your need to work out

Answers

Answer 1

Answer:

well i dont

Explanation:

i am happy with how i look


Related Questions

describe two new pieces of information between sociology and healthcare

Answers

Sociology is the study of social structures and human connections. The study of sociology covers a wide range of topics, including anything from crime to religion, the family to the state, racial and social class distinctions to shared cultural values, societal stability to drastic change in entire societies.

What is goal of sociology?

Sociology's goal is to understand how human activity and consciousness both shape and are shaped by surrounding cultural and social systems, uniting the study of these several fields of study.

Because it influences our ability to pursue our goals in life, lessens our pain and suffering, aids in preventing untimely death, and gives us the knowledge we need to make life plans, health care is a fundamental human benefit. No matter their financial situation, society has a duty to provide all of its members with access to a sufficient degree of care.

For more information regarding sociology, visit:

https://brainly.com/question/14363783

#SPJ2

The piece of information between sociology and healthcare has been the understanding of healthcare according to sociology, and funds to the healthcare in US.

What is sociology?

The sociology is given as the study of the relationships formed between the humans and the institutions. The aspects of sociology have been used in the relation to varying states and departments.

The new information between the sociology and healthcare can be given with:

The sociology considers the casual social relations governs the health of the individual and the society.

The healthcare funding in the US has been found to be accounted to 17.9% of the GDP, forming a relation with the social effects.

Learn more about sociology, here:

https://brainly.com/question/4120495

#SPJ2

When wheat is served as a whole grain, it is generally in the form of

grits.
bulgur.
Arborio.
porridge.

Answers

Answer:

I think the right answer should be porridge

Answer: bulgur

Explanation: when wheat is served as a whole grain, it is generally in the form of bulgur.

hope it helps!

Assuming that everybody is heterosexual unless proven otherwise is a consequence of:

Compulsory hetersoxuality


Homonormativity


Intersectionality


None of the above

Answers

Answer:

Homonormativity is the answer

Answer:

homonormativity

if every body is heterosexual it then become a very dead consequences for homosexuality

What book is the Giver

Answers

The Giver is a 1993 American younger grownup dystopian novel by using Lois Lowry. It is set in a society which at first seems to be utopian however is printed to be dystopian as the story progresses. The novel follows a 12-year-old boy named Jonas.

Answer: The novel forms a loose quartet with three other books set in the same future era, known as The Giver Quartet: Gathering Blue (2000), Messenger (2004), and Son (2012). The Giver is a 1993 American young adult dystopian novel by Lois Lowry. It is set in a society which at first appears to be utopian but is revealed to be dystopian as the story progresses. The novel follows a 12-year-old boy named Jonas

Choose foods that limit the intake of: (4 points)
a: saturated fats and trans fats
b: added sugars and salt
c: alcohol
d: all of the above

Answers

Answer:

d. All of the above I think

You would need to limit the intake of all of these so D.

Afferent pathways send information from the site of the problem to which body system? O A. Central nervous system B. Muscular system O C. Skeletal system D. Respiratory system​

Answers

Answer:

A

Explanation:

the awnser is A

there ya go

Answer:

Central nervous system

Explanation:

How does blood flow starting from the left atrium

Answers

Answer:

wow so hard,but i will help you

I’m pretty sure it is the left ventricle.

hey, remember don't work too hard :) you got this! have a nice day/night :))​

Answers

Answer:

Explanation:

thank you! We all needed this reminder that sometimes it's okay to take a break and relax!

Haha thanks you too :)

please answer all of this please!!...​

Answers

Answer:

Physical Wellness, Emotional Wellness, Intellectual Wellness, Social wellness, and  Spiritual Wellness. I only know the first 5 answers but I hope it helps

_____________are high in calories but provide no essential vitamins and minerals. A. Proteins B. Simple carbohydrates C. Fats D. Complex carbohydrates

Answers

Answer:

fats

Explanation:

Becky is a nurse at a hospital that uses a table to keep track of when patients
are given medication. All patients on a floor are listed in the rows, and the
medication and time of administration are listed in the columns. Why might
Becky have empty cells in the table?
O A. If a patient is discharged, his or her name is still included in the
table, but Becky would not record any information.
O B. If a patient has been receiving the medication for at least one
month, Becky would no longer need to record the information.
C. If a patient is not on any medications, there would be empty cells
next to the patient's name.
O D. If a patient takes medication at the same time every day, Becky
would only record the time once and then leave the rest of the
cells empty.

Answers

Answer:

C

Explanation:

It's pretty obvious

What exercise can you do to strengthen your Deltoids?

calf raises

jump squats

shoulder press

lunges

Answers

Some jump squats prolly .

As a healthcare provider,how would you respond to this situation:

A soccer player dribbling the ball gets tackled by the opponent illegally and
causes a significant laceration to their knee. The athlete is bleeding profusely
from the wound.

Help

Answers

Answer:

I would quickly find some bandage and apply pressure to the wounded knee. I would then keep the player at the correct angle to stop the bleeding for a short time period and then call 911.

Sorry if this isn't correct, I'm a ninth grader and just thought of this.

Explanation:

Which element on a treatment plan is the most likely to describe what the provider will be doing during the episode of care

Answers

Answer: Objective

Explanation:

The element on a treatment plan that is the most likely to describe what the provider will be doing during the episode of care is "objective".

The objectives in a treatment plan simply refers to the steps or activities that are taken by an individual in order to reach his or her goal. The objectives explain what the individual is expected to do during the treatment.

THIS IS FOR MEDICAL TERMINOLOGY PLS HELP!!!:
The suffix that means pain is:

A. -rrhagia.

B. -oma.

C. -algia.

D. -spasm.

Answers

C. -algia
It means all sorts of pain and has it written at the end
For ex: nerve pain, joint pain, muscle pain etc.
The answer is c)alguna

It’s actually science but pls help I really need help I will mark brainliest just pls

Answers

penny = compound
water = element


i think

Answer:

Penny: Element - Water: Compound

Explanation:

Which is a short-term effect of sexual harrasment? (EDGE2020)

-low self-image
-discomfort with intimacy
-regressive behaviors
-self-destructive behaviors

Answers

Sexual harassment ranging from name calling and inappropriate flirting, all the way to sexual misconduct, can have major negative consequences on both male and female mental health.

Short term, I would say A, low self image and self esteem. A seems to be the best answer.

To help you create a healthier eating style, which of the following suggestions should you follow? (4 points)
a: focus on fruits
b: vary your veggies
c: make half your grains whole grains
d: all of the above

Answers

Answer:

D) All of the above

Explanation:

Fruits, veggies, whole grains, and other grains in general, are all part of a healthy diet.

All of above because everything listed is part of a healthy diet

Loss of __________ is a key indicator of heat stroke.

Answers

Answer:

headache

Explanation:

It's a key indicator of heat stroke

In terms of the amount of people that are obese, the United states is ____
out of 200. *

1
16
200
36

^ Those are your options to pick from.

Answers

Answer:

36

Explanation:

What are the two main types of defense taught in basketball?
Man, and Zone
Man to Man, and Individual

Answers

Answer:

Man and Zone

Explanation:

I play basketball and was captain, this is correct trust me

Allison wants to prepare oatmeal porridge for breakfast arrange the steps that she should take to prepare this recipe in the correct spaces

Answers

Answer:

Steps are present below.

Explanation:

Step 1: Add one cup of Oats to the saucepan.

Step 2: Add two cups of Water to the saucepan according to the oats quantity.

Step 3: Boil them for sometime and continuously stir with the help of spoon.

Step 4: Add little amount of Salt  to the porridge.

Step 5: Simmer and Stir until the porridge is ready.

Answer:

1. add water or milk

2. heat water or milk until boiling

3. add oats

4. stir and cook oats

5. allow oats to turn soft

6. cool

Explanation:

Water makes up what percent of the human body’s weight

Answers

Answer: 60 %

Explanation:

Based on research it's 60% of the human adult body that's water.

Which changes occur in females during puberty?
A) Acne clears up.
B)The hips narrow.
C)Underarm hair grows.
D)Body hair thickens.
I can only pick one, I feel like it could be all of them but A so idk

Answers

if you have to pick one

then may b option (D) is correct

Answer:

I think the best answer is C

Explanation:

Of course it isn't gonna be A, if anything it'll be the opposite. It could be B, but the doesn't necessarily have to do with puberty. It could be D, but that doesn't necessarily have to do with puberty either. And C I know for a fact happens after puberty. Good luck!

A person's observable physical or behavioral characteristics are the ____.

Answers

Answer:

A persons observable physical or behavioral characteristics are the same as their phenotype.

Explanation:

The patient has a A in temperature of 4°F above her
original measurement that was afeb 2 hours ago. There
is pain in the LUQ. MRI is scheduled today at 1430.

Answers

Answer:

The temperature of a patient is measured every 6 hours at 6 AM, 12 PM, 6 PM, and 12 AM. Which temperature reading is expected to be low due to a normal variation? a. The measurement at 6 AM b

Explanation:

srry if you dont get it right

List one specific species of nematode (roundworm) that causes zoonotic disease. Describe the clinical symptoms associated with that species.

Answers

Answer:

Disease: Toxocariasis Causative organism: Roundworm

Symptoms: live worm in your stool, wheezing, cough, fever, severe abdominal pain, vomiting, restlessness, disturbed sleep.

Explanation:

Which of the following techniques creates the smallest chopped vegetable?

Slicing
Dicing
Mincing
Julienning

Answers

Mincing or julienning
The correct answer is mincing

Will give 5 points for answering these questions....Help please

Answers

humans: legs, walk
bird: wings, fly
insect: legs or wings, fly or walk
fish: fins, swim
1 birds: wings :fly
2:human: muscles :strength
3: fish: scale:swim
(Can I have Brainlyist?)

What would you do differently next time you encountered the same symptoms that you encountered in this lab?

Answers

Answer:

I would not do anything differnetly.

Sincerely,

Bob the Goldfish

Explanation:

Plz mark as Brainliest!

What were the symptoms you encountered in this lab?
Other Questions
Which statement illustrates bias in scientific research?A zoologist publishes incomplete data on sloths which supports their original hypothesis and notes that more research is required.A botanist publishes data about plant growth that does not support their original hypothesis and is replicable.An ecologist publishes data funded by a construction company which supports their original hypothesis that an endangered animal's territory is not endangered.A microbiologist publishes data funded by the National Institutes of Health that does not support their original hypothesis. Help me please!!! I need a short letter, using basic or simple teems, words, vocabulary. I would like to be Cabinet member perspective. But Natives is also fine with me. Thanks. Please need help Choose the words that complete the following sentence.Direct quotes needaround them, or else it is considered(1 point)O quotation marks/summarizingO quotation marks/plagiarismO parentheses/summarizingO parentheses/plagiarism I love you. You are worth it. What does this quote mean? Thanks! Ayala is making salad dressing. She mixes oil andvinegar in a blender until a smooth consistency isformed. Explain whether this is a heterogeneous or ahomogeneous mixture and why. Help?Jessica must determine how many packages of cookies and cupcakes to buy for her family reunion. Jessica's mother has asked her to buy the same number of each type of item but no more than 100 of each. At the bakery, Jessica finds that cookies are sold in packages of 12 and cupcakes are sold in packages of 9.Use the drop-down menus to select the answers that make each statement true.The greatest number of packages that Jessica can buy is _ packages of cookies and _ packages of cupcakes. explain what happens when particles collide When a story is told from the _____, the narrator has full knowledge of all the characters. omniscient third-person point of view reliable first-person point of view unreliable first-person point of view limited third-person point of view The product of the ages of two adults is 572. Find their ages. Guys, I need help ASAP!! The standard deviation of the following data set is 0.31. 95% of the data would fall in which range?4.3, 5.1, 3.9, 4.5, 4.4, 4.9, 5.0, 4.7, 4.1, 4.6, 4.4, 4.3, 4.8, 4.4, 4.2, 4.5, 4.4Pr (3.88 X 5.12)Pr (2.67 X 5.33)Pr (4.19 X 4.81)Pr (3.57 X 5.43) ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut a student performed an experiment, using a cocktail peanut, before it was burned the peanut half weighed .353 g. After burning the residue weighed .016 g. The energy released by the conjunction increased the temperature of 200. mL of water in the calorimeter by 7.2 degrees Celsius. Calculate the mass of peanut consumed in the combustion. twice the sum of k and 9 is 4 The product of a number and -5 is at least 35. Write as an inequality. who killed the district judge during the revolutionary movementanswer in one sentence Quick question for you all People who complain that video games involve too much sitting are probably old. They probably dont know very much about gaming, either. They dont realize that people can play virtual sports, such as tennis, on video games. There are video games for dancing, too. If people bothered to learn about the different kinds of video games, they would see how wrong they are. This students sample paragraph addresses the counterclaim. Critique this paragraph by answering the questions.What is the counterclaim?Video games are too violent.Video games make people inactive.Video games are different today.What evidence weakens the counterclaim?People who complain are old.Sitting too much is bad for people.There are video games for sports and dancing.What is the tone of the rebuttal?respectfulrudehumorous Mention the type of seeds that undergo hypogeal germination.What do we call the process of permanently stopping babies from breast feeding?plzz help it is due today 2) look closely at article XLVII. Rephrase it in your own words. How do you think this impacted the unity among slaves during the revolution?Please I need help!