Answer:
If its Right Braliantes please
Want Answer?
Explanation:
Complement is an effector system capable of mediating a number of biological activities. Most familiar is the ability of the system to mediate the lytic destruction of many kinds of cells including bacteria and viruses surrounded by lipid membranes.
Economic impact of aflatoxin on health and agriculture
Answer : contamination in crops results mainly from a reduction in marketable volume
Aflatoxin consumed contributes to the mutagenic , carcinogenic , teratogenic , and immunosuppressive health effects in humans.
What is the after effect of increased temperature in the atmosphere?
Answer:
global warming
Explanation:
Explain what happened to the spread of the infection as more individuals were vaccinated.
Answer: As a result of more people being vaccinated the spread of the infection slowed down.
Why is crossing over of the chromosomes during meiosis
important?
Because it increases the genetic variability, offering more combinations of genotypes.
Which of the following statements is true? The shape of DNA is a triple helix. DNA mutations never affect an entire chromosome. Mutations in egg and sperm cells are inherited by offspring. Reginald Punnett discovered patterns of inheritance during pea plant experiments.
Answer:
Reginald Punnet discovered patterns of inheritance during pea plant experiments
Explanation:
is there more than one right answer
✅ Reginald Punnett discovered the theory of incomplete dominance during flower experiments. ~ ₕₒₚₑ ₜₕᵢₛ ₕₑₗₚₛ! :₎ ♡ ~
what conditions can cause a population to decrease?
Answer:
if the population is too high and food is scarce.
high population attract predators.
high competition for food.
mutations.
Answer:
A reduction over time in a region's population can be caused by sudden adverse events such as outbursts of infectious disease, famine, and war or by long-term trends, for example sub-replacement fertility, persistently low birth rates, high mortality rates, and continued emigration.
Citrus trees create their seed by a method of asexual reproduction by a process called
Answer:
Some plants can produce seeds without fertilization. Either the ovule or part of the ovary, which is diploid in nature, gives rise to a new seed. This method of reproduction is known as apomixis. An advantage of asexual reproduction is that the resulting plant will reach maturity faster.
Explanation:
Answer:
Apomixis
Explanation:
Apomixis is the method of asexual reproduction.
Hope this is correct, have a great day.
How does the mitotic spindle ensure that each daughter cell receives a full complement of the genetic material in the cell nucleus
Answer:
The mitotic spindle attaches to the kinetochores at the centromeres of the chromosomes and then it moves toward the poles of the cell. Thus, sister chromatids are separated simultaneously at their centromeres so that each daughter cell will have the same genetic material as the parent cell (i.e., daughter cells will be genetically identical to the parent cell).
Explanation:
The mitotic spindle is a structure composed of microtubule proteins whose function is to ensure the correct segregation of the chromosomes during mitosis. During metaphase, microtubules from the mitotic spindle bind to the kinetochore (a protein complex assembled on the centromeric region) in order to align sister chromatids on the metaphase plate. Subsequently, during anaphase, the mitotic spindle moves toward the poles of the cell, thereby sister chromatids are separated from each other. In consequence, each daughter cell will have the same amount of genetic material (i.e., the same number of chromosomes) as the parent cell.
I don’t understand how to do this
Answer:
Translation: GAUGCUUCCAACGACCACTA
Transcription:
GTACGAAGGTTGCTGGTGAT
GATGCTTCCAACGACCACTA
Explanation:
How are sexual and asexual reproduction similar?
A. Both are processes that form new cells necessary for the survival of either an organism or a species.
B. Both are processes that produce daughter cells with the same number of chromosomes as the parent cells.
C. Both are processes used to replace dead skin cells.
D. Both are processes used to create exact copies of cells.
Which of the following are pyrimidine?
A. Guanine and cytosine
B. Thymine and Guanine
C. Cytosine and uracil
D. Guanine and adenine
E. Adenine and thymine
Answer:
c.Cytosine and uracil
Explanation:
Two types of Nitrogenous bases(heterocyclic aromatic molecules) are found in DNA and RNA: 1.Pyrimidines and 2.Purines
Pyrimidines:Thymine(5-methyl-2,4-dioxypyrimidine) and Cytosine(2-oxy-4-aminopyrimidine) are found in DNA . Uracil (2,4-dioxypyrimidine) and Cytosine (2-oxy-4-aminopyrimidine) are found in RNA.
Purines:Adenine (6-aminopurine) and Guanine(6-oxy-2-aminopurine) are the two purine bases that are found in both DNA and RNA.
At a warm front warm air meets and moves cold air
2. Based on your results, can any conclusions be draw as to the types of habitats likely to contain the most microbes?
Answer:
Yes.
Explanation:
Yes, conclusions can be drawn from the types of habitats the most microbes likely to present because different microbes needs different types of environmental conditions. Some microbes needs moist and cool environment and can't survive in warm and dry environment while some microbes survive in dry and warm environment and die in moist and cool environment so we can draw conclusion from their habitat types.
Which molecule in the equation represents food energy made by plants? A Carbon dioxide B Water C Glucose D Oxygen
Answer: Glucose
Explanation: Photosynthesis is a set of chemical reactions that uses energy from the sun and carbon dioxide to produce sugar and oxygen. The sugar provides plants with energy to grow.
What is the probability that each of the following pairs of parents will produce the indicated offsprings? (assume independent assortment of all gene pairs)
a)CCDDEE•ccddee=CcDdEe
b)CCDdEe•CcDdEe=CCddEE
c) CcDdEe•CcDdEe=CcDdEe
d)ccDdEE•CCDdee=CcDdEe
Answer:
C is the pick c I'm 99% sure
Someone please help me
Answer:
Your answer is D) Graduated Cylinder.
Answer:
Graduated cylinder
Explanation:
Liquid volume is typically measured using specific tool called graduated cylinder.
At 23°F, 1 inch of rain equals 10 inches of snow.
Convert 2 inches of rainfall to snowfall.
Make up and solve division problems that involve
decimals
Answer:
The correct answer is - 20 inches
Explanation:
1 inch of rain equals 10 inches of snow, then
1 = 10 inch snow
2 = 10*2
2= 20 inches of snow.
The correct answer is - 20 inches
The body layers that can be dissected in the dissection study area are arranged from superficial to deep.
True or False
Answer:
True
Explanation:
The correct option about the arrangement of the body layers to be dissected in a dissection study from superficial to deep is ; TRUE
During dissection study there only one way in which structures can be viewed also when the body layers are to be dissected are arranged in only one way as well ( from superficial to deep ) because the superficial layers lie just under the skin while deep layers lies deep inside the skin surrounding each muscle.
therefore arranging the body layers from superficial to deep is the best arrangement when dissecting.
Learn more : https://brainly.com/question/17874053
Matter and energy always flow from the
in ecosystems.
A. consumers to the producers
B. heterotrophs to the autotrophs
C. autotrophs to the consumers
Answer: When organisms use organic matter for cellular respiration, ALL the goes back into carbon dioxide, water, and minerals, while ALL the energy leaves the ecosystem as heat. So matter cycles, energy flows through ecosystems. So It is C
Explanation: A. The producers generate food for themselves and others; consumers do not produce anything, instead eating producers, other consumers or both.
B. Autotrophs make food for their own use, but they make enough to support other life as well.Heterotrophs cannot make their own food, so they must eat or absorb it.
So C is correct
Matter and energy always flow from the in ecosystems from autotrophs to the consumer.
What is ecosystem?The energy flow in the ecosystem is one of the important factors that enables the survival of such a huge number of animals. An ecosystem is made up of a network of connections between living and non-living elements.
All of the energy needed by living things is provided by the sun. About 1% of all radiant energy is absorbed by green plants and distributed throughout the ecosystem.
According to the first law of thermodynamics, energy cannot be generated or destroyed. The energy source, in this case solar energy, cannot be created or destroyed. It can only be moved from one system to another, just like a form is moved from one form to another.
Therefore, Matter and energy always flow from the in ecosystems from autotrophs to the consumer.
To learn more about energy, refer to the link:
https://brainly.com/question/1932868
#SPJ2
A change in DNA could alter the amino acid order which will affect the folding of the protein, and therefore it's function.
Answer:
true
Explanation:
Empathy means that you can communicate well with others.
A.
True
B.
False
Answer:
A. true
Explanation:
i mean if you have empathy then yeah it's true
Answer:
A
Explanation:
It means you have the ability to feel what someone is experiencing.
Which of the following is the major concern with utilizing forensic DNA testing?
O keeping Innocent people out of all
treating genetic diseases as early as possible
a violation of privacy
a violation of the law
Answer: a violation of privacy
Explanation:
A person's DNA cannot be changed as it is their genetic information. It is therefore their most private information and when it is utilized in forensic DNA testing, it runs the risk of invading a person's privacy.
Forensic DNA testing works by comparing the subject DNA with a DNA database. Using this database means going through the DNA of millions of people without their consent.
This is their most private information and it is being stored and accessed without permission. Critics say that this is a violation of privacy and many studies have showed that this is a major concern
Are you for, against or undecided on GMOs? Explain.
Please give your opinion <3
Answer:
AGAINST for sure
Explanation:
ive personally raised GMO animals and they have no life. like chickens at the age of 8 weeks the breasts on GMO chickens are so large they are unable to walk and if u do not butcher them they will have heart attacks at around 9 weeks. they also dont get to go outside and walk around bc that makes them lose weight. so most of the GMO chickens do not get to go outside and actually have clean air. let alone see the sun light and stand in grass.
Explain how the structure of DNA is important in the synthesis
Answer:
DNA is the primary genetic material contained within your cells and in nearly all organisms. It's used to create proteins during protein synthesis, which is a multi-step process that takes the coded message of DNA and converts it into a usable protein molecule.
Explanation:
HELP ITS DUE SOOOONNNN
Answer:
A
Explanation:
Denim
Hope this helps :D Have a great day :3
What does light years measure
A light-year is how astronomers measure distance in space, hope this helps ^^
Answer:
Light year measures distance in space
Explanation:
it is mostly used to estimate very far distances and so it might take us about 24 million light years to travel to another galaxy and so on
Can the change in cyclin concentration during mitosis be explained by the fact that the cell divides in two and thus divides the material in the cell into two smaller volumes
Answer:
No, because cell division is expected to decrease not only the net amount of cyclin molecules in daughter cells but also the volume of these daughter cells compared to the original parent cell, and therefore the concentration should be nearly equal.
Explanation:
When a cell divides to produce two daughter cells, the cell components including its previously duplicated genetic material (DNA), organelles, signaling molecules, fatty acids (lipids), proteins, etc., are distributed into daughter cells. These daughter cells have a smaller volume compared to the original parent cell. In consequence, the concentration of cellular components (including cyclin proteins) should be similar between parent cell and daughter cells.
Which air mass would produce cold, dry weather in the winter?
Answer:
The correct answer is - Continental polar air mass. The continental polar air masses are very big air masses that are very cold, and dry
Answer:
Continental Polar Air Mass
Explanation:
The continental polar air masses are vey big air masses that are very cold, and dry.
When shorthorn red cattle are bred to shorthorn white cattle, they produce roan (red and white hairs interspersed) offspring. What type of inheritance is this
Answer:
Co-dominance.
Explanation:
Genetics can be defined as the scientific study of hereditary in living organisms such as humans, animals and plants.
In Genetics, co-dominance can be defined as a phenomenon in which two (2) alleles of the same gene are present in a living organism and both are equally expressed to a degree or simultaneously.
This ultimately implies that, co-dominance is a phenomenon that typically involves the relationship between alleles i.e the two (2) versions of a gene present in living organisms. Also, a single version of a gene expressed by a living organism is referred to as an allele.
In this scenario, when shorthorn red cattle are bred to shorthorn white cattle, they produce roan (red and white hairs interspersed) offspring. Therefore, this type of inheritance is known as co-dominance because the two (2) alleles (shorthorn red and shorthorn white) are expressed equally or simultaneously in their offspring i.e a roan.
Monitoring levels of which two gases would help determine the human
impact on air quality?
A. Methane
B. Water vapor
C. Carbon dioxide
D. Oxygen
Answer:
A. Methane
C. Carbon dioxide
Explanation:
Methane and carbondioxide are the two gases that determine the human impact on air quality because these gases are produced due to human activities. Methane gas is used in homes for cooking and heating purpose while on the other hand, carbondioxide gas is released from burning of fossil fuels in the engine of vehicles and industries for making different products. These two gases greatly affect air quality.
Answer:
a and c your welcome my children
Explanation: