A red blood cell is 7.5 µm in diameter. It is magnified 2000 times. Calculate the diameter of the image seen through the microscope in millimetres.

Answers

Answer 1

Answer:

15 mm

Explanation:

Given that,

The diameter of a RBC = 7.5 µm

It is magnified 2000 times.

We need to find the diameter of the image seen through the microscope in millimeters.

The size of the diameter is given by :

[tex]d=2000\times 7.5\\\\=15000\ \mu m\\\\or\\\\d=15\ mm[/tex]

So, the diameter of the image seen through the microscope is 15 mm.


Related Questions

When there are more molecules, there will be less energy.

Answers

The more molecules move the more kinetic energy they have. I hope that helped
Energy, potential energy, is stored in the covalent bonds holding atoms together in the form of molecules. This is often called chemical energy. Except at absolute zero (the coldest temperature it is possible to reach), all molecules move. This movement is a form of kinetic energy, and the more the molecules move the more kinetic energy they have. Molecules in solids don't move much, they just vibrate. Molecules in liquids move faster and further, but they stick together enough to hold them in a small volume - the liquid. In a gas, however, the molecules are moving fast (over 1,000 miles per hour), moving in all directions, and don't stay together so they spread out and fill the available volume.

Which of the following statements is true? The shape of DNA is a triple helix. DNA mutations never affect an entire chromosome. Mutations in egg and sperm cells are inherited by offspring. Reginald Punnett discovered patterns of inheritance during pea plant experiments.​

Answers

Answer:

Reginald Punnet discovered patterns of inheritance during pea plant experiments

Explanation:

is there more than one right answer

✧・゚: *✧・゚:*  Answer:  *:・゚✧*:・゚✧

✅ Reginald Punnett discovered the theory of incomplete dominance during flower experiments.   ~ ₕₒₚₑ ₜₕᵢₛ ₕₑₗₚₛ! :₎ ♡ ~

Which part of human blood transports homones and
nutrients?

Answers

Plasma!


Hope that helps you out
Plasma carries water, salts and enzymes. Plasma takes nutrients, hormones, and proteins to the parts of the body that need it.

Scientists find the fossilized remains of a fish in the middle rock layers of a research site. They find the fossil of an insect in the lowest rock layers.
What can be concluded from this evidence?

A. the insect lived before the fish

B. the insect lived on the bottom of the ocean that the fish lived in

Answers

It is A I think the insect lived first and so it is under because it is under a different layer so if they were around at the same time and the fish was just under water it would be in the same layer of rock but because it is different rock it was not around at the same time

Can the change in cyclin concentration during mitosis be explained by the fact that the cell divides in two and thus divides the material in the cell into two smaller volumes

Answers

Answer:

No, because cell division is expected to decrease not only the net amount of cyclin molecules in daughter cells but also the volume of these daughter cells compared to the original parent cell, and therefore the concentration should be nearly equal.

Explanation:

When a cell divides to produce two daughter cells, the cell components including its previously duplicated genetic material (DNA), organelles, signaling molecules, fatty acids (lipids), proteins, etc., are distributed into daughter cells. These daughter cells have a smaller volume compared to the original parent cell. In consequence, the concentration of cellular components (including cyclin proteins) should be similar between parent cell and daughter cells.

Where are the photoreceptors located inside a human eye?​

Answers

Explanation:

retina

photoreceptor; rod and cone

Rods and cones are photoreceptive cells located in the retina of the eye.

PLEASE HELP 47 POINTS ASAP

There is an amusement park based on sea life. Its purpose is to get the public interested and caring about conservation of the world’s oceans. Some of the profits from this organization go toward funding ocean research and conservation. In order to get people interested, some of the shows that the park offers include large marine mammals that do tricks. Some of the larger marine animals are housed in pools for viewing instead of being allowed to live in their natural habitat. They also have rare and endangered species on display to help increase awareness of them. They even have a breeding program for the some of the endangered animals.

Describe an ethical concern that would be related to this park.

Answers

Answer:

The animals don't know outside of that habit because that where they were born. If they were to be released they would die because they are not used to having to fend for themselves.

Explanation:

Empathy means that you can communicate well with others.
A.
True
B.
False

Answers

Answer:

A. true

Explanation:

i mean if you have empathy then yeah it's true

Answer:

A

Explanation:

It means you have the ability to feel what someone is experiencing.

Help me on this question please.

Answers

Answer:

The answer would be D because, stars have nothing to do with the water cycle.

answer:

the stars appearing to move through the night sky.

- so option D.

1. Which of the following statements best describes heredity in organisms that
reproduce sexually?
A. All four offspring received all of their genetic information only from Parent 1 and
are therefore identical to that parent
B. All four offspring received all of their genetic information only from Parent 2 and
are therefore identical to that parent.
C. All four offspring are genetically unique and did not receive any of their genetic
information from either parent.
D. Each of the offspring is genetically unique and received some of its genetic
information from each parent, so each has some traits in common with each
parent.

Answers

For me, the best answer would be D

Answer:

[tex]\huge\boxed{\sf Option \ D}[/tex]

Explanation:

While reproducing sexually, The zygote receives half of the gametes of male organism while half of the gametes of female organism. This constitutes to the total number i.e. 46 chromosomes.

While the zygote receive half from male and half from female, This means that the offspring produced by the zygote will have both the characteristics in common of the male as well as female. Remember that, Chromosomes contain gene which are particularly responsible for characteristics.

So, Each of the offspring is genetically unique and received some of its genetic  information from each parent, so each has some traits in common with each

parent.

[tex]\rule[225]{225}{2}[/tex]

Hope this helped!

~AH1807

Explain how the structure of DNA is important in the synthesis

Answers

Answer:

DNA is the primary genetic material contained within your cells and in nearly all organisms. It's used to create proteins during protein synthesis, which is a multi-step process that takes the coded message of DNA and converts it into a usable protein molecule.

Explanation:

Are you for, against or undecided on GMOs? Explain.
Please give your opinion <3

Answers

Answer:

AGAINST for sure

Explanation:

ive personally raised GMO animals and they have no life. like chickens at the age of 8 weeks the breasts on GMO chickens are so large they are unable to walk and if u do not butcher them they will have heart attacks at around 9 weeks. they also dont get to go outside and walk around bc that makes them lose weight. so most of the GMO chickens do not get to go outside and actually have clean air. let alone see the sun light and stand in grass.

Which molecule in the equation represents food energy made by plants? A Carbon dioxide B Water C Glucose D Oxygen

Answers

Answer: Glucose

Explanation: Photosynthesis is a set of chemical reactions that uses energy from the sun and carbon dioxide to produce sugar and oxygen. The sugar provides plants with energy to grow.

Which is a step of the scientific method in environmental science? A. Testing a hypothesis B.Carrying out research C.Collecting ideas from boocks is a step in the scientific method. The step that follows this step involves forming A.a judgment B.a conclusion C .notes .

Answers

Answer:

The correct answer is Option B (Carrying out research). The step that follows this step involves forming B.a conclusion

Explanation:

The Natural environment  around us is a function of both the living things and the non-living things. So, environmental science is the study of the natural environment around us. This study includes how to tackle environmental problems and further study on how humans could be impacted by the interactions with their environment. The scientific method is a step taken towards ensuring development in a field by bringing new discoveries and challenging existing beliefs through scientific tests and research. Generally, for most scientific methods of many fields, it starts with:

1. Observations

2. Making inquiry which involves asking questions

3. Forming a hypothesis, which means making untested assumptions

4. Conducting an experiment to check the hypothesis

5. Analyze the results

6. Publish the results

The correct answer is Option B (Carrying out research). Because it involves the scientific method highlighted above. The step that follows this step involves forming B.a conclusion

A change in DNA could alter the amino acid order which will affect the folding of the protein, and therefore it's function.

Answers

Answer:

true

Explanation:

Difference between second level consumer and third level consumer

Answers

Answer:

Second-level Consumers - consumers that get their energy from first-level consumers and/or producers. Carnivores - organisms that eat only other animals. Third-level Consumers - consumers that eat second-level consumers and/or first-level consumers.

What is a daughter cell?

Example: "When a cell in the body divides, it will pass on a copy of its DNA to each of its daughter cells."

Answers

Answer:

Explanation:

Daughter cells are produced after a single cell undergoes cell division. During mitosis, one pair of daughter cells is created after one round of DNA replication. In mitosis, a single cell becomes two identical cells. ... Daughter cells in this sense are actually closer to clones

Two rabbits have different parents. One rabbit has ears that flop over, and the other rabbit has ears that stand straight up. Why do the rabbits have ears with different shapes?

Answers

Answer:

The rabbits have different versions of the gene for ear shape, which instruct for different proteins that make differently shaped ears. A Father sheep has curly wool while a Mother sheep has straight wool.

Explanation:

I majored in Biology

Answer:

Explanation: Each rabbit has a different ear shape because they have different versions of the gene for ear shape that connect together to make different ear shapes. - D

At a warm front warm air meets and moves cold air

Answers

what? what u need?!!!!

Matter and energy always flow from the
in ecosystems.
A. consumers to the producers
B. heterotrophs to the autotrophs
C. autotrophs to the consumers

Answers

Answer: When organisms use organic matter for cellular respiration, ALL the goes back into carbon dioxide, water, and minerals, while ALL the energy leaves the ecosystem as heat. So matter cycles, energy flows through ecosystems. So It is C

Explanation: A. The producers generate food for themselves and others; consumers do not produce anything, instead eating producers, other consumers or both.

B. Autotrophs make food for their own use, but they make enough to support other life as well.Heterotrophs cannot make their own food, so they must eat or absorb it.

So C is correct

Matter and energy always flow from the in ecosystems from autotrophs to the consumer.

What is ecosystem?

The energy flow in the ecosystem is one of the important factors that enables the survival of such a huge number of animals. An ecosystem is made up of a network of connections between living and non-living elements.

All of the energy needed by living things is provided by the sun. About 1% of all radiant energy is absorbed by green plants and distributed throughout the ecosystem.

According to the first law of thermodynamics, energy cannot be generated or destroyed. The energy source, in this case solar energy, cannot be created or destroyed. It can only be moved from one system to another, just like a form is moved from one form to another.

Therefore, Matter and energy always flow from the in ecosystems from autotrophs to the consumer.

To learn more about energy, refer to the link:

https://brainly.com/question/1932868

#SPJ2

Please help me guys!!
Look at the number of deer in “predation” and “starvation” columns. What conclusions can you draw about the introduction of the wolves on these values?

Answers

Answer:

This is because when the wolves preyed on the deer, their population got regulated. Due to this, the competition for resources amongst the surviving deer population got reduced resulting in low starvation.

This is because the deer's numbers were controlled when wolves preyed on them. As a result, there was less rivalry for resources among the remaining deer population, which led to decreased hunger.

"Predation" and "starvation" are both ecological concepts related to the interactions and dynamics of populations within ecosystems.

Predation is a biological interaction in which one organism, called the predator, hunts, captures, kills, and consumes another organism, known as the prey. Predation is a common relationship in nature, observed across various taxa, such as carnivores hunting herbivores or parasites feeding on host organisms.

Starvation refers to the condition in which an organism suffers from a lack of sufficient food or nutrients required for its survival and normal functioning. When resources become scarce or unavailable, individuals within a population may not obtain enough food to sustain themselves.

Therefore, there was less rivalry for resources among the remaining deer population, which led to decreased hunger.

For more details regarding "Predation" and "starvation", visit:

https://brainly.com/question/17407899

#SPJ6

I don’t understand how to do this

Answers

Answer:

Translation: GAUGCUUCCAACGACCACTA

Transcription:

GTACGAAGGTTGCTGGTGAT

GATGCTTCCAACGACCACTA

Explanation:

What is the difference between plastic CONSUMPTION and plastic WASTE?

Answers

Answer:

plastic consumption is like using a lot of plastic and plastic waste is when you throw out a lot.

Explanation:

consumption means like eating /using

waste means throwing out / not really using

hope this helped. btw I'm not sure if this is right but I hope it is!

3. Scientists who study the cell cycle use fluorescent dyes and lasers that enable them to measure the DNA content of individual cells. They can count the number of cells with 2N and 4N DNA content, as well as in between 2N and 4N (greater than 2N, but not quite 4N yet). a. In what phase(s) of the cell cycle will cells have 2N DNA content

Answers

Answer:

G1 phase

Explanation:

The cell cycle is divided into 2 major phases

1. The interphase

2. The m phase

The interphase, in chronological order, is further subdivided into

G1 phaseS phaseG2 phase

Cells grow and develop at the G1 phase while the G2 phase is characterized by protein synthesis in addition to continued growth.

The DNA of a cell in interphase is doubled at the S phase. This means that if a cell has a 2N amount of DNA at the beginning of the S phase, the amount of DNA at the end would have become 4N. This amount of DNA is shared into 2 daughter cells in equal amounts during mitosis or the m phase, meaning that each daughter cell would have a 2N amount of DNA before entering the interphase.

Hence, cells will have 2N DNA content in a period that spans through the end of the m phase of the cell cycle to the beginning of the S phase of the same cycle. This means that cells at the G1 phase would be the ones with 2N DNA contents.

Cell grows and prepare itself for replication in the G1 phase cell cycle. In G1 phase of cell cycle, cell is in 2n state.

Cell Cycle:

Cell cycle is the life cycle of the cell in which cell grow and divide. This completes in 2 phases,

InterphaseM- phase

Interphase:

Cell grows in this phase and prepare to divide. This includes 3 phases,

G1 phase In this phase cell, grow and prepare for replication.S- phase : Cell synthesizes its DNA via replication. In S- phase cell is in 4n stage. G-2 phase: Cell prepares itself for division.

M- phase:

Cell condenses its chromosome and divide into 2 cell.Since, cell replicates its DNA in S-phase.

Therefore, in G1 phase of cell cycle, cell is in 2n state.

To know more about the cell cycle, refer to the link:

https://brainly.com/question/11009129

I NEED HELP The measure of how resistant a solid is to shape change when a force is applied.

Answers

Hardness is a measure of how resistant solid matter is to various kinds of permanent shape change when a force is applied Macroscopic hardness is generally characterized by strong intermolecular bonds, but the behavior of solid materials under force is complex; therefore, there are different measurements of hardness: scratch hardness, indentation hardness, and rebound hardness. Hardness is dependent on ductility, elastic stiffness, plasticity, strain, strength, toughness, viscoelasticity, and viscosity. Common examples of hard matter are ceramics, concrete, certain metals, and super hard materials, which can be contrasted with soft matter.

The movement of a fluid, caused by differences in temperature, that transfers heat from one part of the fluid to another

Convection

Conduction

Convection Current

Radiation

Answers

Answer:

Convection is the answer.

Explanation:

Answer:

convection girlie. and dis aint college hun.

Explanation:

Do all three bird species occupy the same niche? Explain .

Answers

Answer:

None of the birds have the same niche.

Explanation:

They all have different niches because of the food they ate. Over time, they were gentically changing to adapt to their own food.

Chromosome structure can be microscopically observed best during​

Answers

i believe the answer is mitosis

describe the regions where the process of crystallization happens
most often

Answers

In polar regions vapor deposition is the primary method of crystal growth in the upper fairing

Explanation:

hope this helps have a nice day :) ♡



Match each cloud type with its image.

Cirrus
Cumulus
Stratus
Cumulonimbus
Fog

Answers

The name of the clouds with respect to its image are given below:

A ----- Cumulonimbus.B ----- Stratus.C ----- Cirrus.D ----- Fog.E ----- Cumulus.

What do you mean by Clouds?

Clouds may be defined as an observable mass of particles of crystallized vapor suspended in the atmosphere of a planet or moon.

The major function of the clouds is to prevent yourself from the sun's intense heat during the day while to limiting the extremely cold at night.

Therefore, it is well described above.

To learn more about Clouds, refer to the link:

https://brainly.com/question/1783904

#SPJ2

Other Questions
What is 8 + 9 + -10 - 3x simplified? 2TIME REN441Which musical styles influenced jazz? Check all that apply,rockmarchesspiritualsbluesfunk You are trying to figure out the most cost effective way to paint scooters that you make. You can lease an automatedmachine for $2,600 per month that will paint 4,000 scooters per month. You can also hire six painters at $23 per hour who can also paint4,000 scooters per month if they work 160 hours per month. Which is more cost effective?a) The paintersb) The machinec) Can't tell How does the setting of a life at sea in Selection 1 affect the character?He lives a life of unmatched ease.He leads a life of great adventure.He has many unmet needs.He is in constant fear. ANAGRAM: Rearrange the scrambled letters to form the correct word. Refer to the meaning of each word as your clue.Your answers should be in CAPITAL LETTERS ONLY1. _ _ _ _2. _ _ _ _ _3. _ _ _ _ _ _ _4. _ _ _ _ _ _ _ _ the event of his resigning his job, hisfamily would starve.b. ata. withinc. ond. in why do people see so many hoplites on ancient pieces today Juliet can barely get the message out of the nurse, so how will the two families get the message of Romeo and Juliets wedding? Predict what will happen next.Giving brainless to person with accurate,explained answer Which river has the most commercial traffic?OrinocoMagdalena-CaucaCaucaMagdalena Susie's bakery is having a sale on all cookies. The bakery is offering a sale pack of 4 cookies for $2.80. What is the unit price of a cookie within the sale pack? Juan went out to eat dinner, and the meal cost $60.00. If Juan received a 18% discount, what was the total value of the discount? When do you need to flip the inequality sign when solving? Please! Im in a rush!!! Ill give brainliest PLEASE JUST ANSWER ONE I REALLY NEED HELP!!QuestionRespond to ONE of the following questions. Your response should include the following toreceive the points in parentheses:Respond in a well-organized essay. Your answer should be written in complete sentences.(16 pts)(a) Define the term conflict as it relates to literature and explain its importance in narrativewriting. Briefly describe the different types of internal and external conflict. Then choose ONEshort story or poem you read for this course. Explain how the author introduces, develops, andresolves a major conflict in this narrative.(b) Recall what you have learned about different genres, or types, of narratives and how toanalyze a narrative. Then choose ONE short story you read for this course. State the author'spurpose for writing the story (to inform or explain, to describe, to persuade, or to entertain) andsummarize the main idea. Briefly discuss the techniques the author used (such as figurativelanguage or metaphor). Evaluate the effectiveness of these techniques in achieving the author'spurpose.(c) Identify a major theme in ONE of the stories or poems you read for this course. State thetheme in a complete sentence. Then explain how the author develops this theme throughoutthe story or poem through plot events, character development, dialogue, and other storyelements. (NEED DONE QUICKLY) If the domain of a coordinate transformation that is reflected over the y-axis is (-6, 2), (4, 5), (2, -1), what is the range? WILL DO ABSOLUTELY ANYTHING FOR THIS ONE HELP ASAP TIMES Michael had $150 in the bank yesterday. Then, Michael bought an expensive designer jacket for $180, butdidn't realize that he overdrew from his bank. His account balance was negative now and he was in debt!What is the absolute value of his new account balance? : Discuss the continuity of the function f(x)=xtan(1/x) at x = 0 given that x0 and f(0)=0. Help Im being timed!! which poetic device is used in the following line? Colleen put the pretty pink petunias into a pot .personification, alliteration, onomatopoeia, or metaphor