which of the following is identical in a skin cell and a muscle cell from the same individual?
a. cellular shape
b. amount of ATP
c. genetic material
d. cell function​

Answers

Answer 1

Answer:

C

Explanation:

skin and muscle cells are similar in that they contain the same DNA


Related Questions

Why is ATP production Constant?

Answers

Regulation
It is vital that the level of ATP in cells remains constant, especially when the demand for energy increases. ... Although high levels of reactive oxygen species lead to cell death and disease, low levels of these species are important for regulating normal cell processes.

Can someone help me with this question please?

Answers

Answer:

B

Explanation:

They use echolocation (sound waves) because they cannot see the bottom of the ocean.

Good luck!

Which example has the most kinetic energy a football resting on a kicking tee a hurt football player sitting on the bench a football flying through a goal post a penalty flag on the ground

Answers

Answer:

The football flying through the goal

Explanation:

Kinetic energy is basiaclly moving energy. Since only the football going through the goal is moving, that's the one with the most kinetic energy.  

HELP ASAP EMERGENCY NEED NOW BRAINLIEST 100 POINTS!
A diagram showing two plates colliding, with one plate moving below the other. What type of plate boundary is illustrated in the image? What is the movement of one plate below another called?

Answers

Answer:

Convergent

Subduction

Explanation:

Answer:

B. convergent

C. subduction

Explanation:

A line passes through the points( -3,-4) and (6,2)

Answers

What are you asking? Slope? If so. You would do change in y over change in x. So subtract 2 and -4 to get positive 6, then subtract 6 and -3 to get positive 9. Your slope is either 1/3 if it’s increasing, or negative 1/3 if it’s decreasing.

Answer:

y = ⅔x - 2

Explanation:

We can solve for a linear equation of a line that passes through these two points by the elimination method and then substitute.

We simply write these two points in the form y = mx + c, where m is the gradient and c is the y-intercept (offset). So:

-4 = -3m + c

2 = 6m + c

____________ -

We can first eliminate c to solve for m and then substitute m back into either equation to solve for c. (See attached image for solving steps)

Then, we get:

m = ⅔

c = -2

so y = ⅔x - 2

A 10.0 cm3 sample of copper has a mass of 89.6 g. What is the density of copper?

Answers

Answer:

[tex]\boxed {\boxed {\sf d=8.96 \ g/cm^3}}[/tex]

Explanation:

Density can be found by dividing the mass by the volume.

[tex]d=\frac{m}{v}[/tex]

The mass of the copper is 89.6 grams.

The volume is 10 cubic centimeters.

[tex]m=89.6 \ g\\v= 10 \ cm^3[/tex]

Substitute the values into the formula.

[tex]d=\frac{89.6 \ g }{10 \ cm^3}[/tex]

Divide.

[tex]d=8.96 \ g/cm^3[/tex]

The density of copper is 8.96 grams per cubic centimeter.

Which cellular process breaks down simple sugars to release energy?
O A. mitosis
O B. photosynthesis
O C. respiration
O D. waste elimination

Answers

Answer:

C. respiration

Explanation:

if 28% of the bases in a DNA strand are guanine, what percentage are thymine

Answers

Answer:

22%

Explanation:

According to Erwin Chargaff in his complementary base pairing rule, a DNA molecule consists of four nucleotide bases that pair with one another in the follow order: Adenine (A) to Thymine (T), and Guanine (G) to Cytosine (C).

According to Chargaff, the amount of Adenine in the DNA equals the amount of Thymine while the amount of Guanine in the DNA equals the amount of Cytosine. The sum of all the bases equals 100%. That is;

A + T + G + C = 100%

In this question, if 28% of the bases in a DNA strand are Guanine, the amount of Cytosine will also be 28%. Hence,

28% + 28% + A + T = 100

56% + A + T = 100

A + T = 100% - 56%

A + T = 44%

Since, A = T

A/T = 44/2

A/T = 22%

Hence, the amount of Thymine in the DNA strand will be 22%

What process forms water vapor to turn into clouds?​

Answers

Answer:

condensation

Explanation:

The water cycle

evaporation--> condensation--> precipitation-->repeat

differences between reproduction in mammals and amphibians.​

Answers

Answer:

the answer is a little weird but hope this helps

Explanation:

While all of these animals reproduce sexually (meaning that the species consists of males and females and mating involves the fetilization of eggs by sperm), reptiles and mammals reproduce through internal fertilization (inside the female) whereas amphibians practice external fertilization.

Answer:

While all of these animals reproduce sexually (meaning that the species consists of males and females and mating involves the fetilization of eggs by sperm), reptiles and mammals reproduce through internal fertilization (inside the female) whereas amphibians practice external fertilization

Graves’ Disease is an autoimmune disorder that causes an overproduction of the hormone produced in the thyroid. These hormones are responsible for cellular metabolism. What would this disorder probably result in?

Answers

Answer:

Explanation:

Graves' disease is an autoimmune disorder in which antibodies produced by your immune system stimulate your thyroid to produce too much T4. It's the most common cause of hyperthyroidism. Hyperfunctioning thyroid nodules (toxic adenoma, toxic multinodular goiter or Plummer's disease).

Give the mRNA strand for the following DNA strand: ATACGATA
A. TATGCTAT
B. UAUGCUAU
C. TUTCGAUA
D. UATGCUAT

Answers

Answer:

every t is changed to u, the rest is the same.

Explanation:

B. UAUGCUAU

B) UAUGCUAU
B is going to be your answer

EASY 7TH GRADE SCIENCE FIRST PERSON MARKED BRAINLIEST!!!!

Which information does a student need to differentiate between the speed and the velocity of a vehicle in motion

A. The rate of the motion
B. The direction of the motion
C. The change in the amount of motion
D. The amount of distance traveled during motion

Answers

Answer: The action from a force can cause an object to move or can speed up accelerate, to slow down (decelerate), to stop, or to change direction. Since any change in velocity is considered acceleration, it could be said that a force on an object results in the acceleration of a object.

Explanation:

Answer:

(B) The direction of the motion

Explanation:

human rights violated when George Floyd was apprehended​

Answers

Answer:

tell me how to answer it

This is correct . True

What happens to red blood cells when placed in a hypotonic solution?

Answers

Hope this helps this is what I used when I studied this

What term describes the strings of ribosomes that are attached to an RNA transcript at one time?
A. release factors
B. spliceosomes
C. transcription factors
D. mutagens
E. polyribosomes

Answers

Answer:

Polyribosomes.

Explanation:

During translation, the subunits of a ribosome surround the transcript and read down stream until they reach the start codon and begin polypeptide synthesis. Once the start codon is exposed, it is available for another ribosome to form around it, thereby initiating another locale for translation. Together the strings of ribosomes are called polyribosomes.

When experiencing oxygen debt, why do human cells not carry out the process of alcoholic fermentation?

Answers

I believe the answer is because oxygen is a fuel/input/reactant to alcoholic fermentation.

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Answers

Answer:

u want step by step?

Explanation:

Spongy tissue is best described as dense smooth and homogenous
True or false

Answers

false, it’s compact

Which statement correctly describes transpires during a chemical reaction?

Answers

Answer:

Melting but if it is radiactional is evaporating

(2) Which of the following describes the movement of particles down/ with a concentration gradient and how ?
Question options:

a)

Osmosis

b)

active transport

c)

diffusion

d)

both osmosis and diffusion

Answers

Answer:

Both osmosis. And diffusion

Open Response 2 part A: Plant cells and fungal cells have many of the
same types of organelles. Structures X and Y are found in both plant cells
and fungal cells. Structure Z is found in plant cells, but not in fungal cells. A
- What is party?
X
Z

Answers

The answer will be z because u can dance and take the L on black kids

Which statement below does NOT correctly describe water's chemical
properties?

a. Water is a neutral substance - it is neither a base or acid

b. Water is an inert substance

c. Water is not flammable or combustible

d. Water is reactive and catalyzes many reactions that take place inside living things

Answers

Answer:

b.

Explanation:

This is incorrect, because, "water is a powerful accelerator of chemical reactions."

Credit to www.astronno.com

How do structures in organisms compare with structures of non-living things such has construction cranes, buildings, ships, airplanes, or bridges?

Answers

They all are able to break down

HELP!!! MAJOR GRADE!!!!!

Gregor Mendel conducted thousands of genetic experiments using pea plants. Mendel is called the Father of Genetics because it was these studies that lead to the principles of genetics. In one of his many experiments, he crossed purple-flowered pea plants with white-flowered pea plants. Much to his surprise, all of the offspring turned out to be peas with purple flowers in appearance.

Although Mendel used the term factors instead of genes, how did Mendel explain why all the pea plants had purple flowers and not a mixture of white and purple flowers?

A.The offspring received the factors (genes) from both parents, but the genotype for purple flowers dominated over white flower pea plants.

B.The offspring only received the factors (genes) from the parent with the genotype for purple flowers and nothing from the white flower parent.

C.The offspring received the factors (genes) from both parents, but the phenotype for purple flowers dominated over the factor for white flowers.

D. The offspring only received the factors (genes) from the parent with the phenotype for purple flowers and nothing from the white flower parent.

Answers

Answer:

A

Explanation:

The purple gene was dominant, so though the plants got "factors" from both parents, only the purple gene was expressed in their phenotype (purple petals).

Which best describes the process of insertion?

A.occurs when part of a chromosome breaks off and is placed into the middle of another chromosome

B.occurs when part of a chromosome breaks off and reattaches backward on the same chromosome

C.occurs when part of a chromosome breaks off and does not reattach

D.occurs when part of a chromosome breaks off and attaches to another chromosome

Answers

Answer:

A.occurs when part of a chromosome breaks off and is placed into the middle of another chromosome

Explanation:

Edge 2020

Answer:

A

Explanation:

EDGE2021 :-)

Have a nice day! ^-^

Blood has a lower concentration of hydrogen ions than cellular cytoplasm. What does that tell us about the pH?

Answers

Answer:Acids and bases In the human body, both blood and the cytosol (watery goo) inside of cells have pH values close to neutral. ... A base, in contrast, raises pH by providing hydroxide (OH −start superscript, minus, end superscript) or another ion or molecule that scoops up hydrogen ions and removes them from solution.

Explanation:

A yellow-skinned CHNOPS meets the blue-skinned CHNOPS of their dreams. They get married and have a green-skinned CHNOPS baby. What type of inheritance (Complete dominance, Incomplete dominance, or Co-dominance) is illustrated by this example? Pick the best answer with the correct justification
A.Complete dominance, because it blends
B.Incomplete dominance, because you see two traits
C.Co-Dominance - because it blends D.Co-Dominance, because you see two traits
E.Incomplete dominance, because it blends
F.Complete dominance, because you see two traits​

Answers

Answer:

uwiwiwuwwieh

Explanation:

Answer

co-dominance

recessive

Explanation:

100 on edge trust me!!

Christopher Columbus used the presence of suspended seaweed in the ocean to
determine how far away he was from the coast of the Africa. Seaweed, or kelp, is
placed under the Protista kingătom. What type of protist did Columbus see?
a)protozoa
b) slime mold
c) water mold
d) brown algae

Answers

Your answer is d he saw brown algae

Brown algae is the type of protist Columbus saw. Therefore, option (D) is correct.

What are brown algae?

Seaweed is a type of brown algae, which is a type of protist that belongs to the kingdom Protista. Brown algae are large, multicellular algae that grow in the ocean and are often found in shallow, warm waters. They have a complex structure and are made up of many cells that are organized into tissues and organs. Brown algae are photosynthetic, meaning they use sunlight to produce energy and nutrients, and they are an important source of food and habitat for many marine organisms.

Other types of protists include protozoa, which are single-celled, heterotrophic organisms that can move using cilia, flagella, or pseudopodia; slime molds, which are fungi-like organisms that can move and are often found in moist environments; and water molds, which are fungi-like organisms that can grow in water and can cause disease in plants and animals.

Learn more about brown algae, here:

https://brainly.com/question/8717436

#SPJ2

Which of the following is the most important reason to maintain a high level of cardiovascular health?
A. A higher level of fitness makes it easier to develop larger muscles.
B. A higher level of fitness makes you more attractive to other people.
C. A higher level of fitness allows you to live a longer, healthier life.
D. A higher level of fitness improves your IQ.

Answers

Answer:

C

Explanation:

I think because the more healthier you are, the longer you'll live

Other Questions
whats the preposition in the sentence. Throughout his audition, Manny Delgado made sure to keep smiling. It is acceptable to create two TCP connections on the same server/port doublet from the same client/port doublet. True False Thank you Ma'am. Compare and contrast the mood of both pieces. How did you feel while you were reading? How did you feel watching the video? Una parte de 25 000 dlares se invierte al 10% de inters, otra parte al 12 % y el resto al 16%. El ingreso anual total de las tres inversiones es de 3200 dlares. Adems, el ingreso de la inversin al 16% es igual al ingreso de las otras dos inversiones combinadas. Cunto se invirti a cada tasa de inters? During one week, a truck driver spent 51 hours driving 3,468 miles. Which rate best represents the relationship between the miles and the hours? A uniform electric field has a magnitude of 10 N/C and is directed upward. A charge brought into the field experiences a force of 50 N downward. The charge must be:_______. What divisive issue dominated the discussion of adding new states to the Union?O whether new states would be slave or free how much representation new states should have in Congresswhether new states should pay taxeshow many people would be allowed to settle in the new states? c)If the speed of the car is tripled, what will happen to the time taken? Read the Mexican governments Bustamante Decree of April 1830.Article 9. The introduction of foreigners across the northern frontier is prohibited under any pretext whatsoever, unless the said foreigners are provided with a passport issued by the agent of the republic at the point whence the said foreigners set out.Article 10. No change shall be made with respect to the slaves now in the states, but the Federal government and the government of each state shall most strictly enforce the colonization laws, and prevent the further introduction of slaves.What was the main reason the Bustamante Decree changed the minds of people who wanted Texas to become part of the United States? It complicated the balance of potential slave and free states in the United States.It showed that Mexico was prepared to defend its land against foreigners.It showed that Mexico was eager to take immigrants from the United States.It was a declaration of war since Mexico was trying to regulate US citizens. ABA+B+energystart text, A, B, end text, \longrightarrow, start text, A, end text, plus, start text, B, end text, plus, start text, e, n, e, r, g, y, end text Which best describes the reaction above? Choose 1 answer: Choose 1 answer: (Choice A) A It is a catabolic reaction. (Choice B) B It is a photosynthetic reaction. (Choice C) C It is an endergonic reaction. (Choice D) D It is an anabolic reaction. HELPPPPPPP!!!!!!!!!!!!!!What sources of data are used by demographers? Be sure to explain the information that each source provides to the demographer. If the domain is {0, 2,-6}, what is the range of y = -2x + 3? List all the nouns Women and men worked together to clear the land plant crops and build homes using the way of wealth Compare and contrast immaterialism with idealism Which statement correctly distinguishes the functions of lipids from other types of biomolecules? pls help will give brainlest Need help with statistics question please.25. Filling Bottles A certain brand of apple juice is supposed to have 64 ounces of juice. Because the punishment for under filling bottles is severe, the target mean amount of juice is 64.05 ounces. However, the filling machine is not precise, and the exact amount of juice varies from bottle to bottle. The quality-control manager wishes to verify that the mean amount of juice in each bottle is 64.05 ounces so that she can be sure that the machine is not over- or under filling. She randomly samples 22 bottles of juice and measures the content and obtains the following data: 64.05 64.05 64.03 63.97 63.95 64.02 64.01 63.99 64.00 64.01 64.06 63.94 63.98 64.05 63.95 64.01 64.08 64.01 63.9 63.97 64.10 63.98 (a) Because the sample size is small, she must verify that the amount of juice is normally distributed and the sample does not contain any outliers. The normal probability plot and box plot are shown. Are the conditions for testing the hypothesis satisfied? (b) Should the assembly line be shut down so that the machine can be re calibrated? Assume =0.06 ounces and use a 0.01 level of significance. (c) Explain why a level of significance = 0.01 of might be more reasonable than 0.1 [Hint: Consider the consequences of incorrectly rejecting the null hypothesis.] Mrs. Fekin bought herself a new water jug. The jug of water holds 64 ounces. If she drinks 4 ounces per hour, after how many hours will the jug have 32 ounces in it? Fill in the blank with the correct Imperfect Tense conjugation of the verb between parentheses.Marcos no (poder) salir a jugar con su primo.A. puedeB. pudaC. podasD. poda In 1941 us president franklin rosevelt called for the procreation of four freedoms?