Which helps in the production of eggs?

testosterone
estrogen
semen
fallopian tube

Answers

Answer 1

Answer:

Semen helps in the production of eggs!

Answer 2

answer:

... semen...

explanation:

i'd be embarrassed to explain that bit


Related Questions

Identify the three types of neurons, and explain the function of each type

Answers

Answer:

Sensory neurons help you:

taste

smell

hear

see

feel things around you

Explanation:

Motor neurons

Motor neurons play a role in movement, including voluntary and involuntary movements. These neurons allow the brain and spinal cord to communicate with muscles, organs, and glands all over the body.

Interneurons

Interneurons are neural intermediaries found in your brain and spinal cord. They’re the most common type of neuron. They pass signals from sensory neurons and other interneurons to motor neurons and other interneurons. Often, they form complex circuits that help you to react to external stimuli.

Which categories of amino acid would you expect to find on the surface of a soluble protein, and which would you expect to find in the interior? What distribution of amino acids would you expect to find in a protein embedded in a lipid bilayer?

Answers

Answer:

Polar and charged amino acid residues (the remainder after peptide bond formation) are more likely to be found on the surface of soluble proteins where they can interact with water, and nonpolar (e.g., amino acid side chains) are more likely to be found in the interior where they are sequestered from water.

Explanation:

The amino acids with POLAR and CHARGED side chains are expected to be observed on the membrane surface, whereas amino acids with NON-POLAR and HYDROPHOBIC side chains are expected to be found inside the lipid bilayer.

The lipidic bilayer is mainly composed of phospholipids.

Phospholipids have hydrophilic, polar phosphate heads facing out on each surface to interact with water and hydrophobic fatty acid tails facing each other inside the lipid bilayer.

The polar and charged side chains of amino acids are expected to be observed on the surface of membrane proteins because they can interact with water (H2O) molecules.

On the other hand, nonpolar side chains of specific amino acids are expected to be observed inside the lipid bilayer to interact with the hydrophobic fatty acid tails of phospholipids.

The polar amino acids include glutamine, glutamic acid, arginine, asparagine, aspartic acid, histidine, lysine, serine, and threonine.

Moreover, amino acids with hydrophobic side chains include leucine, isoleucine, glycine, alanine, valine and proline.

In conclusion, amino acid residues with POLAR and CHARGED side chains are expected to be observed on the membrane surface, whereas amino acids with NON-POLAR and HYDROPHOBIC chains are expected to be found inside the lipid bilayer.

Learn more in:

https://brainly.com/question/4535258?referrer=searchResults

What type of cloud is Cloud A? What kind of weather might you expect when you see clouds of this type?

Answers

Answer:

Cloud A is a cumulus cloud. When these fluffy, white clouds are in the sky, you can expect fair weather.

Explanation:

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Answers

Answer:

what I don't understand what is the Ctcagt

A repressor prevents
a. translation from occurring.

b. ribosomes from binding to mRNA

c. transcription factors from binding to DNA

Answers

I think it’s b ......

Explain how exercise and an active lifestyle can improve bone health
and bone density.

Include discussions of osteoblasts vs.
osteoclasts, osteoids, osteocytes, collagen, bone modeling, impact
and increased workload, glucocorticoid effects, mineral intake, or
underloaded bone.

Answers

Explanation:

explain how exercise and an active Lifestyle can improve bone health and bone density include discussions of

Higher energy contained in the sugar molecules produced by photosynthesis comes from
A. light
B. water molecules.
C. ΑΤΡ.
D. carbon dioxide molecules.

Answers

Answer:

A

Explanation:

light

ffjcddssdfghcxdsssswefgcfdd

Comes from the reduction of carbon dioxide molecules

Explain how photosynthesis and cellular respiration work together.

Answers

Answer:

photosynthesis converts carbon dioxide and water into oxygen and glucose. Glucose is used as food by the plant and oxygen is a by-product. Cellular respiration converts oxygen and glucose into water and carbon dioxide. Water and carbon dioxide are by- products and ATP is energy that is transformed from the process.

can somebody do 4 and 5 for me

Answers

Answer:

4. According to what is observed in the diagram, the maltose (substrate) binds to the maltase (enzyme) to obtain glucose molecules (product), in a process of hydrolysis of the maltose.

5. Three factors that can affect intestinal maltose activity - slowing it down or stopping it - are temperature, pH and substrate depletion.

Explanation:

4. Enzymes, such as maltase, have the function of making a reaction faster and decreasing the activation energy. Maltase is responsible for breaking down a maltose molecule, a dimer, into two glucose monomers, which is a hydrolysis reaction of the bonds that hold glucose molecules together.

5. There are several factors that can cause the decrease or cessation of the activity of an enzyme. Enzymes are activated when substrate is available and work best under ideal temperature and pH conditions. When there are alterations of these factors, the enzyme will reduce or stop the reaction in which it intervenes.

pH: when the pH increases or decreases it produces a decrease in the speed of reaction that catalyzes an enzyme. Very high or low pH levels can denature the enzyme and make the expected reaction not occur. Temperature: like pH, changes in temperature can slow or stop maltase activity. Substrate availability: It is a fact that when the specific substrate of an enzyme becomes depleted, the rate of reaction slows down, stopping when no substrate is available.

which best describes the results of mendels work with pea plants a) he figured out the fastest way to grow pea plants. b) he showes that pea plants do not pass traits to their offspring. c) he found the basic ideas about genetics. d) he discovered the scientific method.

Answers

Answer:

its C

Explanation:

Which types of mutations in the lac operon stop Escherichia coli from utilizing lactose as a carbon source? a) promoter deletion b) lactose-binding site mutation c) repressor DNA-binding site mutation d) operator deletion

Answers

Answer:

D.) repressor DNA-binding site mutation

Explanation:

lacl prevents the repressor polypeptide is a mutant that prevent operon from binding lactose, and thus will bind to the operator and be non-inducible.. This mutant will represses the lac operon whether lactose is present or not and the lac operon will not be expressed. It is also called“super-supperesor".

The lacI locus – One type of mutant allele of lacI (callled I-) prevents the production of a repressor polypeptide or produces a polypeptide that will not allow to bind to the operator sequence.

This is also a constitutive expresser of the lac operon because absence of repressor binding permits transcription.

What is the optimal pH for Enzyme B?

Answers

Answer:

6,7.77.0

Please correct Ok ?

Question 2 of 9

Corn seeds were germinated (grew and put out shoots after a period of dormancy) in a dark room

placed in the light, 75 of these seedlings turned green. Which conclusion about chlorophyll (the

plants can most reasonably be drawn from this information?

(1 point)

DA. Light is the only factor that controls the production of chlorophyll

.

B. Darkness is the only factor that prevents the production of chlorophyll.

IC Light and vitamins are necessary for chlorophyll production.

D. Light and some other factor are necessary for chlorophyll production.

----Page 2 of 9----

Answers

Answer:

The correct answer is option D.  Light and some other factors are necessary for chlorophyll production

Explanation:

By this experiment, it is clear that light is the major factor that helps in the production of chlorophyll in seedlings or plants. In this study, placing the seeds in the light turns 75 seedlings green which is possible by the production of the green pigment, chlorophyll only. So, it is proved that light is a key factor in the production of chlorophyll.

Besides light, there must be some other factors (mineral nutrition and chemical metabolites) that also play role in the production of chlorophyll or increase or decrease of the chlorophyll production as few seedlings did not turn green in the study.

A baseball is tossed into the air, forming an arc. Mark the following points:
1. Kinetic energy is the highest
2. Potential energy is the highest
3. Kinetic energy is converted in potential energy
4. Potential energy is converted into kinetic energy

Answers

Answer:

it is number 3 .............

Answer:

Kinetic energy is the highest when the baseball is in the air.Potential energy is the highest when the ball is about to be thrown.Kinetic energy gets converted to potential energy when the ball stops flying in the air and falls on the ground.Potential energy is converted into kinetic energy when the ball is thrown.

What methods would the body use to provide a
person with energy throughout a race?
DONE
C
Intro

Answers

Answer:

The methods the body would use to provide a person with energy throughout a race is using the ATP in the muscle cells for the first 3 seconds.

For the next 8 to 10 seconds, the body replaces the used ATP and produces more.

Within the next 90 seconds of the race, anaerobic respiration is used up to make more ATP (Adenosine triphosphate).

Therefore, during the whole process, the three energy systems used are:

the ATP-PC System

the Glycolytic system

the Oxidative system

Answer:

The methods the body would use to provide a person with energy throughout a race is using the ATP in the muscle cells for the first 3 seconds.

For the next 8 to 10 seconds, the body replaces the used ATP and produces more.

Within the next 90 seconds of the race, anaerobic respiration is used up to make more ATP (Adenosine triphosphate).

Explanation:

T/F Osmosis and diffusion are both examples of passive transport.
A.True
B.False

Answers

Both osmosis and diffusion are passive transport processes, meaning that no additional energy is needed for them to take place. In both diffusion and osmosis, particles move from an area of higher concentration to one of lower concentration.

The given statement "Osmosis and diffusion are both examples of passive transport" is True.

Passive membrane transfer methods are the most direct. Passive transport is a phenomena that happens spontaneously and doesn't require the cell to use energy to move. Diffusion is the process by which chemicals travel passively from a region of higher concentration to a region of lower concentration. A concentration gradient is a difference in the concentration of one substance throughout a physical region.Transport that is done passively is called diffusion. Until the concentration is the same across the space, a single substance has a tendency to travel from an area of high concentration to an area of low concentration.Based on the gradient of water concentration across the membrane, osmosis is the mechanism by which water diffuses through a semipermeable membrane. Osmosis moves just water across a membrane, and the barrier restricts the diffusion of solutes in the water, whereas diffusion distributes material across membranes and into cells.

Learn more about the passive transport with the help of the given link:

https://brainly.com/question/1619908

#SPJ1

For the last 30 years, human use of fertilizers has had a significant impact on the nitrogen

cycle. Which statement explains how fertilizers impact an ecosystem?

O Fertilizers increase the amount of fixed nitrogen available in the ecosystem.

O Fertilizers decrease the amount of nitrogen fixed by organisms living in the ecosystem.

O Fertilizers kill off important nitrogen fixing bacteria.

Fertilizers decrease the amount of fixed nitrogen available in the ecosystem.

Answers

Answer:

It's C

Explanation:

Hope this helped :)))

The fertilizers show a significant impact on the nitrogen cycle as the fertilizers kill off the important nitrogen fixing bacteria which are present in the soil. Thus, the correct option is C.

What is Nitrogen cycle?

Nitrogen Cycle is a biogeochemical process through which the nitrogen present in the environment is converted into many different forms, consecutively passing from the atmosphere to the soil to the living organisms and back into the atmosphere after decomposition. It involves several processes including the nitrogen fixation, nitrification, denitrification, decay and putrefaction of the nitrogen compounds.

Intensive fertilization of the agricultural soils of normal soil can increase the rates at which nitrogen in the form of ammonia is volatilized in the environment and lost to the air. It can also speed the microbial breakdown of ammonium and nitrates in the soil which results into enhancing the release of nitrous oxide. In addition to this, excessive use of fertilizers also kills the nitrogen fixing bacteria present in the soil.

Therefore, the correct option is C.

Learn more about Nitrogen cycle here:

https://brainly.com/question/1615727

#SPJ2

What affect do glass panels have on temperature google doc

Answers

Answer:

wdym

Explanation:

Which cell organelle is most responsible for ensuring that the cell obtains the necessary materials to maintain homeostasis?

Answers

Answer:

i’d say mitochondria

Explanation:

mitochondria is the “powerhouse of the cell”

4. When an offspring grows off from the body of a parent organism it is called __________________. *

a.fission
b.budding
c.fragmentation
d.sporulatioin

Answers

Answer:

Budding

Explanation:

It is asexual reproduction in which offspring grows out of the parents organisms.

In the process of budding, an offspring grows off from the body of a parent organism and buds off when fully matured. Thus, the correct option is B.

What is Asexual Reproduction?

Asexual reproduction is the type of reproduction only a single parent is involved. In this process, offspring are developed from a single parent called mother cell and these offspring are genetically identical to the parent hence are also called as clones.

During the process of budding which is a types of asexual reproduction, a new organism develops from an outgrowth or bud which is formed on the parent plant due to the cell division at a particular site on the parent plant. For example, the small bulb-like projections coming out from the yeast cell are the buds which give rise to new yeast organism.

 

Therefore, the correct option is B.

Learn more about Asexual Reproduction here:

https://brainly.com/question/4100787

#SPJ6

A colleague has used computer modeling to design an improved enzyme. To produce this enzyme, the next step is to:___________.
A) look for a bacterium that makes the improved enzyme.
B) mutate bacteria until one makes the improved enzyme.
C) determine the nucleotide sequence for the improved enzyme.
D) synthesize the gene for the improved enzyme.
E) use siRNA to produce the enzyme.

Answers

Answer:

C) determine the nucleotide sequence for the improved enzyme.

Explanation:

Computational enzyme design (CED) can be defined as a bioinformatic in silico approach used to model, construct, and enhance enzyme catalysis. CED uses complex optimization algorithms that enable to direct evolution by using computational systems. As a further step, after the modelization of optimal enzymatic activity, bioinformaticians require to determine the nucleotide sequences which will be subsequently used to synthesize the corresponding enzymes.

most bacteria reproduce by

Answers

Answer: Most bacteria rely on binary fission for propagation.

Explanation: Hope this helps have a great day!

Answer: Most bacteria reproduce by binary fission, also know as propagation.

1. Compare and contrast mitosis and meiosis. 2. What major event occurs during interphase?

Answers

Answer:

1.

contrast between mitosis and meiosis

Mitosis

- it takes place in somatic cells in multi cellular organisms in order to provide growth, however, in unicellular organisms it is reproductive division as well. is the means of reproduction in single-celled organisms. Other organisms use it for the growth of tissues (somatic cells)

- exact number of chromosome in offspring

- no recombination or crossing over

- no pairing found

- major phase: prophase, metaphase, anaphase, telophase

Meiosis

- takes place in sex cells to form gamete formation during sexual reproduction

- half of the chromosome number found in gametes of the parents thus, known as reduction division

- due to crossing over takes place recombination  found.

The pairing of chromosomes takes place

- major steps:

Meiosis 1 – prophase, Metaphase, anaphase, Telophase, and

Meiosis 2: Prophase, Metaphase, Anaphase, and Telophase

2. Interphase takes place prior to both mitosis and meiosis which is divided into 3 sub phases-G1, S and G2 phases.

The major events are as follows:

G1- RNA and protein synthesis takes place and cell grows in size

S- DNA replication takes place, Centriole duplication occurs and synthesis of histone proteins.

G2-  RNA and Protein synthesis continues.

help idk this answer ​

Answers

Answer:

d

Explanation:

What is the contour interval of this map?

Answers

Answer:bird creek

Explanation:

SOMEONE PLZ HELP!!!!!!!!!!!!!

Answers

Answer:

Eukaryotic cells probably evolved about 2 billion years ago. Their evolution is explained by endosymbiotic theory. Mitochondria and chloroplasts evolved from prokaryotic organisms. Eukaryotic cells would go on to evolve into the diversity of eukaryotes we know today.

Hope this helps.

Explanation:

Answer:

Eukaryotic cells :)

Explanation:

Genetic counselors work mostly with
1 school counselors.
2 researchers in genetic engineering.
3 elderly adults who live in care facilities.
4 couples who are planning to have children.

Answers

Answer: couples who are having children

Explanation:

I got it right on my quiz

Which of these will weigh the same after it has undergone a change?

A.) Paper being burned.

B.) Sugar water being evaporated.

C.) Two chemicals reacted to form gas.

D.) Ammonia added to steel wool to create heat.

Answers

i think the answer is D
A is the more formatted answer

What are internal structures?

Answers

Answer:

Internal structures are the inner pieces and parts that keep organisms alive, help them grow, and help them reproduce.

Explanation:

Which fossils provide information as to the mode of formation of an oxygen-rich atmosphere by about 2 billion years ago?

Answers

Answer:

The fossils that provide information on the formation of an oxygen-rich atmosphere are the stromatilites from the Precambrian era. These are layered and columnar fossils consisting mainly of cyanobacteria which were the original life form back then. These bacteria took in carbon dioxide and produced oxygen by photosynthesis as early as 2.5 billion years ago (the earth is about 4.5 billion yrs old).

Explanation:

Other Questions
Next, the bill goes to committee. what's your favorite color. will give brainlest if we have the same. just trying to give people easy ways to get points WILL GIVE BRAINLIST!!Of the Executive, Legislative and Judicial branches, which of these powers do you think are the most important and why? AdvantagesDisadvantagesof the bank of Montreal (bmo) Which of the following is NOT one of the five pillars of Islam?Pray dailypractice the 8 fold pathGive $ to the poor.Fast during the month of Ramadan Wendy is a single taxpayer with adjusted gross income of $92,300 for tax year 2019. She has rental income of $55,000 and rental expenses of $80,000. What can Wendy report on her tax return given this situation?a. She can deduct $10,000 because her rental expenses exceeded her rental incomeb. She can deduct $15,000 because her rental expenses exceeded her rental incomec. She can deduct $25,000 because her rental expenses exceeded her rental income Which points (0,6) (7,9) (2,3) go through the line 3x+2y=12 What is a feedback mechanism? Eathy was hungry so she sat on a pineapple MegaGlobal is a company that wants to issue publicly traded securities. In the past three years, it has issued over $2 billion in securities, and $1 billion of those securities are in the hands of the public. This very large enterprise: Which answer choice best describes 3x ?terms constant coefficientfactor Find the sample size required to estimate the percentage of college students who take a statistics course. Assume that we want 95% confidence that the proportion from the sample is within four percentage points of the true population percentage. Round the answer to the next larger whole number. helpp 20 points!!!!!!!!!!!! In a recent survey, 230 or 46% of the sample, said they usually ate fast food when they went out to eat. How many people were surveyed? How much money is collected in tolls if 55 two axle cars cross the bridge? Type your answer in acomplete sentence. no creo que ana venga, pero comprare mas pan_______A. Te echare de menos B. Por si las moscar C. Es el ombligo del mundo D. Estoy harta Let a function y represent the water level in a harbor measured in meters, and let x represent the number of hours since high tide. At time x = 0, the water level is 19.5 meters (a maximum). At time x = 6.26 hours, the water level is 10.5 meters (a minimum). The period of the function is 12.5 hours. After how many hours is the water expected to reach a depth of 17 meters for the first time? Round to the nearest tenth of an hour.A 2.2 hoursB 6.3 hoursC 12.1 hoursD 12.5 hours 2. Atoms of 160, 170, and 180 have the same number of What is made possible by a high concentration of auxins in a plant's shoot and roottips?a) hydrotropismb) thigmotropismc) phototropismd) gravitropism What is the equation of the graphed polynomial below?1y = (-x + 2)2(-x + 3) 3y = -(x + 2)2(x - 3)3y = (x + 2)(x - 3)2y = (x - 2)*(x - 3)2