Who's dad was in the navy in the lord of the flies?

Answers

Answer 1

Answer: Ralph?

Explanation:


Related Questions

choose on of the verbs in the list to report each of the remarks below. urge,beg,sugg
est,promise,recommend
I can't tell you how important it is for you to give up smoking
you have got to lend me the money!oh!plese,ples
why don't you paint the wall yellow?
I will buy you a bike if you pass grade xII​

Answers

1. I am urging you to give up smoking. It’s so important.

2. I am begging you to lend me the money!

3. I suggest you paint the wall yellow.

4. I promise I will buy you a bike if you get a passing grade.

Answer:

1. I can't tell you how important it is for you to give up smoking --> Urge

2. You have got to lend me the money!oh!please,please! --> Beg

3. Why don't you paint the wall yellow? --> Recommend

4. I will buy you a bike if you pass grade. --> Promise

Explanation:

The school band sold T-shirts to raise money for an upcoming trip. It sold 120 shirts, which was 30 percent of the total sales on Sunday. How many T-shirts did the band sell in all? Check all that apply.
The total sales will be greater than 120 shirts.
The total sales will be less than 120 shirts.
(30)(4) = 120, so 100(4) = 400 is the number of T-shirts sold.
120 divided by 30 = 4, so 120(4) = 480 is the number of T-shirts sold.
The band sold 400 total T-shirts.
The band sold 150 total T-shirts.

Answers

Answer:

A C and E

Explanation:

i just did the test

Answer:

A C E that is the anwser plzzz give me brinlist

Explanation:

Martin Luther King Jr. wrote "Letter from Birmingham Jail" to _____. Select all that apply. announce a boycott of all segregated businesses defend the use of nonviolent resistance prove that he was unlawfully detained address criticisms from members of the clergy

Answers

Answer:

Martin Luther King Jr. wrote the Letter from Birmingham Jail to defend the use of nonviolent resistance.

Explanation:

The Letter from Birmingham Jail is an open letter written by Martin Luther King Jr. in 1963. It's considered to be the most important document of the civil rights era. It invites people to fight for justice in a peaceful, nonviolent, manner, calling that their moral responsibility. According to King, people shouldn't wait for justice to come through the courts, but take things into their own hands. Otherwise, they may never defeat injustice.

Answer:

defend the use of nonviolent resistance

Explanation:

the role of an anchor​

Answers

Answer:

To hold the ship down :D

Or to deliver the news covering a certain area

Explanation:

To keep the ship from sailing away on its own

The Empire State Building is

located in Chicago and home to many banking companies.
located in New York City and an important historical landmark.
located in Dallas and the former home of a wealthy family.
located in Los Angeles and featured in many movies.

Answers

Answer:

ihbhiknlj

Explanation:

Answer:

B located in New York City in an important historical landmark

Explanation:

got it right in a test hope it helps and

have a good day

Which phrase best describes someone who is resolute in the story a Christmas carol A. timid and shy B. daring and bold C. firm and unwavering D. hesitant and uncertain​

Answers

Answer:

Your answer for this question might be D. I think. Please please get more help using quizzes.com. Take care.

The phrase which best describes someone who is resolute in the story a Christmas Carol is firm and unwavering. Thus the correct option is C.

What is the central idea of The Christmas carol?

The central idea of the story Christmas carol is the Struggle Between Happiness and Money. Increasing concern about capitalism's and the industrial era's financial incentives is reflected in the story.

The narrator uses time as a significant incentive for Scrooge's growth and transformation on purpose in the story Christmas carol. Scrooge is physically led through each memory, not just recalling it as he usually does.

The words resolute, unwavering, and unyielding are all synonyms for this one. A "resolute refusal" is a declaration that you don't like something and never will. It demonstrates unwavering loyalty.

Therefore, option C is appropriate.

Learn more about Central idea, here:

https://brainly.com/question/10881113

#SPJ6

According to the selection from The Future of the Mind, what was the most significant discovery the scientists made about Einstein’s brain?

a. His brain was quite normal.

b. His brain was larger than average.

c. His brain had features never seen before.

d. His brain had more neurons than were expected

Answers

Answer:

c

Explanation:

because he is smart

I promise I .................. study harder.
a) will
b) am going to may
c) must

Answers

Answer:

A.

Explanation:

Whale is 78 feet long. A rhinoceros is 13 feet long how mucher longer is the whale then the rhinoceros

Answers

Answer:

65 feet

Explanation:

do you trust me

The answer is: 65

Hope this helps!✌

Question 2 of 10
How is the resolution of Endgame different from a typical resolution in
drama?
A. It ends with all characters unable to speak.
B. The symbolism is not explained.
C. The dialogue fades out without stopping.
O D. The conflict is not resolved.
SUBM

Answers

D, the conflict is not resolved!

The resolution of Endgame different from a typical resolution in drama in that the conflict is not resolved. Therefore, option D is correct.

What is the message of Endgame by Samuel Beckett?

Through the utter despair that consists Endgame, Beckett paradoxically promotes an acceptance of our fate and guides us to value life in all its imperfections.

Characters in Samuel Beckett's Endgame, which is assumed to be antagonistic to story-telling, attempt to create or retell stories despite their obvious failures, difficulties, and objections.

Beckett can be considered a prominent absurdist playwright because his plays reflect these issues, and his play Endgame is a typical absurdist play that depicts the characteristics of this type of drama.

Thus, option D is correct.

To learn more about the endgame, follow the link;

https://brainly.com/question/14939063

#SPJ5

In The Land, Part 1, how does Paul try to stop Mitchell from bullying him?

Paul asks his brothers to talk to Mitchell.
Paul asks Mitchell’s mother to talk to her son.
Paul confronts Mitchell about their conflict.
Paul confronts Mitchell’s brothers about his behavior.

Answers

Answer:

a

Explanation:

edge 2021

Paul try to stop Mitchell from bullying him as he:

Option A

Paul asks his brothers to talk to Mitchell.

The Land, which accounts the transitioning of Paul-Edward Logan, is a prequel to Mildred D. Taylor's honor winning novel Roll of Thunder, Hear My Cry. Paul portrays his own story, which unfurls not just as an incrimination of race relations in post-Civil War Mississippi yet additionally as a moving.

Mitchell, the offspring of a sharecropper on the Logan house, is hardly more settled and fairly more noteworthy than Paul. He scorns seeing his exceptional accomplice and as needs be truly beats Paul whenever he can. Paul goes first to Cassie for appeal, yet he just deviants Cassie's proposition to talk with Mitchell.

Paul Edward, the now expired patriarch of the Logan family and spouse of Big Ma, purchased the bundle of land from a Northerner.

The Land follows Paul's life from one of the main minutes he understands the meaning of his  African-American foundation, to the second when he accomplishes his fantasy and secure himself as a proprietor of 200 sections of land.

For more information, refer the following link:

https://brainly.com/question/14734547

Find adverbs: yesterday my usually dependable truck would not start so I gratefully accepted a ride from my neighbor

Answers

Answer:yesterday usually not gratefully

Explanation:

Because the lost hiker had had no protection from the sun and wind, he was suffering 4 points
from
when he was found.
A hunger
B depletion
C exposure
D treachery

Answers

C
Exposure

That’s correct

Your team is struggling there have been missed goals more complaints and attendance issues you believe this is due to a decrease in team morale

Answers

Answer: I believe the team is lacking in teamwork and they might be depending on the team leader which the cause of missed goals and complaints.

Explanation:

The climax of ¨Wiley, His Mother, and the Hairy Man¨ occurs when
Wiley gets out of the tree without being hut by the Hairy Man.
The Hairy Man dissolves the ropes that are tying up the dogs.
The Hairy Man realizes that he stole a pig, not a human baby.
Mama tells Wiley that the Hairy Man will not hurt him anymore.

Answers

Answer:

The answer is number 3.

Explanation:

none

Answer:

C.

Explanation:

what is 65% of 80 help​

Answers

Answer:

52

Explanation:

65% of 80

=0.65 * 80

= 52

Answer:

52!

Explanation:

You can take 65% into a fraction, since it's a percentage. I made it into just 65/100. After you do that, simply multiply that by 80! The answer you end of with is 52.

I hope this helped!!

Join the two sentences with a suitable connector. You can write more than one sentence and you may have to change the sentences. (10 points)
Kate is allergic to chocolate. She ate a bit.=

The news arrive our homes. We are well informed.=


Peter went to the doctor. He wasn’t feeling well.=

Anne cried a lot. Her dog died.=


The pupils answered the test right away. They received the test.=

Dau coroana

Answers

1. Kate is allergic to chocolate but, she ate a bit
2 The news arrives at our homes and we are well informed.
3 Peter went to the doctor because he wasn’t feeling well.
4 Anne cried a lot after he dog died.
5 After reviving the test the pupils answered right away.

Answer:

Kate is allergic to chocolate but she ate a bit.

The news arrived to our homes and we are well informed.

Peter went to the doctor and he wasn’t feeling well.

Anne cried a lot as her dog died.

They received the test and the pupils answered the test right away.

Dau coroana

Hope this helps!

Select the correct text in the passage.
In this excerpt from H. H. Munro’s “The Open Window,” which line is an example of direct characterization?
“Here we are, my dear,” said the bearer of the white mackintosh, coming in through the window; “fairly muddy, but most of it’s dry. Who was that who bolted out as we came up?”

“A most extraordinary man, a Mr. Nuttel,” said Mrs. Sappleton; “could only talk about his illnesses, and dashed off without a word of good-bye or apology when you arrived. One would think he had seen a ghost.”

“I expect it was the spaniel,” said the niece calmly; “he told me he had a horror of dogs. He was once hunted into a cemetery somewhere on the banks of the Ganges by a pack of pariah dogs, and had to spend the night in a newly dug grave with the creatures snarling and grinning and foaming just above him. Enough to make anyone lose their nerve.”

Romance at short notice was her specialty.

Answers

The line that is an example of direct characterization is A most extraordinary man, a Mr. Nuttel,” said Mrs. Sappleton; “could only talk about his illnesses, and dashed off without a word of good-bye or apology when you arrived

What is direct characterization?

Direct characterization is the way an author or write use to describe or tell more about the characters involved in a direct or straight forward form without any form of bias.

Therefore, The line that is an example of direct characterization is A most extraordinary man, a Mr. Nuttel,” said Mrs. Sappleton; “could only talk about his illnesses, and dashed off without a word of good-bye or apology when you arrived

Learn more about direct characterization below.

https://brainly.com/question/1956203

#SPJ1


Which is the meaning of iconoclast in the paragraph?

Answers

Answer:

A person who attacks someone's beliefs or traditions.

Explanation:

Answer:

A person who attacks someone believe or culture

Mexico City has long been ranked among the world’s most polluted cities. The Mexican capital lies in a natural bowl surrounded by mountains, which trap air pollution. When pollution reaches critical levels, school and factory hours are changed to avoid exposing people to the worst of the pollution.

Recently, the city has been making a big effort to improve air quality. Vehicles are tested every six months to make sure the exhaust gases are within safe levels. City laws require motorists to leave their cars at home one day a week and use public transportation.

Read the passage carefully. Choose a connection a reader could make between the text and the world.

A.I would love to travel to El Salvador.
B.This reminds me of our town’s pollution problems.
C.This reminds me of a book I read about how schools are built.
D.I understand that it is important to travel around the world.

Answers

Answer:

B This reminds me of our town’s pollution problems.

Explanation:

Answer:the answer is bbbbbbbbbbbbbbbbbbbbb your welcome i got it right on edge 2020 my birthday is on dec 17 im turning 14

Explanation:

Is the word asked a action verb linking verb or auxiliary verb

Answers

Answer:  auxiliary verb

Explanation:

In “The Next Adventure,” how does Malik change from the time he finds out he’s moving to Japan to the end of
the story? Use specific details and evidence from the text to support your response. Your response should be one
to two complete paragraphs.

Answers

Answer:

At the beginning of the story he preferred to spend his time browsing social media, but at the end of the story he was more than ready for the next adventure.

Explanation:

Answer:

He was mad about leaving at first because he was leaving his home town and best friend. But once he got to his new home he slowly started opening up and going place with some new friends he met. He soon learns that it is not all that bad to see new place and meet new people. When it comes time to move again, his attitude had obviously changed because he said that he is ready for the next adventure.

Explanation:

Why is Nausicaa the only one of the girls who have the courage to talk to Odysseus?

Answers

Answer:

Nausicaa is the one who helped Odysseus

Explanation:

He has one in Nausicaa, the daughter of Phaeacian King Alcinous and Queen Arete, who are wise and just rulers. Nausicaa helps Odysseus when he begs for aid on the beach. Because of her help, Odysseus is eventually able to return home.

Cause:? Effect: Lemur population is declining

A: Lemurs have few pups.
B: Lemurs are being put in zoos.
C: Predators are killing off lemurs.
D: Forests, where lemurs live, are being destroyed.

Answers

Forest being destroyed :))

Which of the following is NOT a reason why Anne Frank’s family was in danger?

The Nazis were killing Jewish people in concentration camps.

The Nazis took over Amsterdam after the Frank family moved there.

Otto Frank had business connections in Amsterdam, in the Netherlands.

Anne Frank’s family was forced to hide from the Gestapo.

Answers

Answer:

C. Otto Frank had business connections in Amsterdam, in the Netherlands.

Explanation:

Otto Frank was Anne Frank's father, so obviously he would do everything in his power to protect his family, not put them in harm's way. Not to mention, his connections helped him and his family have contact with the outside world while they were living in the annex.

Why had her mother refused to leave to Palestine?

She didn't want to leave her parents.
She wanted to stay with her friends.
She was afraid to travel.
She thought it was a dirty country.

Answers

I don’t know if I don’t know the book/thing your reading.. :(

but I will guess,
-
she was afraid to travel

Hope this helps you bb :) , sorry if I’m wrong

All Nashville is a-chill! And everywhere, As wind-swept sands upon the deserts blow, There is, each moment, sifted through the air A powered blast of January snow. (5) O thoughtless dandelion! to be misled By a few warm days to leave thy natural bed Was folly growth and blooming over soon. And yet, thou blasted, yellow-coated gem! Full many hearts have but a common boon (10) With thee, now freezing on thy slender stem. When once the heart-blooms by love's fervid breath Is left, and chilling snow is sifted in, It still may beat, but there is blast and death To all that blooming life that might have been. (1916) The function of the dandelion in the poem is to: act as a symbol for humankind's relationship to nature indicate the possibility of new and fresh beginnings provide an opportunity to reflect on the feelings of lost love suggest a juxtaposition to the typical human experience symbolize the narrator's enduring admiration for nature

Answers

Answer:

The function of the dandelion in the poem is to:

C.  provide an opportunity to reflect on the feelings of lost love.

Explanation:

The poem we are analyzing here is "A January Dandelion" by author George Marion McClellan.

The dandelion mentioned in the poem is a symbol of lost love. According to the speaker, this dandelion was fooled by the weather and ended up blooming too soon. In the end, it was blasted by harsh winds and froze "on [its] slender stem." The flower represents what happens to us when we hastily fall in love only to lose it. "[T]here is death and blast," even if we can love again. The heart may still beat, but nothing will change the pain of having been broken:

When once the heart-blooms by love's fervid breath Is left, and chilling snow is sifted in, It still may beat, but there is blast and death

How would using a new conflict style affect the outcome

Answers

Answer:

In a dispute, it's often easier to describe how others respond than to evaluate how we respond. Each of us has a predominant conflict style. With a better understanding of the impact our personal conflict style has on other people, we can consciously choose how to respond to others in a conflict situation.

Competing

Value of own issue/goal: High

Value of relationship: Low

Result: I win, you lose

Competitors come across as aggressive, autocratic, confrontational and intimidating. A competitive style is an attempt to gain power and pressure a change. A competitive style can be appropriate when you have to implement an unpopular decision, make a quick decision, the decision is vital in a crisis or it is important to let others know how important an issue is to you – "standing up for your right." However, relationships can be harmed beyond repair or others may feel they have to use covert methods to get their needs met.

Accommodating

Value of own issue/goal: Low

Value relationship: High

Result: I lose, you win

Accommodators set aside their own needs because they want to please others in order to keep the peace. Smoothing or harmonizing can result in a false solution to a problem and can result in feelings ranging from anger to pleasure. Accommodators are unassertive and cooperative and may play the role of a martyr, complainer or saboteur. Accommodation is useful when admitting you are wrong or when you want to minimize losses to preserve relationships. However, it can become competitive – "I am nicer than you are" – and may result in reduced creativity and increased power imbalances.

Avoiding

Value of own issue/goal: Low

Value of relationship: Low

Result: I lose, you lose

Avoiders deliberately ignore or withdraw from a conflict rather than face it. Avoiders do not seem to care about their issue or the issues of others. People who avoid the situation hope the problem will go away, resolve itself without their involvement or rely on others to take the responsibility. Avoidance can be appropriate when you need more time to think and process, time constraints demand a delay, or the risk of confrontation is not worth what might be gained. However, avoidance is destructive if the other person perceives that you don’t care enough to engage. By not dealing with the conflict, this style allows the conflict to simmer, potentially resulting in angry or negative outbursts.

Compromising

Value of own issue/goal: Medium

Value of relationship: Medium

Result: I win some, you win some

Compromisers are willing to sacrifice some of their goals and persuade others to give up theirs, too–give a little, get a little. Compromise maintains the relationship and can take less time than other methods but resolutions may focus on demands rather than needs or goals. The compromise is not necessarily intended to make all parties happy or result in a decision that makes the most business sense, but rather ensures the decision is just and equitable, even if it causes a loss for both parties. Power is defined by what one party can coerce or get the other to give up. To split the difference, game-playing can result in an outcome that is less creative and ideal.

Collaborating

Value of own issue/goal: High

Value of relationship: High

Result: I win, you win

Collaboration generates creative solutions that satisfy all the parties’ concerns and needs. Collaborators identify the underlying concerns, test assumptions and understand the views of others. Collaboration fosters respect, trust and builds relationships. Collaborators address the conflict directly and in a way that expresses willingness for all parties to get what they need. However, collaboration takes time so if the relationship is not important it may not be worth the time and energy to create a win-win solution.

In any conflict ask, "Is my preferred conflict handling style the very best I can use to resolve this conflict or solve this problem?"

Explanation:

Identify the synonyms in the sentence.
Although many scholars have attempted to decipher the texts, no one has been able to deduce
their meaning
0/ 10000 Word Limit

Answers

Decipher and Deduce.

what changes have happened in your city recently?what would (wouldn't)you do if you were a mayor?​

Answers

For corona they implemented that you should only get tested if you are symptomatic if you were in an area where some people had it. I don't like that because some cases are asymptomatic I  believe as long as you were exposed you should be tested because that can help bring people infected down.

Other Questions
Who was the established groups in Postville before the in-migration? What were their expectations of each of the new groups Jeremy find the cost by adding the percents. 25% off of $60 is equal to 15% off of $60, then subtracting 10% from that cost is equal to . The two total costs are HELP!!BRAINLIEST AND 10 POINTS !! Complete the analogyREBEL : ORTHODOXY :: (A) nonconformist : convention(B) radical : revolution (C) soldier : combat (D) scientist : theory Which statement illustrates bias in scientific research?A zoologist publishes incomplete data on sloths which supports their original hypothesis and notes that more research is required.A botanist publishes data about plant growth that does not support their original hypothesis and is replicable.An ecologist publishes data funded by a construction company which supports their original hypothesis that an endangered animal's territory is not endangered.A microbiologist publishes data funded by the National Institutes of Health that does not support their original hypothesis. Help me please!!! I need a short letter, using basic or simple teems, words, vocabulary. I would like to be Cabinet member perspective. But Natives is also fine with me. Thanks. Please need help Choose the words that complete the following sentence.Direct quotes needaround them, or else it is considered(1 point)O quotation marks/summarizingO quotation marks/plagiarismO parentheses/summarizingO parentheses/plagiarism I love you. You are worth it. What does this quote mean? Thanks! Ayala is making salad dressing. She mixes oil andvinegar in a blender until a smooth consistency isformed. Explain whether this is a heterogeneous or ahomogeneous mixture and why. Help?Jessica must determine how many packages of cookies and cupcakes to buy for her family reunion. Jessica's mother has asked her to buy the same number of each type of item but no more than 100 of each. At the bakery, Jessica finds that cookies are sold in packages of 12 and cupcakes are sold in packages of 9.Use the drop-down menus to select the answers that make each statement true.The greatest number of packages that Jessica can buy is _ packages of cookies and _ packages of cupcakes. explain what happens when particles collide When a story is told from the _____, the narrator has full knowledge of all the characters. omniscient third-person point of view reliable first-person point of view unreliable first-person point of view limited third-person point of view The product of the ages of two adults is 572. Find their ages. Guys, I need help ASAP!! The standard deviation of the following data set is 0.31. 95% of the data would fall in which range?4.3, 5.1, 3.9, 4.5, 4.4, 4.9, 5.0, 4.7, 4.1, 4.6, 4.4, 4.3, 4.8, 4.4, 4.2, 4.5, 4.4Pr (3.88 X 5.12)Pr (2.67 X 5.33)Pr (4.19 X 4.81)Pr (3.57 X 5.43) ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut a student performed an experiment, using a cocktail peanut, before it was burned the peanut half weighed .353 g. After burning the residue weighed .016 g. The energy released by the conjunction increased the temperature of 200. mL of water in the calorimeter by 7.2 degrees Celsius. Calculate the mass of peanut consumed in the combustion. twice the sum of k and 9 is 4 The product of a number and -5 is at least 35. Write as an inequality. who killed the district judge during the revolutionary movementanswer in one sentence