Do convection currents of thermal energy form in Earth’s crust?

Answers

Answer 1
The Earth's crust is broken up into pieces called plates. The crust moves because of movements deep inside the earth. Heat rising and falling inside the mantle creates convection currents generated by radioactive decay in the core. Earth's solid crust acts as a heat insulator for the hot interior of the planet. ... Tremendous heat and pressure within the earth cause the hot magma to flow in convection currents. These currents cause the movement of the tectonic plates that make up the earth's crust. Convection currents are the result of differential heating. Lighter (less dense), warm material rises while heavier (more dense) cool material sinks. It is this movement that creates circulation patterns known as convection currents in the atmosphere, in water, and in the mantle of Earth. Magma in the Earth's mantle moves in convection currents. The hot core heats the material above it, causing it to rise toward the crust, where it cools. The heat comes from the intense pressure on the rock, combined with the energy released from natural radioactive decay of elements. Description Magma or magma, meaning in Arabic, magma, magma, or magma, which is a mixture of fused silicon materials, or in other words with. Magma forms under the Earth's crust or other layers of the Earth.

Related Questions

Are Bacteria (essential/non-essential) to sustaining the EcoSphere?

Answers

Essential because not all bacteria are harmful and we need bacteria in our daily lives

Help me with this question?

Answers

Answer:

Hey you called me dumb, but i will answer

meiosis

Explanation:

which of the following can lower the carrying capacity of a particular area?

Answers

Answer:

honestly I think its C smaller organisms .I could be completely wrong so keep that in mind

4) How does climate affect ecosystems and the life within them?

Answers

Answer:

Explanation:Climate is an important environmental influence on ecosystems. Changing climate affects ecosystems in a variety of ways. For instance, warming may force species to migrate to higher latitudes or higher elevations where temperatures are more conducive to their survival.

what is the function of RBC

Answers

Answer:

When a red blood cell is placed in a hypertonic solution, it contracts as water is drawn out of the cell and into the surrounding solution. If the same blood cell is placed in a hypotonic solution, the blood cell grows in size. Blood cells in isotonic solutions do not shrink or swell.

The reason that blood cells change in size when placed in a solution with different salt concentration is due to the osmosis process. Osmosis causes solutions with high concentrations of salt to draw water from areas with low concentrations of salt.

There are some exceptions to this phenomenon. Blood cells can draw water and explode when placed in hypertonic solution on some special occasions. Some diseases affect the structural integrity of blood cells. Also, when human blood cells are exposed to temperatures close to freezing, they can draw water and explode.

Osmosis is an important phenomenon for living systems. The amount of salt in a given solution exhibits a tendency to diffuse through the environment, eventually resulting in equilibrium. In addition to blood cells, the kidneys function through the use of osmotic principles. The kidneys filter an animal's blood to remove excess salt and balance the amount of water

Answer:

It carry oxygen from our lungs to the rest of our bodies. they make the return trip, taking carbondioxide back to our lungs to be exhaled

Trilobites are used as index fossils because

Answers

Answer:

d

Explanation:

6. A cell recognizes that it has a damaged
mitochondria. Where would this damaged
organelle go to be broken down?
A. Lysosome
B. B. Vacuole
C. C. Chloroplast
D. D. Cell Membrane

Answers

Explanation:

Cell death, also called apoptosis, is an essential part of life. As cells become old or broken, they are cleared away and destroyed. Mitochondria help decide which cells are destroyed.

A is the correct answer. The lysosome collects broken down cell parts such as broken down mitochondria.

Ruby has observed that plants in her garden vary in height. She wants to investigate whether a plant species (species A) grows faster than the other garden species (species B, C, and D). Select the statement that describes Ruby gathering enough evidence to support a scientific explanation concerning plant growth rates

Answers

Answer:

This question lacks options, the options are:

A) Ruby measures the heights of several species A, B, C, and D plants for a week under different conditions and finds a journal article that describes the growth rate of species A.

B) Ruby measures the height of a species A plant for a week and finds an anonymous gardening blog that describes the growth rate of species A.

C) Ruby measures the heights of several species A, B, C, and D plants for a week under the same conditions.

D) Ruby measures the heights of several species A, B, C, and D plants for a week under the same conditions and finds journal articles that describe the growth rates of each species.

The answer is D

Explanation:

According to this question, Ruby wants to investigate whether a plant species A in her garden grows faster than other plant species (B, C and D) due to the varying height she observed in them. To do this, Ruby will need to conduct a scientific investigation by measuring the height of all the plant species she is trying to compare (A, B, C, D).

However, she must do the measurements under the same conditions i.e. controlled in order not to influence the result. In order to make a scientific explanation concerning the plant growth rates, Ruby should find journal articles that describe the growth rates of each species and make comparison with her experimental/measured height values.

16. Which is an abiotic factor that would affect the growth of a population within an ecosystem?

a. the availability of water

c. the type of herbivores present

b. the availability of producers

d. the number of carnivores present

Answers

Answer:

A, the availability of water

Explanation:

6. In a population which is in Hardy-Weinberg equilibrium, what would be the frequency of heterozygotes for
alleles A and a (i.e. genotype Aa), when the frequency of the allele a is 0.6?

a. 1.2
b. 0.16
c. 0.48
d. 0.45

Please show formula. I am lost

Answers

1.2 is correct aanser

yes it is correctly

what is the diagram of 2NH3

Answers

Need picture of the diagram to answer

Which of the following best describes how sedimentary rock forms?


A Molten rock beneath the surface of Earth cools and becomes solid.


B Layers of sediment
become compressed over time to form rock.


C Chemical processes or changes in pressure or temperature change a rock.


D Molten rock reaches the surface and cools to become solid rock.

Answers

Answer:

I think its B

Explanation:

what is that scp that mimcs other human voices? it is like a red crocodile ​

Answers

Answer:

when you are able to mimic other humans voices you must be very very talented and have practice a lot because your vocal cords have adapted 2 copying other people's voices

Answer:

SCP-939

Explanation:

What could explain the curve in this population growth graph? A graph has time on the horizontal axis and population size on the vertical axis. The population size was constant for a period of time, increased rapidly, and then became constant again. an unlimited food supply a natural disaster a population crash a reduction in predators

Answers

Answer:

A reduction in predators

Explanation:

I just took the test

A reduction in predators could explain the curve in this population growth graph.

How does reduction in number of predators lead to curve?The prey species soon degrades and overruns its area since there are no predators to regulate the population and modify feeding behavior.When food becomes scarce, people grow unwell and famished, and they either flee or crash.When predator populations grow, putting more pressure on prey populations and acting as a top-down control, pushing them toward extinction. As a result, the size of prey populations is influenced by both resource availability and predation.

learn more about population growth graph here:

https://brainly.com/question/1437549

#SPJ2

What is the area of the triangle?
16
10
8

Answers

Answer:

10

Explanation:

The cells of a plant help the plant maintain its life functions. What part of a plant cell has the function of producing sugar in the presence of sunlight?

Answers

Answer:

CHLOROPLAST

Explanation:

As stated in this question, plant cells are capable of producing their own food in form of sugar (glucose) using energy from sunlight in a process called PHOTOSYNTHESIS. Photosynthesis is the process by which green plants and other certain organisms synthesize their own food using light energy.

The ability to carry out this photosynthetic function is embedded in a structure found in plant cells called CHLOROPLAST. Chloroplast contains a pigment called CHLOROPHYLL, which captures light energy from the sun. Generally, the the function of producing sugar in the presence of sunlight (photosynthesis) occurs in the CHLOROPLAST.

A h e t e r o z y g o u s parent is crossed with a h o m o z y g o u s recessive parent. Complete a Punnett Square and answer the questions below.

Answers

I Am Not Sure What Your Asking?

Answer:

Black Fur & Black Eyes: 4/16

Black Fur & Red Eyes: 4/16

White Fur & Black Eyes: 4/16

White Fur & Red Eyes: 4/16

4 is 1/4 of 16

Explanation:

I hope this helps

I WILL GIVE BRAINLY PLEASE HURRY!!
Some towns have decided to bury their garbage to get rid of it. What is one harmful effect of this practice?

Answers

Answer:

It can put harmful substances into the atmosphere and boost climate change.

Explanation:

brainliest pls

Answer:

plants and animals habitats will be ruined and or killed off by this harmful practice

Which statement explains the role of genes in the process of inheriting a specific trait? Question 8 options: Genes are changed by the environment of a living thing and these changes effect the genes of the offspring. Genes in living things come together to make chromosomes which take information from offspring to parent. Genes absorb chemicals from the blood stream and carry them throughout the body of parents and offspring. Genes which are past from both parents carry the genetic material that determines inherited traits.

Answers

Answer:

Genes which are past from both parents carry the genetic material that determines inherited traits.

Explanation:

Describe Piaget’s processes of assimilation and accommodation. Use an example to illustrate the processes.

Answers

Answer: For Piaget's process of accommodation it is when you change schema to accommodate new info.

example: Once you learn about something you modify your understanding of a concept to include specific categories. For example, when a child sees a dog, it has four legs and fur. But when they see a cat they create a new schema for cats.

Answer Process of assimilation adds on to pre-existing information/experiences.

example: going back to our cat-dog example. When they develop a concept of a dog as being a four-legged thing with fur, when they see a cat they will place the cat in the same category as a dog and be like "that's a dog" to anything that fits their concept of a dog.

Which of the following is the source of the carbon in sugar produced during photosynthesis?

A) carbon dioxide
B) water
C) rubisco
D) ATP

Answers

A) Carbon dioxide is the source of carbon
I’m sure it’s carbon dioxide

How does the number of valence electrons in sodium (Na) compare to the number of valence electrons in calcium (Ca)? A. Na has two fewer valence electrons than Ca. B. Na and Ca have an equal number of valence electrons. C. Na has one more valence electron than Ca. D. Na has one fewer valence electron than Ca.

Answers

Answer:

D. Na has one fewer valence electron than Ca.

Explanation:

Elements in different groups has been grouper based on the number of valence electrons they possess. Valence electrons refers to the electrons at the outermost part of the shell of an atomic element.

Sodium (Na) belongs to group 1 on the periodic table meaning that it has one number of valence electrons while Calcium (Ca) belongs to group 2 meaning that it has two number of valence electrons. Hence, Na has one fewer valence electron than Ca.

is black coffee a strong or weak acid ?

Answers

It’s a 5 so weak I hope this helps

Answer:

Coffee often gets branded as an acidic drink, but in fact, coffee comes in at around a five on the pH scale, which is actually less acidic than drinks like beer, orange juice, and even soda.

Which molecule separates the conteins inside of the cell from the contents outside of the cell

Answers

Answer:

Thanks

Explanation:

skannalakanslanwlKsoqnw

Write a statement about the role gravity plays in the motion of the planets.

Answers

Answer:

Gravity is what holds the planets in orbit around the sun and what keeps the moon in orbit around Earth. ... Gravity creates stars and planets by pulling together the material from which they are made. Gravity not only pulls on mass but also on light.

I need help on this

Answers

Answer:

1. energy

2. potential energy

3.kinetic energy

4. mechanical energy

5. b

Explanation:

A mitochondrion is having a problem creating enough energy to build new molecules. Which problem most likely exists with the mitochondria

Answers

since it’s the power house of the cell it needs a lot of energy but it can’t produce enough sometimes

The hydrogen pump may not be functioning properly.

A substance only composed of one kind of atom is a(n) *

Answers

Element is your answer

Explanation it is on the periodic table

plant roots grow in the direction of gravity. They are also exhibiting hydrotropism,which is a response to (A) water (B)gravity (C) chemicals (D) touch

Answers

Answer:

A

......... . . . . . . .. ...

A because the base word of hydrotropism is ‘hydro’ which is water.

How many moles of arsenic are in 1.204 x 1024 atoms of arsenic?

Answers

What is the mass in grams of 1.00×1023 radon atoms? Use 6.022×1023mol−1 for Avogadro's number. Your answer should have three significant figures. 36.9 grams.

Answer: 2.0 moles

Explanation:

Other Questions
The product of the ages of two adults is 572. Find their ages. Guys, I need help ASAP!! The standard deviation of the following data set is 0.31. 95% of the data would fall in which range?4.3, 5.1, 3.9, 4.5, 4.4, 4.9, 5.0, 4.7, 4.1, 4.6, 4.4, 4.3, 4.8, 4.4, 4.2, 4.5, 4.4Pr (3.88 X 5.12)Pr (2.67 X 5.33)Pr (4.19 X 4.81)Pr (3.57 X 5.43) ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut a student performed an experiment, using a cocktail peanut, before it was burned the peanut half weighed .353 g. After burning the residue weighed .016 g. The energy released by the conjunction increased the temperature of 200. mL of water in the calorimeter by 7.2 degrees Celsius. Calculate the mass of peanut consumed in the combustion. twice the sum of k and 9 is 4 The product of a number and -5 is at least 35. Write as an inequality. who killed the district judge during the revolutionary movementanswer in one sentence Quick question for you all People who complain that video games involve too much sitting are probably old. They probably dont know very much about gaming, either. They dont realize that people can play virtual sports, such as tennis, on video games. There are video games for dancing, too. If people bothered to learn about the different kinds of video games, they would see how wrong they are. This students sample paragraph addresses the counterclaim. Critique this paragraph by answering the questions.What is the counterclaim?Video games are too violent.Video games make people inactive.Video games are different today.What evidence weakens the counterclaim?People who complain are old.Sitting too much is bad for people.There are video games for sports and dancing.What is the tone of the rebuttal?respectfulrudehumorous Mention the type of seeds that undergo hypogeal germination.What do we call the process of permanently stopping babies from breast feeding?plzz help it is due today 2) look closely at article XLVII. Rephrase it in your own words. How do you think this impacted the unity among slaves during the revolution?Please I need help! Use the interactive tool to graph the line given the following information: coordinates (1,3) slope of 2Based on your investigation, what is the value of b for the point (0,b)? what is carbogen and it's uses Please help!!!! ASAP!!! Thank you!!! Brainliest to right answer also based on answer 1 are the equations equivalent? help will give brainlyist and 5 star and heart (MC)Read the narrative and determine the point of view:"As you walked along the beach with your mom, you knew it was time to tell her the facts about what happened. She may never pardon you for your deceit, but you sense that she deserves to know. You think that to regain her trust, you need to demonstrate responsibility now for what you did and be honest about it." (5 points) aFirst person bSecond person cThird-person limited dThird-person objective eThird-person omniscient Why did the results of the presidential election of 1867 anger many democrats What percentage of the population of the colonies were patriots slausonn can you pls answer this quesion pls i have 3 min left