Answer:
Following are the solution to this question:
Explanation:
In a spindle in prophetic (mitotic apparatus) spindle, pulley and cellular membranes form at the kinetochore of metaphase genes intended besides separation of anaphase daughter chromosomes.
Even though the cycle of creation of the cells move towards opposite poles, microtubules gradually form a network between them, and its duplicate chromosomes would be later removed.
which enzyme attaches the ozaki fragments?
Answer:
DNA ligase,joins the okazaki fragments together into a single DNA molecule
Answer:
DNA ligase attaches the ozaki fragments.
Explanation:
In my thought it's the answer.
Rough ER is mostly responsible for
making -__-, whereas smooth ER is
mostly responsible for making
Explanation:
The rough ER, studded with millions of membrane bound ribosomes, is involved with the production, folding, quality control and despatch of some proteins. Smooth ER is largely associated with lipid (fat) manufacture and metabolism and steroid production hormone production.
What methods would the body use to provide a
person with energy throughout a race?
DONE
C
Intro
Answer:
The methods the body would use to provide a person with energy throughout a race is using the ATP in the muscle cells for the first 3 seconds.
For the next 8 to 10 seconds, the body replaces the used ATP and produces more.
Within the next 90 seconds of the race, anaerobic respiration is used up to make more ATP (Adenosine triphosphate).
Therefore, during the whole process, the three energy systems used are:
the ATP-PC System
the Glycolytic system
the Oxidative system
Answer:
The methods the body would use to provide a person with energy throughout a race is using the ATP in the muscle cells for the first 3 seconds.
For the next 8 to 10 seconds, the body replaces the used ATP and produces more.
Within the next 90 seconds of the race, anaerobic respiration is used up to make more ATP (Adenosine triphosphate).
Explanation:
The most important part of mitosis is to correctly divide the
Cell membrane
Cytoplasm
DNA
Organelles
Answer:
DNA
Explanation:
Which cell organelle is most responsible for ensuring that the cell obtains the necessary materials to maintain homeostasis?
Answer:
i’d say mitochondria
Explanation:
mitochondria is the “powerhouse of the cell”
What affect do glass panels have on temperature google doc
Answer:
wdym
Explanation:
Which fossils provide information as to the mode of formation of an oxygen-rich atmosphere by about 2 billion years ago?
Answer:
The fossils that provide information on the formation of an oxygen-rich atmosphere are the stromatilites from the Precambrian era. These are layered and columnar fossils consisting mainly of cyanobacteria which were the original life form back then. These bacteria took in carbon dioxide and produced oxygen by photosynthesis as early as 2.5 billion years ago (the earth is about 4.5 billion yrs old).
Explanation:
For the last 30 years, human use of fertilizers has had a significant impact on the nitrogen
cycle. Which statement explains how fertilizers impact an ecosystem?
O Fertilizers increase the amount of fixed nitrogen available in the ecosystem.
O Fertilizers decrease the amount of nitrogen fixed by organisms living in the ecosystem.
O Fertilizers kill off important nitrogen fixing bacteria.
Fertilizers decrease the amount of fixed nitrogen available in the ecosystem.
Answer:
It's C
Explanation:
Hope this helped :)))
The fertilizers show a significant impact on the nitrogen cycle as the fertilizers kill off the important nitrogen fixing bacteria which are present in the soil. Thus, the correct option is C.
What is Nitrogen cycle?Nitrogen Cycle is a biogeochemical process through which the nitrogen present in the environment is converted into many different forms, consecutively passing from the atmosphere to the soil to the living organisms and back into the atmosphere after decomposition. It involves several processes including the nitrogen fixation, nitrification, denitrification, decay and putrefaction of the nitrogen compounds.
Intensive fertilization of the agricultural soils of normal soil can increase the rates at which nitrogen in the form of ammonia is volatilized in the environment and lost to the air. It can also speed the microbial breakdown of ammonium and nitrates in the soil which results into enhancing the release of nitrous oxide. In addition to this, excessive use of fertilizers also kills the nitrogen fixing bacteria present in the soil.
Therefore, the correct option is C.
Learn more about Nitrogen cycle here:
https://brainly.com/question/1615727
#SPJ2
Which categories of amino acid would you expect to find on the surface of a soluble protein, and which would you expect to find in the interior? What distribution of amino acids would you expect to find in a protein embedded in a lipid bilayer?
Answer:
Polar and charged amino acid residues (the remainder after peptide bond formation) are more likely to be found on the surface of soluble proteins where they can interact with water, and nonpolar (e.g., amino acid side chains) are more likely to be found in the interior where they are sequestered from water.
Explanation:
The amino acids with POLAR and CHARGED side chains are expected to be observed on the membrane surface, whereas amino acids with NON-POLAR and HYDROPHOBIC side chains are expected to be found inside the lipid bilayer.
The lipidic bilayer is mainly composed of phospholipids.Phospholipids have hydrophilic, polar phosphate heads facing out on each surface to interact with water and hydrophobic fatty acid tails facing each other inside the lipid bilayer.The polar and charged side chains of amino acids are expected to be observed on the surface of membrane proteins because they can interact with water (H2O) molecules.On the other hand, nonpolar side chains of specific amino acids are expected to be observed inside the lipid bilayer to interact with the hydrophobic fatty acid tails of phospholipids.The polar amino acids include glutamine, glutamic acid, arginine, asparagine, aspartic acid, histidine, lysine, serine, and threonine.Moreover, amino acids with hydrophobic side chains include leucine, isoleucine, glycine, alanine, valine and proline.In conclusion, amino acid residues with POLAR and CHARGED side chains are expected to be observed on the membrane surface, whereas amino acids with NON-POLAR and HYDROPHOBIC chains are expected to be found inside the lipid bilayer.
Learn more in:
https://brainly.com/question/4535258?referrer=searchResults
A baseball is tossed into the air, forming an arc. Mark the following points:
1. Kinetic energy is the highest
2. Potential energy is the highest
3. Kinetic energy is converted in potential energy
4. Potential energy is converted into kinetic energy
Answer:
it is number 3 .............
Answer:
Kinetic energy is the highest when the baseball is in the air.Potential energy is the highest when the ball is about to be thrown.Kinetic energy gets converted to potential energy when the ball stops flying in the air and falls on the ground.Potential energy is converted into kinetic energy when the ball is thrown.Identify the three types of neurons, and explain the function of each type
Answer:
Sensory neurons help you:
taste
smell
hear
see
feel things around you
Explanation:
Motor neurons
Motor neurons play a role in movement, including voluntary and involuntary movements. These neurons allow the brain and spinal cord to communicate with muscles, organs, and glands all over the body.
Interneurons
Interneurons are neural intermediaries found in your brain and spinal cord. They’re the most common type of neuron. They pass signals from sensory neurons and other interneurons to motor neurons and other interneurons. Often, they form complex circuits that help you to react to external stimuli.
What is the contour interval of this map?
Answer:bird creek
Explanation:
Plants and animal cells are examples of
cells
O prokaryotic cells
O eukaryotic cell
Answer:
eukaryatic which the RH whitthakar was divided PLANTAE and animalia kingdoms in eukaryotes
Explain how exercise and an active lifestyle can improve bone health
and bone density.
Include discussions of osteoblasts vs.
osteoclasts, osteoids, osteocytes, collagen, bone modeling, impact
and increased workload, glucocorticoid effects, mineral intake, or
underloaded bone.
Explanation:
explain how exercise and an active Lifestyle can improve bone health and bone density include discussions of
What are internal structures?
Answer:
Internal structures are the inner pieces and parts that keep organisms alive, help them grow, and help them reproduce.
Explanation:
Question 2 of 9
Corn seeds were germinated (grew and put out shoots after a period of dormancy) in a dark room
placed in the light, 75 of these seedlings turned green. Which conclusion about chlorophyll (the
plants can most reasonably be drawn from this information?
(1 point)
DA. Light is the only factor that controls the production of chlorophyll
.
B. Darkness is the only factor that prevents the production of chlorophyll.
IC Light and vitamins are necessary for chlorophyll production.
D. Light and some other factor are necessary for chlorophyll production.
----Page 2 of 9----
Answer:
The correct answer is option D. Light and some other factors are necessary for chlorophyll production
Explanation:
By this experiment, it is clear that light is the major factor that helps in the production of chlorophyll in seedlings or plants. In this study, placing the seeds in the light turns 75 seedlings green which is possible by the production of the green pigment, chlorophyll only. So, it is proved that light is a key factor in the production of chlorophyll.
Besides light, there must be some other factors (mineral nutrition and chemical metabolites) that also play role in the production of chlorophyll or increase or decrease of the chlorophyll production as few seedlings did not turn green in the study.
What type of cloud is Cloud A? What kind of weather might you expect when you see clouds of this type?
Answer:
Cloud A is a cumulus cloud. When these fluffy, white clouds are in the sky, you can expect fair weather.
Explanation:
1. Compare and contrast mitosis and meiosis. 2. What major event occurs during interphase?
Answer:
1.
contrast between mitosis and meiosis
Mitosis
- it takes place in somatic cells in multi cellular organisms in order to provide growth, however, in unicellular organisms it is reproductive division as well. is the means of reproduction in single-celled organisms. Other organisms use it for the growth of tissues (somatic cells)
- exact number of chromosome in offspring
- no recombination or crossing over
- no pairing found
- major phase: prophase, metaphase, anaphase, telophase
Meiosis
- takes place in sex cells to form gamete formation during sexual reproduction
- half of the chromosome number found in gametes of the parents thus, known as reduction division
- due to crossing over takes place recombination found.
The pairing of chromosomes takes place
- major steps:
Meiosis 1 – prophase, Metaphase, anaphase, Telophase, and
Meiosis 2: Prophase, Metaphase, Anaphase, and Telophase
2. Interphase takes place prior to both mitosis and meiosis which is divided into 3 sub phases-G1, S and G2 phases.
The major events are as follows:
G1- RNA and protein synthesis takes place and cell grows in size
S- DNA replication takes place, Centriole duplication occurs and synthesis of histone proteins.
G2- RNA and Protein synthesis continues.
What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA
Answer:
what I don't understand what is the Ctcagt
help idk this answer
Answer:
d
Explanation:
Higher energy contained in the sugar molecules produced by photosynthesis comes from
A. light
B. water molecules.
C. ΑΤΡ.
D. carbon dioxide molecules.
Answer:
A
Explanation:
light
ffjcddssdfghcxdsssswefgcfdd
Which types of mutations in the lac operon stop Escherichia coli from utilizing lactose as a carbon source? a) promoter deletion b) lactose-binding site mutation c) repressor DNA-binding site mutation d) operator deletion
Answer:
D.) repressor DNA-binding site mutation
Explanation:
lacl prevents the repressor polypeptide is a mutant that prevent operon from binding lactose, and thus will bind to the operator and be non-inducible.. This mutant will represses the lac operon whether lactose is present or not and the lac operon will not be expressed. It is also called“super-supperesor".
The lacI locus – One type of mutant allele of lacI (callled I-) prevents the production of a repressor polypeptide or produces a polypeptide that will not allow to bind to the operator sequence.
This is also a constitutive expresser of the lac operon because absence of repressor binding permits transcription.
Which mutation below would result in the greatest amount of change in the proteins that code for a particular trait?
(Please help I will reward)
A. inserting three nucleotides
B. deleting three nucleotides
C. deleting one codon
D. deleting two nucleotides
Answer:
Mutations are errors in codons caused by changes in nucleotide bases. Some mutations may not have much effect. For example, if the codon GAA becomes the codon GAG, because the genetic code is degenerate, the codon will still code for the amino acid glutamate. Such ineffectual mutations are called silent mutations. Some mutations, however, can have a huge affect on coding for amino acids, which can in turn affect what proteins are produced, which can have a profound effect on cellular and organismal function.
most bacteria reproduce by
Answer: Most bacteria rely on binary fission for propagation.
Explanation: Hope this helps have a great day!
Answer: Most bacteria reproduce by binary fission, also know as propagation.
4. When an offspring grows off from the body of a parent organism it is called __________________. *
a.fission
b.budding
c.fragmentation
d.sporulatioin
Answer:
Budding
Explanation:
It is asexual reproduction in which offspring grows out of the parents organisms.
In the process of budding, an offspring grows off from the body of a parent organism and buds off when fully matured. Thus, the correct option is B.
What is Asexual Reproduction?
Asexual reproduction is the type of reproduction only a single parent is involved. In this process, offspring are developed from a single parent called mother cell and these offspring are genetically identical to the parent hence are also called as clones.
During the process of budding which is a types of asexual reproduction, a new organism develops from an outgrowth or bud which is formed on the parent plant due to the cell division at a particular site on the parent plant. For example, the small bulb-like projections coming out from the yeast cell are the buds which give rise to new yeast organism.
Therefore, the correct option is B.
Learn more about Asexual Reproduction here:
https://brainly.com/question/4100787
#SPJ6
which best describes the results of mendels work with pea plants a) he figured out the fastest way to grow pea plants. b) he showes that pea plants do not pass traits to their offspring. c) he found the basic ideas about genetics. d) he discovered the scientific method.
Answer:
its C
Explanation:
Which of these will weigh the same after it has undergone a change?
A.) Paper being burned.
B.) Sugar water being evaporated.
C.) Two chemicals reacted to form gas.
D.) Ammonia added to steel wool to create heat.
can somebody do 4 and 5 for me
Answer:
4. According to what is observed in the diagram, the maltose (substrate) binds to the maltase (enzyme) to obtain glucose molecules (product), in a process of hydrolysis of the maltose.
5. Three factors that can affect intestinal maltose activity - slowing it down or stopping it - are temperature, pH and substrate depletion.
Explanation:
4. Enzymes, such as maltase, have the function of making a reaction faster and decreasing the activation energy. Maltase is responsible for breaking down a maltose molecule, a dimer, into two glucose monomers, which is a hydrolysis reaction of the bonds that hold glucose molecules together.
5. There are several factors that can cause the decrease or cessation of the activity of an enzyme. Enzymes are activated when substrate is available and work best under ideal temperature and pH conditions. When there are alterations of these factors, the enzyme will reduce or stop the reaction in which it intervenes.
pH: when the pH increases or decreases it produces a decrease in the speed of reaction that catalyzes an enzyme. Very high or low pH levels can denature the enzyme and make the expected reaction not occur. Temperature: like pH, changes in temperature can slow or stop maltase activity. Substrate availability: It is a fact that when the specific substrate of an enzyme becomes depleted, the rate of reaction slows down, stopping when no substrate is available.Genetic counselors work mostly with
1 school counselors.
2 researchers in genetic engineering.
3 elderly adults who live in care facilities.
4 couples who are planning to have children.
Answer: couples who are having children
Explanation:
I got it right on my quiz
What is the optimal pH for Enzyme B?
Answer:
6,7.77.0
Please correct Ok ?