What is a symptom of attention deficit hyperactive disorder?
A.
insistence on repeating behaviors
B.
difficulty in recalling an event
C.
obsession with certain ideas
D.
inability to complete a task

Answers

Answer 1

Answer:

The answer to this problem is D. inability to complete a task.

Explanation:

Attention-deficit/hyperactivity disorder (ADHD) is a brain disorder marked by an ongoing pattern of inattention and/or hyperactivity-impulsivity that interferes with functioning or development.

Symptems:

Lack of focus.

Hyperfocus.

Disorganization.

Time management problems.

Forgetfulness.

Impulsivity.

Emotional problems.

Poor self-image.

Lack of motivation.

Restlessness and anxiety.

Fatigue.

Health problems.

Relationship issues.

Substance misuse.

Answer 2

Answer:

inability to complete a task

Explanation:


Related Questions

Individuals with gestational diabetes are _____.

more likely to have full term small babies
more likely to have diabetic babies
more likely to develop type II diabetes within 5–10 years
more likely to develop type I diabetes while they are pregnant

Answers

The answer to this is

B: More likely to have diabetic babies.

I hope this helps you out :))))

Answer:

the answer is more likely to develop type II diabetes within 5–10 years

Explanation:

About how many Americans age 65 and older are affected by dementia?
A.
10 percent
B.
30 percent
C.
40 percent
D.
60 percent

Answers

10% of amerixans 65 or older are affected by dimentia

Answer:

a.10 percent

Explanation:

for all PLATO users

What are some aggressive behaviors?

Answers

Answer:

all of the above

Explanation:

my explanation is these are all agressive behaviors these are not acts of kindness

Answer:

tbh i don't really know but Im guessing its all of the above

Explanation:

Which statement is true regarding Type II diabetes?

Doctors diagnose patients with Type II diabetics in childhood or young adulthood.
Type II diabetics were previously Type I diabetics.
Obesity can contribute to type II diabetes
Type II diabetics are always insulin dependent.

Answers

Answer:

i beleive the answer is type II diabetes is usually diagnosed in childhood or young adult hood

Obesity can contribute to type 2 diabetes. Its believed to account 80-85% risk to people with obesity it states. So I believe that the 3rd option of obesity can contribute to type 2 diabetes.

Hope this helps.

Which might a person having a stroke experience? Check all that apply.

headache

runny nose

stomach pain

difficulty speaking

loss of strength on one side of the body

Answers

Answer:

Loss of strength one one side of the body

Difficulty speaking

Headache

Explanation:

Mitochondria create proteins used to build many things in the body.
true or false?

Answers

Answer:

Yeah :)

Explanation:

Give a short description of how each of these processes leads to a loss of biodiversity and include which one is the greatest cause.
a. habitat alteration
b. invasive species
c. overharvesting
d. pollution

Answers

Pollution can end up in water causing sea animals to die when they inhale it, invasive species kill other animals.

The outer layer of the brain is the:
A. Primitive brain
B. Emotional brain
C. Thinking brain
D. Understanding brain

Answers

Answer:

I believe the answer would be A. But,tbh none of these are correct, the out side layer of the brain is called the Dura mater, also known as the gray matter!

Explanation:

What is a sprain? What are the causes, symptoms and treatments

Answers

Answer:

A sprain is a stretching or tearing of ligaments — the tough bands of fibrous tissue that connect two bones together in your joints. The most common location for a sprain is in your ankle. Initial treatment includes rest, ice, compression and elevation. Mild sprains can be successfully treated at home.

Explanation:

Answer:

A sprain is a stretching or tearing of ligaments — the tough bands of fibrous tissue that connect two bones together in your joints. The most common location for a sprain is in your ankle. Initial treatment includes rest, ice, compression and elevation. Mild sprains can be successfully treated at home.

Explanation:

hope this helped,brainliest?

i know this is off topic but im just bothered by this.
i think i found my soulmate, but im not accurate.
how do you know u found yours?

Answers

Answer:

When you feel like you've known each other for years even tho you may have just met

Explanation:

Answer:

You just know.

Explanation:

You guy are inseparable.

Which of the following is credit history
A. The balance you carry on your credit card
B The total cash value of all your bank account
C. The total amount of money you can spend with your credit card
D. The record of how well you repay your depts on time

Answers

D! If you don’t pay your debts on time, that goes onto your credit history report.

Answer: D. The record of how well you repay your debts on time.

Explanation: I just took the unit test

What health resources are available at your home? List at least three.

Answers

1.First aid kit 2. Healthy diet 3. Exercise

Pls Help!
Imagine you are the owner of a holiday camp with seven cabins. A group of five high school students will be staying with you for three days, starting next week. You need a list of meals {breakfast, lunch, and supper} to provide for the time you are camping. What would be a good meal plan for the duration of three days?
*If possible describe how it the cooked or prepared and list the needed ingredients to make the meals for breakfast, lunch, and supper.*

Answers

Answer:

Day 1:

Breakfast- Biscuits and Gravy served with eggs and toast

Lunch- the choice of soup or salad

Dinner- Chicken alfredo served with bread

Day 2:

Breakfast-Pancakes or Waffles with oatmeal

Lunch-Turkey Subs or Chicken salad served with mac& cheese

Dinner- spaghetti and Meatballs with mashed potatoes

Day 3:

Breakfast- an Omelete with bacon and toast

Lunch- Chicken and rice served with a salad

Dinner- Tacos or Burritos with a side salad

_____________ is a program in which the person chooses a primary care physician who is affiliated with the plan to manage the person's health care. A. An HMO B. A PPO C. Managed health care D. All of the above


(50 points)

Answers

Answer:

D alll of the above

Explanation:

Its all of the things mentioned

HMo is a Health maintenance organization

which will help people manage their health  

PPo is Preferred provider organization

which will also support you on creating or choosing primary care physician

6th grade pre teacher ED i mark as brainliest​

Answers

Answer:

Answer A

Explanation:

Using flattery to influence another person is a
A. type of aggressive behavior
B. method of manipulation
C. way to be assertive
D. refusal skill

Answers

Answer:

the answer is B method of manipulation

Explanation: the reason being is if someone doesnt do what you want some people who are narcissistic do tend to try and get their way they tend to flatter or subdue a person to try and get the person to do what they want beucase the like the feeling of winning and some people are gullible

(ive been watching alot of criminal minds

Using flattery to influence another person is a method of manipulation.

To gain someone's approval, support, or obedience, one must praise or admire them. This is known as using flattery to persuade. It is a type of manipulation as it aims to influence someone's feelings or ego in order to produce a desired result.

Flattery can be used to persuade someone to do something they would not have done otherwise or to influence their perception or choice. Despite the outward appearance of friendliness or positivity, the real goal is to gain the upper hand or control over the other person.

Therefore, the correct option is B.

Learn more about manipulation, here:

https://brainly.com/question/14435293

#SPJ6

Please Help!
Need Quickly!
Part A:
Describe how caffeine can affect your stress level. How does it affect your cardiorespiratory system? Include information about the hormone called adrenalin.

Part B
What is a comfort food? How does comfort food affect your stress levels? What are some of the dangers of comfort food as it pertains to your level of physical fitness? Describe how neurotransmitters, such as serotonin, work in relation to stress and comfort food.

Part C
Describe a diet that can lower your stress level. What does the diet look like? What kinds of foods and drinks are in the diet? What quantities of food are in the diet? Include your thoughts about how the stress hormone cortisol or the feel-good neurotransmitter, serotonin, relate to diet that reduces stress.

**Each answer needs to be two or three paragraphs long!**

Answers

Part A)
Caffeine can affect your stress levels in many ways. For example, high amounts of caffeine can lead to negative health affects that can be known as chronic stress. But it can also affect you in a positive way like when you have a small amount it can lift your mood and give you a boost.
Caffeine can affect your cardio respiratory system in many ways. For example, it can affect your hearts pumping action in many bad ways. This is because their will be a huge amount of calcium inside of the cells in the heart.
This could also consist of causing an affect on the adrenaline. For example, caffeine can excite our brain cells in many ways which can later on tell our hormones/the pituitary gland that’s theres an emergency. The pituitary then tells the adrenaline to flood the body with adrenaline. Also knows as the “fight or flight” response.

Part A)

Caffiene can cause you to be stressed because it excites the brain which chains into the hormone, coristol to be released. Caffeine also increases adrenaline levels, it forces your brain to become attentive for a short amount of time. A large sum of these chemicals causes stress and has negative effects on the body. It causes the individual to become tired and unattentive. Another reaction to large doses of caffiene include rapid increase in calcium in the cells of the heart. The calcium slows down heart function and can lead to heart disease and in worst case scenario a stroke.

Better get Brainliest! Took a while to write.

Describe a law not discussed in this lesson designed to benefit an individual’s health. Justify your response using two or more complete sentences.

Answers

Answer:

The law of public urination being illegal is a law designed to benefit health. Urine is very unsanitary and a bio-hazard so a law against urinating in public helps so those chemicals are not out in the public.

Explanation: ( I Hope that helped with your question)

Students activities involved in relation to occupation work or job

Answers

Answer:

thats the awnser I'm gonna give 'em that 2, 4, 4 on the floor,

Like an outlaws boys on the day before.

Got the pretty girls out there begging for more,

Gotta give 'em all what they came here for.

Doin' my thing singing my song,

Right on track I'm chugging along.

I'm here and gone like yesterday,

Rolling like an old freight train.

On a wing and a prayer in a glorified greyhound bus,

Flying down the road running 9-0 and kicking up dust.

Drinkin' truck stop coffee

Countin' birds on those telephone wires.

Burnin' the midnight oil

And the tread off these Old Goodyear tires.

I'm gonna give 'em that 2, 4, 4 on the floor,

Like an outlaws boys on the day before.

Got the pretty girls out there begging for more,

Gotta give em all what they came here for.

Doin' my thing singing my song,

Right on track I'm chugging along.

I'm here and gone like yesterday

Rolling like an old freight train.

And sometimes my mind is a million miles away,

I know you're sound asleep at home while I'm on this stage.

And I'm missing you

Wishing I was kissing you everyday.

But girl I gotta keep rollin',

Rollin' like an old freight train.

And it's a mighty lonesome sound

When there's not soul around

To help you ease your pain,

But you gotta keep rollin'.

Rollin' like an old freight train.

I'm gonna give 'em that 2, 4, 4 on the floor,

Like an outlaws boys on the day before.

Got the pretty girls out there begging for more,

Gotta give 'em all what they came here for.

Doin' my thing singing my song,

Right on track I'm chugging along.

I'm here and gone like yesterday,

Rolling like an old freight train,

Comin' on down the line

Feel that diesel engine whine

Smell the smoke stack, hear the gears grind

Full steam ahead halfway out of my mind

I'm too far gone to be turning back going

Clickity clack down the railroad tracks.

I'm here and gone like yesterday

Rolling like an old freight train

Just like an old freight train.

Tell me do you wanna ride this train.

Explanation:

What is the purpose of mandatory immunizations?
A. To ensure low vaccination rates across the population
O B. To prevent suffering and death from preventable diseases
O C. To exempt children from vaccines that may harm them
O D. To prevent noncommunicable childhood diseases
SUBMI

Answers

Answer:

B

Explanation:

Mandatory vaccination refers to the forced immunization, which in turn is advantageous to the consumer. The answer is option B.

Immunization protects against vaccine-preventable infections and prevents severe sickness. Hepatitis B, paralysis of limbs, amputation of legs or arms, brain injury, hearing loss, and brain malfunction are some of the vaccine-preventable disorders.

Immunization protects against a variety of complex diseases. For example, humans are affected by a slew of autoimmune illnesses. These disorders, ranging from diabetes to osteoarthritis, have no lasting cure. Building a stronger immune system lowers the risk of autoimmune diseases.

Some of the illnesses may spread and affect the entire community. Immunized people represent little to no chance of contracting pandemic diseases.

Therefore, immunizations prevent long-suffering and death from preventable disease.

Learn more about immunity here:

https://brainly.com/question/28302493

#SPJ5

How do u break up with someone and not hurt their feelings?

Answers

Throw them across the room and say "IM BREKING UP WITH YOU"

Answer: fake your death

Explanation:

How do doctors use hemoglobin levels to decide
whether or not someone was blood doping?
Please help me IM FAILING MY CLASSES T-T

Answers

Hemoglobin is a protein that is produced by the body that carries oxygen in the read blood cells the more read blood the more hemoglobin you have if the athletes have a high level of hemoglobin on the day of the race than it had ben days or weeks before, to shows that the athlete was blood doping.

Just do the check boxes please will give brainliest.

Answers

Answer:

hmmmmmmmmmmmmm

Explanation:

What do you do when you're given the choice to hurt someone you love or hurt a friend

Answers

Answer:

..you choose to hurt neither there is alway another way

Explanation:

Maybe its just me but if i were ever given that choice i would choose to hurt myself rather than hurt them

In what way does population education help to control widespread poverty?​

Answers

Answer:

Explanation:

It is not just a problem of increasing poverty, growing numbers of illiterates, it should make rich countries do all they can to prevent overpopulation and the  issues in a way which is personally meaningful and socially relevant.

What is a disease that involves the breakdown of air sacs in the lungs?

Answers

Answer:

Emphysema

Explanation:

it breaks down the lungs over time making it harder and harder to breathe.

Emphysema. Over time, the inner walls of the air sacs weaken and rupture — creating larger air spaces instead of many small ones.

Would you say that pizza is a well balanced meal? Why or why not? (2 marks)

Answers

Answer:

pizza is a combination of protein, carbohydrates, and fat. Pizza contains carbohydrates which are the crust, plus protein and fat, the cheese

Explanation: Hope it helps

Answer:

Pizza is not a well-balanced meal. Yes, it has protein, but it is high in fats. A lot of the fats in pizza arent good.

Explanation:

When one forces another to have sexual relations, it is called _____?

Answers

Answer: Sexual Assault

Explanation:

Sexual harassment, me and my girlfriend were talking and looking it up yesterday, hope this helps! :)

Your grandma has been smoking for about 10 years. When you talk to her about quitting, she says that she's so old that it won't make a difference. What could you say to her in response to encourage her to quit?

Answers

Answer:

I would tell her that quitting smoking is never too late. Think about how spending a couple more years with her grandkids, and loved ones could be tremendously memorable. Yes, quitting drug addictions and any addictions in general are difficult, but worth a try.

Explanation:

Give four reasons why many people have problems with credit cards.

Answers

Answer: Medical bills, divorce, underemployment and gambling

Explanation: thts 4 my ladie

Answer:

1.)Your Payments Are Late or Missing

2.)Your Annual Fee Is Too High

3.)You Have Too Much Debt

4.)Your Credit Card Doesn't Work in Foreign Countries

Explanation:

Other Questions
When a story is told from the _____, the narrator has full knowledge of all the characters. omniscient third-person point of view reliable first-person point of view unreliable first-person point of view limited third-person point of view The product of the ages of two adults is 572. Find their ages. Guys, I need help ASAP!! The standard deviation of the following data set is 0.31. 95% of the data would fall in which range?4.3, 5.1, 3.9, 4.5, 4.4, 4.9, 5.0, 4.7, 4.1, 4.6, 4.4, 4.3, 4.8, 4.4, 4.2, 4.5, 4.4Pr (3.88 X 5.12)Pr (2.67 X 5.33)Pr (4.19 X 4.81)Pr (3.57 X 5.43) ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut a student performed an experiment, using a cocktail peanut, before it was burned the peanut half weighed .353 g. After burning the residue weighed .016 g. The energy released by the conjunction increased the temperature of 200. mL of water in the calorimeter by 7.2 degrees Celsius. Calculate the mass of peanut consumed in the combustion. twice the sum of k and 9 is 4 The product of a number and -5 is at least 35. Write as an inequality. who killed the district judge during the revolutionary movementanswer in one sentence Quick question for you all People who complain that video games involve too much sitting are probably old. They probably dont know very much about gaming, either. They dont realize that people can play virtual sports, such as tennis, on video games. There are video games for dancing, too. If people bothered to learn about the different kinds of video games, they would see how wrong they are. This students sample paragraph addresses the counterclaim. Critique this paragraph by answering the questions.What is the counterclaim?Video games are too violent.Video games make people inactive.Video games are different today.What evidence weakens the counterclaim?People who complain are old.Sitting too much is bad for people.There are video games for sports and dancing.What is the tone of the rebuttal?respectfulrudehumorous Mention the type of seeds that undergo hypogeal germination.What do we call the process of permanently stopping babies from breast feeding?plzz help it is due today 2) look closely at article XLVII. Rephrase it in your own words. How do you think this impacted the unity among slaves during the revolution?Please I need help! Use the interactive tool to graph the line given the following information: coordinates (1,3) slope of 2Based on your investigation, what is the value of b for the point (0,b)? what is carbogen and it's uses Please help!!!! ASAP!!! Thank you!!! Brainliest to right answer also based on answer 1 are the equations equivalent? help will give brainlyist and 5 star and heart (MC)Read the narrative and determine the point of view:"As you walked along the beach with your mom, you knew it was time to tell her the facts about what happened. She may never pardon you for your deceit, but you sense that she deserves to know. You think that to regain her trust, you need to demonstrate responsibility now for what you did and be honest about it." (5 points) aFirst person bSecond person cThird-person limited dThird-person objective eThird-person omniscient Why did the results of the presidential election of 1867 anger many democrats What percentage of the population of the colonies were patriots