13 th Amendment has ended slavery (1865). What are you going to do? Then
project ten years into the future (1875). Write a second paragraph that tells how
Reconstruction is either meeting your expectations or is a disappointment to you. Write a final paragraph to conclude your opinion of Reconstruction. Do you feel like you are
better off now as opposed to the days before when you were a slave?
Each of the three paragraphs should include at least one historically accurate
event as evidence in support of your opinions

Answers

Answer:

Sorry for the lack of apostrophes, my keyboard is broken.

There are better days ahead of me, Im sure of it! Ive got to stay positive. My papa who lost his life fighting in the Civil War said I should never ever loose hope no matter how bad it gets. Im starting to loose faith in his words, though. There are still so many people out there mistreating blacks like its their buissness. That scares me, it truly does. Obviously I wish everything will turn out alright, and I must admit I had a strong belief that everything would change after the Civil War... but I must accept the truth. The disgusting people of America shall only see this as one less way to abuse me, my family, anyone who looks like me, really. Every day I wake up afraid of what torment I might face. It doesnt help that I live in a southern state, either. Black codes and those Pig Laws all over the place. Chasing me. Haunting me. But I must not loose hope; it would be a disgrace to my papa. Everything will be okay... right?

Reconstruction has been going on for 11 years now. Every year I grow more weary. I was promised Id be a free man after the war, and yet day after day I continuously loose more rights. I cant vote. I ant live or travel where I want to without being controlled. Worst of all, they took my first son. They took him right in front of my eyes and said it was for labour purposes. I am incredibly dissapointed with the results of what this country has turned into. This isnt freedom! This isnt unity!

what was the reaction to the proclamation of 1763 by colonists?

Answers

Answer:

A desire for good farmland caused many colonists to defy the proclamation; others merely resented the royal restrictions on trade and migration. Ultimately, the Proclamation of 1763 failed to stem the tide of westward expansion.

Explanation:

Which option best explains the geography of the spread of Islam?

It started in Asia and then spread to parts of Europe and Africa.

It started in Europe and then spread to parts of Africa and the Americas.

It started in Northern Africa and then spread South.

It started in Mecca and did not spread any further than the Middle East.

Answers

Answer:

the first one

It started in Asia and then spread to parts of Europe and Africa

Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer: This is kinda an estimate so don't quote me on this.

Poland, Germany, Great Britain, France, and the  Soviet Union.

Explanation:

World War II began in Europe on September 1, 1939, when Germany invaded Poland. Great Britain and France responded by declaring war on Germany on September 3. The war between the U.S.S.R. and Germany began on June 22, 1941, with the German invasion of the Soviet Union

Other Questions
anyone out there an expert on dreams?? Estimate 511 x 637 by first rounding each number so that it only has 1 nonzero digit. what would you do when you grow up?*Career* And explain why! During a formal group discussion, participants should be prepared toO lead the conversation and prompt others to speak. O persuade others to agree with their viewpoint. O interrupt other speakers when necessary. O take turns both listening and speaking. This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive How do you do this question? Abdul made $252 for 12 hours of work.At the same rate,how many hours would he have to work to make $105 XYZ Corporation, whose common stock is currently selling for $40 per share, is having a rights offering. The terms of the offering require 10 rights plus $35 to subscribe to one share of stock. Compute the theoretical value of a right before the ex-rights date. Est ce que quelqu'un pourrait bien corriger mon expression ecrite ou donner son avie dessus s'il vous plait A $10,000 bond with 18%/year, compounded semi-annually (interest is paid every six month) is available in the market. The bond matures in 10 years. The closest PW of this bond if the purchaser can earn 12%/year, compounded quarterly is:_____. My annoying brother likes to drive me crazy. There is no other who is that lazy. He whines to my mom night and day, until eventually gets his way. What is a sister to do, when he screams til he's blue? There is no way to win, for he gets under your skin. He does his best to kill all joy. Oh, how my brother does annoy! What is the tone of the poem PLZ HELP!!!Will mark brainliest44. Show that the quadrilateral with vertices A(0,0), B(a,0), C(a + b, c) and D(b, c) is a parallelogram. hehe i need help with the whole quiz basically:IFind the decimal that is equivalent to: A. 1.714 B. 0.583 C. 0.0583 D. 6. Another engine reaches its top speed from rest in 7.5 s. It is able to perform 250,000 J of wok inthat time How much power does this engine have in that time? The Yellow River is often called the cradle of Chinese civilization. It was along the banks of the Yellow River where the Chinese civilization first formed. The Yellow River is 3,395 miles long, making it the sixth longest river in the world. It is also called the Huang He River.Early Chinese farmers built small villages along the Yellow River. The rich yellow-colored soil was good for growing a grain called millet. The farmers of this area also raised sheep and cattle. Ancient China: Geography,Ken NelsonUsing context clues, which statement best defines the phrase "cradle of Chinese civilization?the place where the longest river in China startsthe place where most people in ancient China livedthe place where people in China began a farming culturethe only place in ancient China where people could farm What is an accurate statement about many of the first Africans to come to Louisiana?They came voluntarily.They were skilled laborers. They came in search of domestic work. They knew how to grow crops.