If the family will not budget their family resources or their efficiently what will happen?

Answers

Answer 1

Answer:

They will go broke

Explanation:

because if they spend over budget thats not enough money so they will be broke


Related Questions

A formal document detailing the process to be followed when a firm recruits for an open position is a ________.a) recruiting guide.
b) staffing plan.
c) external recruiting analysis.
d) realistic job preview.

Answers

Answer:

a) recruiting guide.

Explanation:

Recruitment can be defined as an organizational process used by human resources managers to fill vacant positions existing within an organization through the acceptance of job applications from qualified candidates or applicants.

Generally, the main purpose and goal of a recruitment process is to give each and every candidate a fair opportunity, hearing and positive feelings about the recruiting organization.

A formal document detailing the process to be followed when a firm recruits for an open position is a recruiting guide. The recruitment guide is used as a laid down plan or guideline that typically identifies or highlights the goals, requirements and descriptions for each job position that is available within the organization.

15-9: Harris Company must set its investment and dividend policies for the coming year. It has three independent projects from which to choose, each of which requires a $3 million investment. These projects have different levels of risk, and therefore different costs of capital. Their projected IRRs and costs of capital are as follows: Project A: Cost of capital: 17%; IRR: 20% Project B: Cost of capital: 13%; IRR: 14% Project C: Cost of capital: 7%; IRR: 9% Haris intends to maintain its 35% debt and 65% common equity capital structure, and its net income is expected to be $7,500,000. If Harris maintains its residual dividend policy (with all distributions in the form of dividends), what will its payout ratio be?

Answers

Answer:

Its payout ratio will be 22%

Explanation:

Residual dividend policy is a policy where a company uses the residual equity to fund dividend payments.

Accept Project A, B and C as they all have higher Cost of capital than the IRR

The total investment = $3,000,000 * 3 = $9,000,000

Dividend = Earnings - Investment in equity = $7,500,000 - 65%*$9,000,000 = $7,500,000 - $5,850,000 = $1,650,000

Dividend payout ratio = Dividend / Total earnings = $1,650,000 / $7,500,000 = 0.22 = 22%

For Flynn Company, variable costs are 70% of sales, and fixed costs are $195,000. Management’s net income goal is $75,000. Compute the required sales in dollars needed to achieve management’s target net income of $75,000.

Answers

Answer:

i would 75,345 is your answer

Explanation:

The required sales in dollars needed to achieve management’s target net income of $75,000 is $900,000.

Required sales in dollar

Using this formula

Required sales in dollar=Fixed cost+ Net income/ (1-percentage)

Let plug in the formula

]Required sales in dollar=$195,000+$75,000 /(1-.70)

Required sales in dollar=$270,000/.30

Required sales in dollar=$900,000

Therefore the required sales in dollars needed to achieve management’s target net income of $75,000 is $900,000.

Learn more about Required sales in dollar here:https://brainly.com/question/15079417

#SPJ9

Casey Electronics has a piece of machinery that costs $300,000 and is expected to have a useful life of 6 years or 40,000 hours. Residual value is expected to be $50,000.Using the units-of-production method, what is depreciation expense for the first year assuming it was used 6,000 hours?a) $37,500b) $70,000c) $81,000d) $41,667

Answers

Answer:

a) $37,500

Explanation:

In order to determine the depreciation for year 1  based on the units-of-production method, we apply the formula below:

Annual Depreciation= Depreciable Value × Units produced during the year /Estimated total production

Depreciable Value = Original cost – Scrap value

depreciable value=$300,000-$50,000=$250,000

Units produced during the year=6,000 hours

Estimated total production in hours=40,000 hours

first-year depreciation=$250,000*6000/40000

first-year depreciation=$ 37,500.00  

which fiscal policy would most likely result in the largest budget deficit

Answers

Answer:

If the question asks for the largest SURPLUS the answer will be

High Taxation and Low Spending

Explanation:

There are two different questions make sure you read it correctly!!!!

The fiscal policy that would most likely result in the largest budget deficit is expansionary fiscal policy.

What is fiscal policy?

Fiscal policy refers to the use of the government budget to affect the economy. This includes government spending and levied taxes. The policy is said to be expansionary when the government spends more on budget items such as infrastructure or when taxes are lowered.

Such policies are typically used to boost productivity and the economy. Conversely, the policy is contractionary when government spending decreases or taxes rise. Contractionary policies might be used to combat rising inflation. Generally, expansionary policy leads to higher budget deficits, and contractionary policy reduces deficits. Expansionary Policy is when governments can spend beyond their tax-based budgetary constraints by borrowing money from the private sector. The U.S. government issues Treasury Bonds to raise funds, for example.

To meet its future obligations as a debtor, the government must eventually increase tax receipts, cut spending, borrow additional funds or print more dollars.

Learn more about fiscal policy, here:

https://brainly.com/question/27250647

#SPJ3

Over a five-year period, (nominal) GDP in a nation increased from $10 trillion to $15 trillion, while the GDP price deflator increased from 100 to 125. Approximately how much is GDP in year five, stated in terms of year-one dollars?

Answers

Answer:

The GDP in year five, stated in terms of year-one dollars, is approximately $12 trillion.

Explanation:

This can be calculate using the following formula:

Real GDP in year five = Nominal GDP in year five / (GDP price deflator in year five / GDP price deflator in year-one) ................... (1)

Where;

Real GDP in year five = Amount of GDP in year five, stated in terms of year-one dollars = ?

Nominal GDP in year five = $15 trillion

GDP price deflator in year five = 125

GDP price deflator in year-one = 100

Substituting the into equation (1), we have:

Real GDP in year five = $15 / (125 / 100) = $15 / 1.25 = $12 trillion

Therefore, the GDP in year five, stated in terms of year-one dollars, is approximately $12 trillion.

Analyze how Nintendo recreated the home video game business following the Atari-era boom and bust. How was Nintendo able to capture value in the home video game business?

Answers

Answer: Cost leadership and differenciation in quality

Explanation:

Cost leadership; Nitendo was able to reduce production cost by subcontracting most of it's production, while the rest of it's production were done within(in-house), with this effect in cost of production reduced, Nitendo was able to reduce selling price and beat the competition in the market.

Differentiation in quality; Nintendo came with quality, their graphics and sounds were top-notch, despite that, they still invested more in main them better with better technology innovation.

Question 7 of 10
How does fractional reserve banking increase the money supply?
O A. By automatically converting foreign currencies into U.S. dollars on
deposit
O B. By guaranteeing that all deposits are held in reserve as cash at all
times
O C. By using deposited money to make loans without reducing the
value of the deposits
O D. By giving banks the authority to print their own money in an
economic emergency
SUBMIT

Answers

Answer: C. By Using deposited money to make loans without reducing the value of the deposits

Explanation:

A.P.E.X

Answer:

c

Explanation:


2. Seller is defined as a party that makes, offers or contracts to make a sale to an actual or
potential buyer."
True of false? ​

Answers

Answer:

True

Explanation:

A seller is a person who agrees to exchange his goods or services with another party for money or other goods. A seller transfers ownership of the products to a buyer in exchange for money or other valuables.  It is a person who sells, a salesperson, or a vendor of goods and services.

A seller requires a buyer to complete a sales transaction.

Levine Inc. is considering an investment that has an expected return of 15% and a standard deviation of 10%. What is the investment's coefficient of variation?
a. 0.67
b. 0.73
c. 0.81
d. 0.89
e. 0.98

Answers

Answer:

A)0.67

Explanation:

Coefficient of variation can be regarded as the method that is usually devices in the assessment of the total risk per unit of return in a particular investment.

To calculate the investment's coefficient of variation, we use the expresion below

Coefficient of variation = standard deviation/expected return.

Given:

expected return = 15%

standard deviation = 10%.

Coefficient of variation =10/15

= 0.67

Hence, the investment's coefficient of variation is 0.67

Steve Colburn's portable sawmill used 100% for business, was completely destroyed by fire. The sawmill had an adjusted basis of $35,000 and a fair market value of $50,000 before the fire. The sawmill was uninsured. Steve's casualty loss is:________.1) $49,900.
2) $50,000.
3) $35,000.
4) $34,900.

Answers

Answer: $35,000

Explanation:

A casualty loss is simply a loss that an individual or business incurs when a property is damaged, or destroyed due to an unexpected or sudden event like fire, volcanic eruption, flood etc.

Here, Steve's casualty loss will be gotten when we compare both his adjusted basis and the fair market value and then we choose the lesser one. Since $35000 is lesser than $50000, therefore the answer will be $35000.

Phillips Co. currently pays no dividend. The company is anticipating dividends of $.02, $.05, $.10, $.20, and $.30 over the next 5 years, respectively. After that, the company anticipates increasing the dividend by 3.5 percent annually. One step in computing the value of this stock today is to compute the value of:_________
a) P5.
b) P3.
c) P1.
d) P6.
e) P4.

Answers

Answer:

a) P5.

Explanation:

The formula to calculate the current price stock is as follow:

P0 = D1/(1+Ke)^1 + D2/(1+Ke)^2 + D3/(1+Ke)^3 + D4/(1+Ke)^4 + D5/(1+Ke)^5 + P5/(1+Ke)^5

The Price of share is P

The dividend is D

The required rate of return is Ke

The Greenback Store’s cost structure is dominated by variable costs with a contribution margin ratio of 0.25 and fixed costs of $40,000. Every dollar of sales contributes 25 cents toward fixed costs and profit. The cost structure of a competitor, One-Mart, is dominated by fixed costs with a higher contribution margin ratio of 0.75 and fixed costs of $440,000. Every dollar of sales contributes 75 cents toward fixed costs and profit. Both companies have sales of $800,000 for the month. Required: a. Compare the two companies’ cost structures. b. Suppose that both companies experience a 15 percent increase in sales volume. By how much would each company’s profits increase?

Answers

Answer:

                                Greenback Store            One-Mart

                                      Amount      %           Amount    %

a.  Sales                       $800,000   100%     $800,000   100%

Variable cost               $600,000    75%      $200,000    25%      

Contribution margin    $200,000    25%      $600,000    75%

Fixed cost                    $40,000       5%        $440,000    55%

Operating profit           $160,000     20%      $160,000     20%

Break even point         $160,000                  $586,666.67

Workings

Greenback Store Break even point = Fixed cost / Contribution margin ratio = 40,000 / 0.25 = 160,000

One-Mart Break even point = Fixed cost / Contribution margin ratio = 440,000 / 0.75 = 586,666.67

b. Greenback Store

Increase in sales = $800,000*15% = $120,000

Company profit Increase by + (Increase in sales * Contribution margin ratio = 120,000 * 25% = $30,000

Thus, with the increase in 15% of sales of Greenback Store, the profit of the   company increase by $30,000

One-Mart

Increase in sales = $800,000*15% = $120,000

Company profit Increase by + (Increase in sales * Contribution margin ratio = 120,000 * 75% = $90,000

Thus, with the increase in 15% of sales of One-Mart , the profit of the   company increase by $90,000.

Consider the following information about an asset that is being review for impairment: Book value $ 700,000 Estimate future cash flows 650,000 Fair value 590,000 What is the amount of the impairment loss for this asset?

Answers

Answer:

The amount of the impairment loss for this asset is $110,000

Explanation:

A assets is impaired when the fair market value of that assets lowers than the book value of the asset.

To calculate the impairment of an assets following formula is used

Impairent = Book value of Asset -  fair market value of the asset

Placing values in the formula

Impairent = $700,000 -  $590,000

Impairent = $110,000

After graduating law school Amy has to start repaying her $110,000 in loans. Assuming the annual interest rate is 7.5% over a 20 year repayment period, what will be the monthly loan payments?

a. $886.15
b. $458.34
c. $899.18
d. $906.93

Answers

Answer:

monthly payment= $886.15

Explanation:

Giving the following information:

PV= $110,000

i= 0.075/12= 0.00625

n= 12*20= 240

To calculate the monthly payment, we need to use the following formula:

monthly payment= (PV*i) / [1 - (1+i)^(-n)]

monthly payment= (110,000*0.00625) / [1 - (1.00625^-240)]

monthly payment= $886.15

Swifty uses the periodic inventory system. For the current month, the beginning inventory consisted of 7300 units that cost $11.00 each. During the month, the company made two purchases: 2800 units at $12.00 each and 12200 units at $12.50 each. Swifty also sold 13100 units during the month. Using the average cost method, what is the amount of cost of goods sold for the month? (Round average cost per unit to 2 decimal places, e.g. 1.48.)
1- $156545.
2- $157200.
3- $151400.
4- $163300.

Answers

Answer:

1. $156545.

Explanation:

Average cost of inventory = {(7300 x $11) + (2800 x $12) + ($12200 x $12.50)}/(7300 + 2800 + 12200)

Average cost of inventory = $80300 + $33600 + $152500)/22300

Average cost of inventory = $11.95 per unit

Cost of goods sold = Units sold * average cost per unit

Cost of goods sold = 13,100 * $11.95

Cost of goods sold = $156,545

According to the video, what do Financial Analysts analyze? Check all that apply.
financial records
travel distances
insurance claims
a company's competitors
fraud

Answers

A-D

-financial records

-a company’s competitors

Answer:

Financial Records

A Company’s Competitors

Explanation:

I got it right on edge 2020 hope this helps!

On November 1, Orpheum Company accepted a $12,400, 90-day, 8% note from a customer to settle his account. What entry should be made on the November 1 to record the acceptance of the note?

Answers

Answer:

Dr Note Receivable $12,400

Cr Accounts Receivable $12,400

Explanation:

Based on the information given we were told that on November 1 the company accepted a note from a customer in order to help settle the customer account of the amount of $12,400 which means that the Journal entry that should be made on the November 1 to record the acceptance of the note will be :

Dr Note Receivable $12,400

Cr Accounts Receivable $12,400

Colorado Rocky Cookie Company offers credit terms to its customers. At the end of 2021, accounts receivable totaled $665,000. The allowance method is used to account for uncollectible accounts. The allowance for uncollectible accounts had a credit balance of $40,000 at the beginning of 2021 and $25,000 in receivables were written off during the year as uncollectible. Also, $2,000 in cash was received in December from a customer whose account previously had been written off. The company estimates bad debts by applying a percentage of 15% to accounts receivable at the end of the year.

Required:
Prepare journal entries to record the write-off of receivables, the collection of $2,000 for previously written off receivables, and the year-end adjusting entry for bad debt expense.

Answers

Answer:

Bad debt expenses is $82,750

Explanation:

Recording the write off receivables

Date  Account Titles and Explanation                 Debit       Credit

          Allowances for uncollectible accounts   $25,000

               Accounts receivables                                              $25,000

           (To write off an uncollectible amount)

Recording the reinstatement of an account previously written off

Date  Account Titles and Explanation                 Debit       Credit

          Account receivables                                  $2,000

                 Allowances for uncollectible accounts               $2,000

          (To reinstatement of an account previously written off)

Recording collection of account previously written off

Date  Account Titles and Explanation                 Debit       Credit

          Cash                                                               $2,000

                           Account receivables                                  $2,000

          (To record the cash received)

Recording bad debt expenses for the year

Date  Account Titles and Explanation                 Debit       Credit

          Bad debt Expenses                                   $82,750

                Allowances for doubtful accounts                        $82,750

           (To record estimated bad debts)

Workings

Particulars                        Amount

Beginning balance                    $40,000

Less: Receivables write off       $25,000

Add: Collection of receivables  $2,000

        previously written off

                                                     $17,000

Less: Required allowances         $99,750 ($665,000*15%)                  

Bad debt expenses                     $82,750

Thus, the bad debt expenses is $82,750

9.
How is nominal GDP converted into real GDP?
O by eliminating the effects of price increases on GDP growth
O by adding all incomes earned to total expenditures by consumers, businesses, and government
O by adding the contributions of American-owned factories in foreign countries
O by adding up all of the real purchases made in the economy

Answers

A. By eliminating the effects of price increases on GDP growth. Nominal GDP is calculated using the current prices while Real GDP is adjusted for inflation.

Answer:

by eliminating the effects of price increases on GDP growth

Explanation:

To correct for an increase in prices, economists establish a set of constant prices by choosing one year as a base year and using this base year to calculate real GDP for other years.

Choi Home Repair needs to accumulate $22,000 in 6 years to purchase new equipment. What sinking fund payment (in $) would they need to make at the end of each three months, at 4% interest compounded quarterly?

Answers

Answer: $815.62

Explanation:

This is an annuity because it is to be a specific payment per period.

As it is in 6 years, it is a Future Value calculation.

Number of periods = 6 years * 4 quarters = 24 quarters

Interest = 4%/ 4 quarters = 1%

Future Value = Annuity * Future Value interest factor of Annuity, 24 periods, 1%

22,000 = Annuity * 26.9735

Annuity = 22,000/26.9735

Annuity = $815.62

Megans personal information is shown below according to the following table what is her hypothetical credit score

Answers

Answer: Sherry's credit score is 390

Explanation:

You did not include Megan's details so I used a reference question and you can answer with your details looking at how I answered this one.

Sherry personal information is shown below . age 26 .time of address 3 years .age of auto 9 years .car payment none. Housing cost 750 .checking and saving accounts checking only . Finance company reference no . Major credits cards 4 .ratio of debt to income 22% . Declared bankruptcy never .according to the following table what is her credit score

                                                    Option Points       Allocated based on table

Age                                                        26                               20

Time of address                                     3                                20

Age of Auto                                            9                                  0

Car Payment                                        None                            72

Housing Cost                                       750                              48

Checking and Saving accounts    Checking only                    8

Finance company reference                No                               60

Major credits cards                               4                                 60

Ratio of debt to income                       22%                               0

Declared bankruptcy                        Never                            102

Total                                                                                         390

Rent expense in Volusia Company's 2016 income statement is $420,000. If Prepaid Rent was $70,000 at December 31, 2015, and is $95,000 at December 31, 2016, the cash paid for rent during 2016 is:_________

Answers

Answer:

$445,000

Explanation:

The rent in Volusian company income statement for 2016 is $420,000

The prepaid rent is $70,000 at December 31 2015 and $95,000 at December 31 2016

Therefore the cash paid for rent in 2016 can be calculated as follows

= $420,000+($95,000-$70,000)

= $420,000 + $25,000

= $445,000

Mike Finley wishes to become a millionaire. His money market fund has a balance of $403,884 and has a guaranteed interest rate of 12%. How many years must Mike leave that balance in the fund in order to get his desired $1,000,000?
Assume that Sally Williams desires to accumulate $1 million in 15 years using her money market fund balance of $209,004. At what interest rate must Sallyâs investment compound annually? (Round answer to 0 decimal places, e.g. 5%.)

Answers

Answer:

Mike Finley

t = 7.999983133 years rounded off to 8 years

Sally Williams

r = 0.110000123 or 11.0000123% rounded off to 11.00%

Explanation:

Mike Finley

To calculate the time period it will take Mike Finley to become a millionaire, we will use the formula of future value of cash flow. The formula for future value of cash flow is as follows,

Future value = Present value * (1+r)^t

Where,

r is the interest rate or rate of returnt is the time period in years

Plugging in the values for Future value, present value and r in the formula, we can calculate the t to be,

1000000 = 403884 * (1+0.12)^t

1000000 / 403884  =  1.12^t

2.475958444 = 1.12^t

Taking log on both sides.

ln(2.475958444) / ln(1.12)  =  t

t = 7.999983133 years rounded off to 8 years

Sally Williams

We will use the same formula for future value of cash flows as we used above to calculate the rate at which investment should be compounded annually to grow to $1 million.

1000000 = 209004 * (1+r)^15

1000000 / 209004 = (1+r)^15

4.784597424 = (1+r)^15

Taking root of 1 on both sides.

(4.784597424)^1/15  =  (1+r)^15 * 1/15

1.110000123  =  1+r

1.110000123 - 1 = r

r = 0.110000123 or 11.0000123% rounded off to 11.00%

Ten years ago, Lucas Inc. earned $0.50 per share. Its earnings this year were $5.00. What was the growth rate in earnings per share (EPS) over the 10-year period?

Answers

Answer:

25.89%

Explanation:

With regards to the above information, initial earning = $0.50

Final earnings = $5.0

Number of periods = 10 years

We can formulate the above into an equation, which will now be:

$5.00 = $0.5 ( 1 + rate )^ 10

We can simplify furthermore.

1 + rate ^ 10 = 5 / 0.5

1 + rate ^ 10 = 10

1 + rate ^ 10 = 10^1/10

1 + rate = 10 ^ 0.1

1 t rate = 1.2589

rate = 1.2589 - 1

rate = 0.2589

rate = 25.89%

Therefore, the growth rate in earnings per share (EPS) over the 10 year period is 25.89% .

A tax system in which the tax rate on everyone's first $10,000 of income is 10 percent, the tax rate on everyone's second $10,000 of income is 15 percent, and the tax rate on all income over $20,000 is 25 percent is a(n):

Answers

Answer:

The appropriate response is "Progressive tax".

Explanation:

Progressive taxation appears to mean that the tax rate is higher for increased organizations as well as lower for low-income communities. Whenever the taxable income leads to higher, the above tax rate tends to increase. The approximately equal tax rate would be taxation that is set regardless including its up or down in tax liability.

So that above is the correct answer.

Toys "R" Us has decreased its receivable turnover over the last three years: which of the following may be a possible cause of this decrease? A) the company has been more selective in choosing reliable customers. B) salesmen have granted customers an extension of credit terms. C) the accounting department has increased the allowance for doubtful accounts. D) all of the above are correct

Answers

Answer:

B) salesmen have granted customers an extension of credit terms.

Explanation:

receivables turnover ratio = net sales / average accounts receivable

A low receivables turnover ratio is usually a bad thing, since most companies sell on credit, i.e. their accounts receivable should be important. A high receivables turnover ratio means that the company is collecting its accounts receivable efficiently and its customers are good payers.

The key point here is average accounts receivable. What can result in a company having very high accounts receivable (compared to its total sales)? The answer is simple, their customers are not paying on time or the company had to extend their credit terms in order to attract more customers.

Roland had revenues of $601,000 in March. Fixed costs in March were $212,520 and profit was $51,920. A. What was the contribution margin percentage?B. What monthly sales volume (in dollars) would be needed to break-even?
c. What sales volume (in dollars) would be needed to earn $169,420?

Answers

Answer: See explanation

Explanation:

Revenue = $601,000

Fixed costs = $212,520

Profit = $51,920

A. A. What was the contribution margin percentage?

Contribution margin will be calculated as:

= (Fixed cost + Profit) / Revenue

= ($212520 +$51920) / $601,000

= $264440 / $601000

= 44%.

B. What monthly sales volume (in dollars) would be needed to break-even?

The break even point sales will be:

= Fixed cost / Contribution margin

= $212520 / 44%

= $212520 / 0.44

= $483000

C. What sales volume (in dollars) would be needed to earn $169,420?

This will be:

= (FC+DP) / Contribution margin

= (212520 + 169420)/0.44

= $381940/0.44

= $868045.45

Fortune Company had beginning raw materials inventory of $16,000. During the period, the company purchased $92,000 of raw materials on account. If the ending balance in raw materials was $10,000, the amount of raw materials transferred to work in process is

Answers

Answer:

The amount of raw materials transferred to work in process is $98,000.

Explanation:

Given that, at the beginning of its business operations, Fortune Company had a raw material inventory of $ 16,000 and that, during the business year, it acquired another quantity of raw materials for $ 92,000, the total of raw materials in the company's stock had a total value of $ 108,000 (16,000 + 92,000).

Now, if at the end of the balance the value of the raw materials was $ 10,000, the amount of raw material that was incorporated into the production process was a value of $ 98,000 (108,000 - 10,000).

The comparative financial statements prepared at December 31, 2015, for Prince Company showed the following summarized data:
2015 2014
Income statement
Sales Revenue 190,900 167,300
Cost of goods sold 113,000 102,000
Gross Profit 77,900 65,300
Operating expenses and interest expense 56,700 53,700
Pretax income 21,200 11,600
Income Tax 6,200 3,100
Net Income 15,000 8,500
Balance Sheet
Cash 4,600 6,500
Accounts Receivable (net) 15,300 16,900
Inventory 40,300 32,600
Operational Assets (net) 46,400 36,400
106,600 92,400
Current liabilities (no interest) 15,100 16,100
Long-term liabilities (10%interest) 44,900 44,900
Common Stock (par $5) 29,900 29,900
Retained Earnings 16,700 1,500
106,600 92,400
1. Present component percentages for 2015 only.
2. Respond to the following for 2015:
What was the gross profit percentage?

Answers

Answer:

Prince Company

1. Component percentages for 2015:

Income statement              2015      Percentage

Sales Revenue             190,900          100%

Cost of goods sold       113,000            59% (113,000/190,900 * 100)      

Gross Profit                    77,900             41% (77,900/190,900 * 100)

Operating expenses and

interest expense         56,700             30% (56,700/190,900 * 100)            

Pretax income               21,200              11% (21,200/190,900 * 100)

Income Tax                     6,200               3% (6,200/190,900 * 100)

Net Income                   15,000               8% (15,000/190,900 * 100)  

Balance Sheet                                   2015      Percentage

Cash                                                 $4,600     4.3% (4,600/106,600 * 100)  

Accounts Receivable (net)               15,300    14.4% (15,300/106,600 * 100)    

Inventory                                          40,300    37.8% (40,300/106,600 * 100)    

Operational Assets (net)                 46,400    43.5% (46,400/106,600 * 100)

Total                                               106,600    100%    

Current liabilities (no interest)        15,100       14.2% (15,100/106,600 * 100)  

Long-term liabilities (10%interest) 44,900      42.1% (44,900/106,600 * 100)

Common Stock (par $5)               29,900        28% (29,900/106,600 * 100)  

Retained Earnings                         16,700        15.7% (16,700/106,600 * 100)  

Total                                            106,600       100%  

2. Gross profit percentage for 2015:   41%

Explanation:

a) Data and Calculations:

Income statement              2015           2014

Sales Revenue             190,900      167,300

Cost of goods sold       113,000      102,000

Gross Profit                    77,900       65,300

Operating expenses and

interest expense         56,700        53,700

Pretax income               21,200         11,600

Income Tax                     6,200          3,100

Net Income                   15,000         8,500

Balance Sheet

Cash                                                 $4,600    $6,500

Accounts Receivable (net)               15,300     16,900

Inventory                                          40,300    32,600

Operational Assets (net)                 46,400    36,400

Total                                               106,600    92,400

Current liabilities (no interest)        15,100      16,100

Long-term liabilities (10%interest) 44,900    44,900

Common Stock (par $5)               29,900    29,900

Retained Earnings                         16,700        1,500

Total                                            106,600     92,400

Other Questions
Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees! Persuasive SpeechIntroductionA. Imagine going out to eat at a restaurant, and you read entrees like "fried human legs" and "human baby parmesan."B. I believe the world would be a happier, healthier, more humane place if everyone were vegetarian -- you should become one!C. Today I am going to enlighten you all about the animal cruelty involved with food processing that goes on behind closed doors, and the healthier lifestyle of being vegetarian.[First let me tell you a little bit about what else your are eating when you choose to eat meat.]BodyA. Every year billions of animals are raised and slaughtered for human consumption. In todays factory farms animals are confined to extremely small spaces so farmers can concentrate on maximizing production.1. This over crowding breeds disease, so the animals are fed antibiotics and sprayed with pesticides.2. The animals are also fed growth hormones.3. So, the chemicals, antibiotics and hormones are passed on to the consumers.4. USDA fact sheet, bacterial contamination of animal products often causes illness and death. Salmonella poisoning can be fatal.5. Time Magazine, bad chicken is responsible for at least 1,000 American deaths each year.[Now, here are some more disturbing facts you should know about meat production.]B. According to the Animal Protection Institute, in the U.S. alone, every year 41.8million beef cattle, 115 million pigs, and 8.785 billion chickens are slaughtered for human consumption. The animals endure much more.1. Beef cattle called "downers" are prodded or dragged to the slaughterhouse, or left without food or water to die.2. Pigs are stunned, hung upside down before their throats are cut and bled to death. If missed, they go to the scalding tank where they may be boiled alive.3. Crowed, chickens peck each other to death. Instead of providing space farmers "debeak" them by cutting off their upper beak with a hot blade.4. I would like to show you some photos taken inside a slaughterhouse.[If animal cruelty is not enough to change your mind, then maybe your own health concerns will make a difference.]C. Studies show meat-eaters are twice as likely to die from heat disease, and 60% more likely to die from cancer than vegetarians.1. Meat consumption has been linked to many diseases, osteoporosis, diabetes, kidney disease, hypertension, and obesity.2. Quoted by William Roberts, MD, editor and chief of The American Journal Of Cardiology, "When we kill animals to eat them, they end up killing us because their flesh, which contains cholesterol and saturated fat, was never intended for human beings, who are natural herbivores."ConclusionI hope that I have enlightened you all about the matters of vegetarianism, and I hope you all will make the right moral and health decisions as I have. Quote by Leonardo de Vinci, "I have, from an early age renounced eating meat. The time will come when we will look upon the murder of animals as they now look upon the murder of humans.Review the persuasive speech outline.If this speech was given to an audience full of people who worked for the cattle industry, what would the speaker have to accomplish?a.motivate them to become meat eatersb.change their beliefs about meatc.weaken the audiences attitude towards vegetablesd.strengthen the audiences attitude towards meat what was the reaction to the proclamation of 1763 by colonists? About 1/5 of all adults in the United States have type O blood. If four randomly selected adults donate blood, find the probability of each of the following events. a. All four are type O. b. None of them is type O. c. Two out of the four are type O . Whats the answer for this question guys??? a copper ore contains 3.00% of copper carbonate, CuCO3, by mass. Which mass of copper would be obtained from 1 tonne of the ore? A 1.91kg B 3.71kg C 15.3kg D 58.4kg If you travel 7.5 km and walk for 1.5 h, what is your average speed? Show your work? what is the role of private security within the criminal justice system How does the U.S. Constitution best reflect the ideal of separation of powers? Giving brainliest In the equation 3x+7=15, the number 7 is a. At Summer camp, campers are divided into groups. Each group has 16 campers and 2 cabins. How many cabins are needed are needed for 48 campers? A: 14 B: 20 C: 6 D: 30 What kind of heritability estimates (broad sense or narrow sense) are obtained from human twin studies? The length of a rectangular deck is 5 times its width. If the decks perimeter is 24 feet, what is the decks area? Why would the climates of Austin, Texas and St. Paul, Minnesota be different?(use the map) a St. Paul is much warmer than Austin due to its closeness to the Great Lakes. b St. Paul is at a higher latitude than Austin. The farther from the equator you are, the colder it is. c The Altitude in Austin is much greater than in St. Paul, making Austin much colder d The climates of both cities are very similar since they are almost lined up north and south of each other. 5. What are the horizontal and vertical components of a 10 unit vector that is oriented 48degrees above the horizontal?