Answer: Made up of
Explanation:
Composed can mean several things such as being able to remain calm or being made up of something. In this case it is the latter. When they say that something is composed of something else, it means that the first thing is made up of the second thing.
In this case therefore, the oceanic crust being composed of pieces that cover the ocean floor means that the oceanic crust is made up of those pieces.
Match each cloud type with its image.
Cirrus
Cumulus
Stratus
Cumulonimbus
Fog
The name of the clouds with respect to its image are given below:
A ----- Cumulonimbus.B ----- Stratus.C ----- Cirrus.D ----- Fog.E ----- Cumulus. What do you mean by Clouds?Clouds may be defined as an observable mass of particles of crystallized vapor suspended in the atmosphere of a planet or moon.
The major function of the clouds is to prevent yourself from the sun's intense heat during the day while to limiting the extremely cold at night.
Therefore, it is well described above.
To learn more about Clouds, refer to the link:
https://brainly.com/question/1783904
#SPJ2
Which part of human blood transports homones and
nutrients?
I don’t understand how to do this
Answer:
Translation: GAUGCUUCCAACGACCACTA
Transcription:
GTACGAAGGTTGCTGGTGAT
GATGCTTCCAACGACCACTA
Explanation:
At a warm front warm air meets and moves cold air
A 176-pound lactating woman should consume approximately ______ grams of protein per the RDA recommendation.
64
88
176
387
Answer:
88
Explanation:
Answer: 88
Explanation:
Chromosome structure can be microscopically observed best during
Scientists find the fossilized remains of a fish in the middle rock layers of a research site. They find the fossil of an insect in the lowest rock layers.
What can be concluded from this evidence?
A. the insect lived before the fish
B. the insect lived on the bottom of the ocean that the fish lived in
Explain how the structure of DNA is important in the synthesis
Answer:
DNA is the primary genetic material contained within your cells and in nearly all organisms. It's used to create proteins during protein synthesis, which is a multi-step process that takes the coded message of DNA and converts it into a usable protein molecule.
Explanation:
Do all three bird species occupy the same niche? Explain .
Answer:
None of the birds have the same niche.
Explanation:
They all have different niches because of the food they ate. Over time, they were gentically changing to adapt to their own food.
Difference between second level consumer and third level consumer
Answer:
Second-level Consumers - consumers that get their energy from first-level consumers and/or producers. Carnivores - organisms that eat only other animals. Third-level Consumers - consumers that eat second-level consumers and/or first-level consumers.
Cross the following blood types OO and AB.
What percentage would have O Blood, B Blood, A
Blood and AB Blood?
Answer:
Explanation:
Believe it or not, in this case having a blood type different from either parent is by far the most common result. In most cases, an O parent and an AB parent will have only A or B kids.
When there are more molecules, there will be less energy.
Where are the photoreceptors located inside a human eye?
Explanation:
retina
photoreceptor; rod and cone
Rods and cones are photoreceptive cells located in the retina of the eye.
Matter and energy always flow from the
in ecosystems.
A. consumers to the producers
B. heterotrophs to the autotrophs
C. autotrophs to the consumers
Answer: When organisms use organic matter for cellular respiration, ALL the goes back into carbon dioxide, water, and minerals, while ALL the energy leaves the ecosystem as heat. So matter cycles, energy flows through ecosystems. So It is C
Explanation: A. The producers generate food for themselves and others; consumers do not produce anything, instead eating producers, other consumers or both.
B. Autotrophs make food for their own use, but they make enough to support other life as well.Heterotrophs cannot make their own food, so they must eat or absorb it.
So C is correct
Matter and energy always flow from the in ecosystems from autotrophs to the consumer.
What is ecosystem?The energy flow in the ecosystem is one of the important factors that enables the survival of such a huge number of animals. An ecosystem is made up of a network of connections between living and non-living elements.
All of the energy needed by living things is provided by the sun. About 1% of all radiant energy is absorbed by green plants and distributed throughout the ecosystem.
According to the first law of thermodynamics, energy cannot be generated or destroyed. The energy source, in this case solar energy, cannot be created or destroyed. It can only be moved from one system to another, just like a form is moved from one form to another.
Therefore, Matter and energy always flow from the in ecosystems from autotrophs to the consumer.
To learn more about energy, refer to the link:
https://brainly.com/question/1932868
#SPJ2
The movement of a fluid, caused by differences in temperature, that transfers heat from one part of the fluid to another
Convection
Conduction
Convection Current
Radiation
Answer:
Convection is the answer.
Explanation:
Answer:
convection girlie. and dis aint college hun.
Explanation:
What is a daughter cell?
Example: "When a cell in the body divides, it will pass on a copy of its DNA to each of its daughter cells."
Answer:
Explanation:
Daughter cells are produced after a single cell undergoes cell division. During mitosis, one pair of daughter cells is created after one round of DNA replication. In mitosis, a single cell becomes two identical cells. ... Daughter cells in this sense are actually closer to clones
What is the difference between plastic CONSUMPTION and plastic WASTE?
Answer:
plastic consumption is like using a lot of plastic and plastic waste is when you throw out a lot.
Explanation:
consumption means like eating /using
waste means throwing out / not really using
hope this helped. btw I'm not sure if this is right but I hope it is!
Help me on this question please.
Answer:
The answer would be D because, stars have nothing to do with the water cycle.
answer:
the stars appearing to move through the night sky.
- so option D.
Please help me guys!!
Look at the number of deer in “predation” and “starvation” columns. What conclusions can you draw about the introduction of the wolves on these values?
Answer:
This is because when the wolves preyed on the deer, their population got regulated. Due to this, the competition for resources amongst the surviving deer population got reduced resulting in low starvation.
This is because the deer's numbers were controlled when wolves preyed on them. As a result, there was less rivalry for resources among the remaining deer population, which led to decreased hunger.
"Predation" and "starvation" are both ecological concepts related to the interactions and dynamics of populations within ecosystems.
Predation is a biological interaction in which one organism, called the predator, hunts, captures, kills, and consumes another organism, known as the prey. Predation is a common relationship in nature, observed across various taxa, such as carnivores hunting herbivores or parasites feeding on host organisms.
Starvation refers to the condition in which an organism suffers from a lack of sufficient food or nutrients required for its survival and normal functioning. When resources become scarce or unavailable, individuals within a population may not obtain enough food to sustain themselves.
Therefore, there was less rivalry for resources among the remaining deer population, which led to decreased hunger.
For more details regarding "Predation" and "starvation", visit:
https://brainly.com/question/17407899
#SPJ6
Are you for, against or undecided on GMOs? Explain.
Please give your opinion <3
Answer:
AGAINST for sure
Explanation:
ive personally raised GMO animals and they have no life. like chickens at the age of 8 weeks the breasts on GMO chickens are so large they are unable to walk and if u do not butcher them they will have heart attacks at around 9 weeks. they also dont get to go outside and walk around bc that makes them lose weight. so most of the GMO chickens do not get to go outside and actually have clean air. let alone see the sun light and stand in grass.
PLEASE HELP 47 POINTS ASAP
There is an amusement park based on sea life. Its purpose is to get the public interested and caring about conservation of the world’s oceans. Some of the profits from this organization go toward funding ocean research and conservation. In order to get people interested, some of the shows that the park offers include large marine mammals that do tricks. Some of the larger marine animals are housed in pools for viewing instead of being allowed to live in their natural habitat. They also have rare and endangered species on display to help increase awareness of them. They even have a breeding program for the some of the endangered animals.
Describe an ethical concern that would be related to this park.
Answer:
The animals don't know outside of that habit because that where they were born. If they were to be released they would die because they are not used to having to fend for themselves.
Explanation:
1. Which of the following statements best describes heredity in organisms that
reproduce sexually?
A. All four offspring received all of their genetic information only from Parent 1 and
are therefore identical to that parent
B. All four offspring received all of their genetic information only from Parent 2 and
are therefore identical to that parent.
C. All four offspring are genetically unique and did not receive any of their genetic
information from either parent.
D. Each of the offspring is genetically unique and received some of its genetic
information from each parent, so each has some traits in common with each
parent.
For me, the best answer would be D
Answer:
[tex]\huge\boxed{\sf Option \ D}[/tex]
Explanation:
While reproducing sexually, The zygote receives half of the gametes of male organism while half of the gametes of female organism. This constitutes to the total number i.e. 46 chromosomes.
While the zygote receive half from male and half from female, This means that the offspring produced by the zygote will have both the characteristics in common of the male as well as female. Remember that, Chromosomes contain gene which are particularly responsible for characteristics.
So, Each of the offspring is genetically unique and received some of its genetic information from each parent, so each has some traits in common with each
parent.
[tex]\rule[225]{225}{2}[/tex]
Hope this helped!
~AH1807describe the regions where the process of crystallization happens
most often
In polar regions vapor deposition is the primary method of crystal growth in the upper fairing
Explanation:
hope this helps have a nice day :) ♡
I NEED HELP The measure of how resistant a solid is to shape change when a force is applied.
Hardness is a measure of how resistant solid matter is to various kinds of permanent shape change when a force is applied Macroscopic hardness is generally characterized by strong intermolecular bonds, but the behavior of solid materials under force is complex; therefore, there are different measurements of hardness: scratch hardness, indentation hardness, and rebound hardness. Hardness is dependent on ductility, elastic stiffness, plasticity, strain, strength, toughness, viscoelasticity, and viscosity. Common examples of hard matter are ceramics, concrete, certain metals, and super hard materials, which can be contrasted with soft matter.
Which is a step of the scientific method in environmental science? A. Testing a hypothesis B.Carrying out research C.Collecting ideas from boocks is a step in the scientific method. The step that follows this step involves forming A.a judgment B.a conclusion C .notes .
Answer:
The correct answer is Option B (Carrying out research). The step that follows this step involves forming B.a conclusion
Explanation:
The Natural environment around us is a function of both the living things and the non-living things. So, environmental science is the study of the natural environment around us. This study includes how to tackle environmental problems and further study on how humans could be impacted by the interactions with their environment. The scientific method is a step taken towards ensuring development in a field by bringing new discoveries and challenging existing beliefs through scientific tests and research. Generally, for most scientific methods of many fields, it starts with:
1. Observations
2. Making inquiry which involves asking questions
3. Forming a hypothesis, which means making untested assumptions
4. Conducting an experiment to check the hypothesis
5. Analyze the results
6. Publish the results
The correct answer is Option B (Carrying out research). Because it involves the scientific method highlighted above. The step that follows this step involves forming B.a conclusion
In and out, it's all we know. We do it more when you are on the go! Even sleeping, in and out...it always happens without a doubt.
A.Immune System
B.Respiratory System
C.Digestivs System
D. Nervous System
E. Circulatory System
F. Musulsketal System
If nuicleotoid W is guanine what could be the correct identification of the nucleotides
3. Scientists who study the cell cycle use fluorescent dyes and lasers that enable them to measure the DNA content of individual cells. They can count the number of cells with 2N and 4N DNA content, as well as in between 2N and 4N (greater than 2N, but not quite 4N yet). a. In what phase(s) of the cell cycle will cells have 2N DNA content
Answer:
G1 phase
Explanation:
The cell cycle is divided into 2 major phases
1. The interphase
2. The m phase
The interphase, in chronological order, is further subdivided into
G1 phaseS phaseG2 phaseCells grow and develop at the G1 phase while the G2 phase is characterized by protein synthesis in addition to continued growth.
The DNA of a cell in interphase is doubled at the S phase. This means that if a cell has a 2N amount of DNA at the beginning of the S phase, the amount of DNA at the end would have become 4N. This amount of DNA is shared into 2 daughter cells in equal amounts during mitosis or the m phase, meaning that each daughter cell would have a 2N amount of DNA before entering the interphase.
Hence, cells will have 2N DNA content in a period that spans through the end of the m phase of the cell cycle to the beginning of the S phase of the same cycle. This means that cells at the G1 phase would be the ones with 2N DNA contents.
Cell grows and prepare itself for replication in the G1 phase cell cycle. In G1 phase of cell cycle, cell is in 2n state.
Cell Cycle:
Cell cycle is the life cycle of the cell in which cell grow and divide. This completes in 2 phases,
InterphaseM- phaseInterphase:
Cell grows in this phase and prepare to divide. This includes 3 phases,
G1 phase In this phase cell, grow and prepare for replication.S- phase : Cell synthesizes its DNA via replication. In S- phase cell is in 4n stage. G-2 phase: Cell prepares itself for division.M- phase:
Cell condenses its chromosome and divide into 2 cell.Since, cell replicates its DNA in S-phase.Therefore, in G1 phase of cell cycle, cell is in 2n state.
To know more about the cell cycle, refer to the link:
https://brainly.com/question/11009129
Which of the following statements is true? The shape of DNA is a triple helix. DNA mutations never affect an entire chromosome. Mutations in egg and sperm cells are inherited by offspring. Reginald Punnett discovered patterns of inheritance during pea plant experiments.
Answer:
Reginald Punnet discovered patterns of inheritance during pea plant experiments
Explanation:
is there more than one right answer
✅ Reginald Punnett discovered the theory of incomplete dominance during flower experiments. ~ ₕₒₚₑ ₜₕᵢₛ ₕₑₗₚₛ! :₎ ♡ ~
Two rabbits have different parents. One rabbit has ears that flop over, and the other rabbit has ears that stand straight up. Why do the rabbits have ears with different shapes?
Answer:
The rabbits have different versions of the gene for ear shape, which instruct for different proteins that make differently shaped ears. A Father sheep has curly wool while a Mother sheep has straight wool.
Explanation:
I majored in Biology
Answer:
Explanation: Each rabbit has a different ear shape because they have different versions of the gene for ear shape that connect together to make different ear shapes. - D