el número de llegadas al servicio de urgencias de un hospital es de 2 cada 15 min. Si se supone que
el numero de llegadas se distribuye en un modelo de Poisson, se pretende calcular la probabilidad
de que en los próximos 15 min se produzcan 4 llegadas.
Ayuda por favor, es urgente. ​

Answers

Answer 1

Answer:

Uh I don’t speak u language

Step-by-step explanation: Sorry :/


Related Questions

The current exchange rate for the mexican peso to the us dollar is 3 to.if a tourist dinner bill was 15 pesos,what is the amount in the us dollar​

Answers

Answer:

5

Step-by-step explanation:

3x=15

x=15/3

x=5

Solve each equation:
5x=1

Answers

Answer:

5x=1

Step-by-step explanation:

51

The shadow of an object varies directly with its height.The shadow of a 25 ft trees is 6 ft.How long is the shadow of an 18 ft tree

Answers

Answer:

Well i got 4.32 but im not completely sure

Step-by-step explanation:

Which shape has six square, flat sides that are equal in size?

Answers

Answer: cube

Step-by-step explanation:

Think of a box .... it has 4 sides, a top, and a bottom = 6 total sides

Which of the following statements are true for a rhombus? It has two pairs of parallel sides. It has two pairs of equal sides. It has only two pairs of equal sides. Two of its angles are at right angles. Its diagonals bisect each other at right angles. Its diagonals are equal and perpendicular. It has all its sides of equal lengths. It is a parallelogram. It is a quadrilateral. It can be a square. It is a square.

Q1W7 Learning Task 1 (Introduction)
Factoring Polynomials

On the chart below, find a factor in Column B of each of the given polynomials in Column A using the Factor Theorem.
Column A
1. x² + 6x + 8
2. x³ - 7x + 6
3. x³ - 2x² - 5x + 6
Column B
x-3
x-1
x+2
x+3
x+1

Answers

Answer:

Column A                                            Column B

1. x² + 6x + 8                                        x-3,x+2

2. x³ - 7x + 6                                       x+1, x+2, x+3

3. x³ - 2x² - 5x + 6                              x-1, x+2, x-3

Step-by-step explanation:

Column A                                            Column B

1. x² + 6x + 8                                        x-3,x+2

2. x³ - 7x + 6                                       x+1, x+2, x+3

3. x³ - 2x² - 5x + 6                              x-1, x+2, x-3

Using Factor theorem we put values of x = ±1,±2,±3 in each of the polynomials unless we get a zero.

1. x² + 6x + 8      

= 1+6(1) +8= 15

1. x² + 6x + 8

  4+ 12+8 = 24

1. x² + 6x + 8

 (-1)² + 6(-1)+ 8

= 1-6+8= 3

1. x² + 6x + 8

 (-2)² + 6(-2)+ 8

= 4-12+8= 0

1. x² + 6x + 8

(3)²+ 6(3) +8

= 9+18+8 ≠ 0

1. x² + 6x + 8

(-3)²+ 6(-3) +8

= 9-18+8 =-1

For this polynomial we have x+2= 0 or x=-2, x-3= 0 , x=3

2. x³ - 7x + 6

1-7+6= 0

2. x³ - 7x + 6

(-1)³-7(-1) +6

= 13-1≠0

2. x³ - 7x + 6

(2)³-7(2) +6

= 8-14+6= 0

2. x³ - 7x + 6

(-2)³-7(-2) +6

= -8 +14+6

2. x³ - 7x + 6

(-3)³-7(-3) +6

= -27+21+6 = 0

For this polynomial we have x+1= 0 , x+2 = 0  and x+3= 0, or x=-1,-2,-3

3. x³ - 2x² - 5x + 6

(1)³-2(1)²-5(1)+6

= 0

3. x³ - 2x² - 5x + 6

(-1)³-2(-1)²-5(-1)+6

= -1 -2 +5+6

=8

3. x³ - 2x² - 5x + 6

(2)³-2(2)²-5(2)+6

= 8-8-10+6

=-4

3. x³ - 2x² - 5x + 6

(-2)³-2(-2)²-5(-2)+6

= -8-8+10+6

=0

3. x³ - 2x² - 5x + 6

(3)³-2(3)²-5(3)+6

= 27-18-15+6

=0

3. x³ - 2x² - 5x + 6

(-3)³-2(-3)²-5(-3)+6

= -27-18+15+6

=-14

For this polynomial we have x-1= 0 ,x+2=0, x-3= 0or x=1,-2,3

Dan uses 340 grams of blueberries to make 24 fluid ounces of smoothie. last week he made 54 fluid ounces of smoothie. how many grams of blueberries did dan use last week?

Answers

Answer: He used 765 grams of blueberries.

Step-by-step explanation:

The quantity of blueberries is directly proportional to the quantity of smoothie.

Equation of direct variation : [tex]\dfrac{x_1}{y_1}=\dfrac{x_2}{y_2}[/tex]

Substitute [tex]x_1=340\text{ grams},\ \ \ y_1=24\text{ fluid ounces}[/tex]

[tex]y_2=54\text{ fluid ounces}[/tex]

To find : [tex]x_2[/tex]

[tex]\dfrac{340}{24}=\dfrac{x_2}{54}[/tex]

[tex]\Rightarrow\ x_2=\dfrac{340}{24}\times54\\\\\Rightarrow\ x_2=765[/tex]

Hence, he used 765 grams of blueberries.

Explain the economic activities of the people in North America.​

Answers

The people living in the north America are involved in different economic activities like animal husbandry, industries, services, farming, fishing etcc …

Room temperature ranges from 25 degrees Celsius to 25 degrees Celcius. Find the range of room temperature in degrees Fahrenheit. Use the formula F-32=1.8C to convert from the Celsius scale to the Fahrenheit scale.

Answers

Complete question :

Room temperature ranges from 20 degrees Celsius to 25 degrees Celcius. Find the range of room temperature in degrees Fahrenheit. Use the formula F-32=1.8C to convert from the Celsius scale to the Fahrenheit scale

Answer:

68°F to 77°F

Step-by-step explanation:

Given that:

Temperature range in degree celcius :

20°C to 25°C

The temperature range in degree Fahrenheit is :

Using the relation :

F-32=1.8C

20°C :

F-32=1.8(20)

F = 36 + 32

F = 68°

25°C :

F-32=1.8(25)

F = 45 + 32

F = 77°

Hence, range of room temperature in Fahrenheit scale is :

68°F to 77°F

The ratio of 6th graders to 7th graders in a class of 35 students is 3:4. How many more 7th graders than 6th graders are in the class?

Answers

Answer:

Assessment started: undefined.

Item 1

The floor of a dollhouse is shaped like a rectangle with a length of 34 foot and a width of ​512​ foot. Use this model to determine the floor's area.

What is the floor's area?

Enter your answer as a fraction in simplest form by filling in the boxes.

Step-by-step explanation:

please HELP ASAP
What is the missing side, x?

Answers

Answer:

76

Step-by-step explanation:

Sam buys several pairs of jeans for $16.50 each, and a shirt for $25. Louis goes to a different store and buys the same number of jeans as Sam for $17.50 each, plus a shirt for $15. Is there a situation where both will pay the same amount for their purchases?
HELP MEEEE I HAVE TO TURN IT IN IN 10 MINUTES

Answers

There is not one !!!!!

Please help, I will give brainliest to correct answer!!
n/4 = 6
What is the value of n?

Answers

Answer:

N=24

Step-by-step explanation:

N/4=6 (times 4 to the other side)

N=24

Answer:

n = 24

Step-by-step explanation:

1) Isolate n!

n/4 = 6

×4 ×4

n = 24

simplify the square root of 272​

Answers

If you are looking for the square root, which I’m assuming. It’s 4 square root of 17, or 16.492

Expand the product (x-3)(x+2)

Answers

The answer is-

x^2−x−6

Store M sells 5 DVDs for $49. Store S sells 8 DVDs for $59.50. Which store offers the best deal
on DVDs?

Answers

hi

5 for  49  means    : 49/5   =  9+4/5 = 9.80 each

8 for  59.50   means     59.50/8 ≈  7.44

second offer is the best deal

26 - 20f = 6 please help me

Answers

answer : f=1

explanation : subtract 26 from both sides and then divide by -20, making f = q

What method can be used to prove the triangles are congruent?

Answers

The answer would be aas

Answer:

The answer to this question would be AAS (Angle-Angle-Side)

Step-by-step explanation:

The triangles both have the same side and another same angle as shown in the image, but to make this AAS, there must be another angle, which is the center point of both triangles... these are the same because they are vertical angles.

Find the slope of each line.

Answers

the slope is -3/4 :)

A student finished a 30 question test in 75 minutes . Which rate best represents the relationship between the numbers of minutes spent on test questions and the number of questions?

Answers

30 questions/75 mins

1 question/2.5 mins is your answer

Answer:

It dosent say at this rate so all you need is this

Minutes/ questions which your answer is

75/30

What is the slope of a line perpendicular to the line whose equation is 2x-y=−6. Fully reduce your answer.

Answers

Answer:

m-perpindicular= -[tex]\frac{1}{2}[/tex]

PLEASE MARK BRAINLIEST

The stopping distance, d ( in feet) for a van moving at a velocity (speed) v miles per hour is modeled by the equation:
d = 0.04v + 1.1v
What is the stopping distance for a velocity of 10 miles per hour?
a. 10 ft
b. 7 ft
c. 15 ft
d. 13 ft

Answers

Note: The must be [tex]0.04v^2[/tex] instead of [tex]0.04v[/tex].

Given:

The stopping distance, d ( in feet) for a van moving at a velocity (speed) v miles per hour is modeled by the equation:

[tex]d=0.04v^2+1.1v[/tex]

To find:

The stopping distance for a velocity of 10 miles per hour.

Solution:

We have,

[tex]d=0.04v^2+1.1v[/tex]

where, d is stopping distance and v is velocity.

Substitute v=10  in the given equation to find the stopping distance for a velocity of 10 miles per hour.

[tex]d=0.04(10)^2+1.1(10)[/tex]

[tex]d=0.04(100)+11[/tex]

[tex]d=4+11[/tex]

[tex]d=15[/tex]

So, the stopping distance for a velocity of 10 miles per hour is 15 ft.

Therefore, the correct option is c.

what is the slope of the line?
plss answer now

Answers

Answer:

y= -3 I think but the next person will answer this for you

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

Hint :

Slope of horizontal lines is

zero (( 0 )) .

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

Thus ;

[tex]slope = 0[/tex]

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

A leatherback sea turtles was swimming at 850 below sea level. He went 165 meters and then descendes 165 meters. Draw a number line to show the change in position of the sea turtles from depth it was swimming. What integer represents the sea turtles change in position?

Answers

Answer:

0

Step-by-step explanation:

Initial. Position = (- 850) below sea level

Upward movement = 165m

Deownward movement (descent) = (165m

Change in position : net change

Upward movement + downward movement

(165 + (-165)m = (165 - 165)m = 0

Help quickly!!! Will give points!!

Answers

Answer:

you need to show the examples

Step-by-step explanation:

HEYO! so i have this problem that needs to be solved and not feeling good doesn't help either lol. So here it is....


what is 14/25 in simplest form?

Answers

Answer:

0.56

Step-by-step explanation:

Answer:

14/25

Step-by-step explanation:

Because you cant divide both of them by the same number.

Help plz mportant!!! Choose the point-slope form of the equation below that represents the line that passes through the point (-1.6) and has a slope of -3.
а. y - 6 = -3x - 3
b. y - 6 = -3(x + 1)
c. y=-3x + 3
d. 3x+y=3​

Answers

Answer:

B

Step-by-step explanation:

point slope uses the form y - y1 = m(x - x1)

m stand for slope. in this case it is -3

x1 is -1 and y1 is 6

when you plug it in, you get

y - 6 = -3(x - [-1])

which simplifies to your final answer: y - 6 = -3(x + 1)

which set of the numbers is equivalent to 75%? (0.75 3/5), (7.5 75/100), (3/4 0.075), (15/20 0.75)

Answers

Answer:

0.75

Step-by-step explanation:

it has to be 0.75 because to make a percentage you move decimal to the left twice and its a %. But i am sorry i do not know the second one, maybe someone else can help :)

Answer:

75.0

Step-by-step explanation:

A shoe store uses a 40% markup for all of the shoes it sells. What would be the selling price of a
pair of shoes that has a wholesale cost of $67?

Answers

Answer:

$93.8

Step-by-step explanation:

(*markup is an increase in price)

67 + ( 40% × 67 )

= 67 + ( 40/100 × 67/1 )

= 67 + 26.8

= 93.8

......................................................................................

Somebody help me fast
This is correct?!

Answers

Answer:

A.false

B.true

C.false

D.true

1. A recipe for a pan of brownies requires 1.50
cups of milk, 0.675 cups of sugar, and 1.05
cups of oil. How many cups of ingredients
will there be in the mixing bowl?

Answers

Answer:

3.225 cups

Step-by-step explanation:

1.50 cups + 0.675 cups + 1.05 cups = 3.225 cups

1.50 cups

1.05 cups

0.675 cups

3.225 cups

Other Questions
What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees! Persuasive SpeechIntroductionA. Imagine going out to eat at a restaurant, and you read entrees like "fried human legs" and "human baby parmesan."B. I believe the world would be a happier, healthier, more humane place if everyone were vegetarian -- you should become one!C. Today I am going to enlighten you all about the animal cruelty involved with food processing that goes on behind closed doors, and the healthier lifestyle of being vegetarian.[First let me tell you a little bit about what else your are eating when you choose to eat meat.]BodyA. Every year billions of animals are raised and slaughtered for human consumption. In todays factory farms animals are confined to extremely small spaces so farmers can concentrate on maximizing production.1. This over crowding breeds disease, so the animals are fed antibiotics and sprayed with pesticides.2. The animals are also fed growth hormones.3. So, the chemicals, antibiotics and hormones are passed on to the consumers.4. USDA fact sheet, bacterial contamination of animal products often causes illness and death. Salmonella poisoning can be fatal.5. Time Magazine, bad chicken is responsible for at least 1,000 American deaths each year.[Now, here are some more disturbing facts you should know about meat production.]B. According to the Animal Protection Institute, in the U.S. alone, every year 41.8million beef cattle, 115 million pigs, and 8.785 billion chickens are slaughtered for human consumption. The animals endure much more.1. Beef cattle called "downers" are prodded or dragged to the slaughterhouse, or left without food or water to die.2. Pigs are stunned, hung upside down before their throats are cut and bled to death. If missed, they go to the scalding tank where they may be boiled alive.3. Crowed, chickens peck each other to death. Instead of providing space farmers "debeak" them by cutting off their upper beak with a hot blade.4. I would like to show you some photos taken inside a slaughterhouse.[If animal cruelty is not enough to change your mind, then maybe your own health concerns will make a difference.]C. Studies show meat-eaters are twice as likely to die from heat disease, and 60% more likely to die from cancer than vegetarians.1. Meat consumption has been linked to many diseases, osteoporosis, diabetes, kidney disease, hypertension, and obesity.2. Quoted by William Roberts, MD, editor and chief of The American Journal Of Cardiology, "When we kill animals to eat them, they end up killing us because their flesh, which contains cholesterol and saturated fat, was never intended for human beings, who are natural herbivores."ConclusionI hope that I have enlightened you all about the matters of vegetarianism, and I hope you all will make the right moral and health decisions as I have. Quote by Leonardo de Vinci, "I have, from an early age renounced eating meat. The time will come when we will look upon the murder of animals as they now look upon the murder of humans.Review the persuasive speech outline.If this speech was given to an audience full of people who worked for the cattle industry, what would the speaker have to accomplish?a.motivate them to become meat eatersb.change their beliefs about meatc.weaken the audiences attitude towards vegetablesd.strengthen the audiences attitude towards meat what was the reaction to the proclamation of 1763 by colonists? About 1/5 of all adults in the United States have type O blood. If four randomly selected adults donate blood, find the probability of each of the following events. a. All four are type O. b. None of them is type O. c. Two out of the four are type O . Whats the answer for this question guys??? a copper ore contains 3.00% of copper carbonate, CuCO3, by mass. Which mass of copper would be obtained from 1 tonne of the ore? A 1.91kg B 3.71kg C 15.3kg D 58.4kg If you travel 7.5 km and walk for 1.5 h, what is your average speed? Show your work? what is the role of private security within the criminal justice system How does the U.S. Constitution best reflect the ideal of separation of powers? Giving brainliest In the equation 3x+7=15, the number 7 is a. At Summer camp, campers are divided into groups. Each group has 16 campers and 2 cabins. How many cabins are needed are needed for 48 campers? A: 14 B: 20 C: 6 D: 30 What kind of heritability estimates (broad sense or narrow sense) are obtained from human twin studies? The length of a rectangular deck is 5 times its width. If the decks perimeter is 24 feet, what is the decks area? Why would the climates of Austin, Texas and St. Paul, Minnesota be different?(use the map) a St. Paul is much warmer than Austin due to its closeness to the Great Lakes. b St. Paul is at a higher latitude than Austin. The farther from the equator you are, the colder it is. c The Altitude in Austin is much greater than in St. Paul, making Austin much colder d The climates of both cities are very similar since they are almost lined up north and south of each other.