a, b, c, or d. first answer gets brainliest

A, B, C, Or D. First Answer Gets Brainliest

Answers

Answer 1
Answer: B

Explanation: You can eliminate A and C right off the bat bc there not pushing towards each other and it’s not D bc this is the ground not high off of the ground like a mountain so therefore the answer is B

Related Questions

Food we eat has not been modified through selective breeding.

a) True
b) False

*No wrong answers please.*​

Answers

Answer: True.

Quizlet is a very good resource to use for problems like this.

Food we eat has not been modified through selective breeding. This statement is true.

What is selective breeding?

Selective breeding is the process where individual organisms with certain desirable traits are selectively bred for the purpose of propagating that particular trait.

Selective breeding is applied in agriculture for the purposes of rearing or cultivating high yielding breeds of farm animals and crops.The food we eat has been modified through selective breeding. Hence the statement: Food we eat has not been modified through selective breeding.

Milk production selective breeding has bee applied in milk production by selectively rearing cows with high milk production as planting of disease-resistant crops selective breeding has been applied in the cultivation of disease resistant crops.

Therefore, Food we eat has not been modified through selective breeding. This statement is true.

Learn more about selective breeding at:

brainly.com/question/11243665

#SPJ1

(HELP ASAP 15 POINTS)
Is the coloring of the peppered moths an example of competition, differential reproductive success, or inherited variation? Explain why.

Answers

Answer:

Peppered moths get their color in lieu to become the fittest among all so that they can survive easily.

Answer/Explanation:

Differential reproductive success.

When the Birch(white) trees were covered in soot(making them black). The black pepper months could blend in to the tree while the white moths stood out.

When the Birch(white) trees were clean and white. The white pepper moths could blend in to the tree while the black moths stood out.

This is an example of differential reproductive success. Who ever could blend in with the tree had the better genes because it made them difficult to be spotted. The other type of moth would be not so lucky, easily spotted an eaten. The better gene lead is "successful," because that moth could live longer because of its characteristics..

Which molecule has the most energy?
a. carbon dioxide
b. ATP
C. oxygen
d. glucose

Answers

Answer:

D glucose

Explanation:

the original molecule at the beginning of the pathway would have the highest amount of free energy.

The answer would be B. ATP!

Please help me
Which particle, protons, neutrons, or electrons, has the LEAST mass?

Answers

Answer:

Electrons are much smaller in mass

Explanation:

Although similar in mass, protons are positively charged, while neutrons have no charge. Therefore, the number of neutrons in an atom contributes significantly to its mass, but not to its charge. Electrons are much smaller in mass than protons, weighing only 9.11 × 10−28 grams, or about 1/1800 of an atomic mass unit.

Which of the following is NOT ​

Answers

Answer:

Psychrometer

Explanation:

When a food handler can effectively remove soil from equipment using normal methods, the equipment is considered what?

Answers

Answer:

Cleanable

Explanation:

Cleanability refers to the ease with which microorganisms or particles can be removed from the equipment used in food production. To be cleanable the roughness of the machine being employed in production is not expected to exceed 0.8μm.

The Atomic Force Microscope is used to measure the surface roughness of machines. Cleanability is important as it ensures that the machines used in food production are safe.

When a food handler can effectively remove soil from an equipment by using normal methods, the equipment is considered to be; Corrosion Resistant.

The soil referred to her would be dirt because we are talking about a food handler.

Now, if the food handler is finding it difficult to remove dirt from the equipment by using normal/regular methods, it means that the soil/dirt has succeeded in having some kind of chemical reaction with that equipment.

If that is the case, then it means the equipment is undergoing corrosion because corrosion is defined as the gradual destruction of a metal by chemical reaction with the environment.

Since we have established that inability to use normal method denotes corrosion, then if he can use normal methods to remove the soil effectively, then the equipment is said to be corrosion resistant.

Read more at; https://brainly.in/question/40223031

This picture shows a phospholipid bylayer. What crucial function do the nonpolar tails of the phospholipids have?

A) keep water-soluble substances from passing easily into the cell
B) help encode genetic material
C) allow water-soluble substances to pass easily into the cell
D) speed chemical reactions with enzymes

Answers

Answer:

It is B

Explanation:

I had this question on my test last week.

What is the relationship between the biodiversity of an ecosystem and its
ability to rebound from disturbance?
A. A biodiverse ecosystem is not affected in any way by disturbance.
B. A biodiverse ecosystem harbors many interactions, thus a
disturbance may impair some interactions, but not all.
C. The relationship between the biodiversity of an ecosystem and its
ability to rebound from disturbance is unknown.
D. A biodiverse ecosystem has so many interactions that the
slightest disturbance will destroy it.

Answers

Answer:

B. A biodiverse ecosystem harbors many interactions, thus a  disturbance may impair some interactions, but not all.

Explanation:

Biodiversity is the variation of life forms in an environment. This is as a result of available nutrient and energy to support the various life forms.

The relationship between biodiversity and rebound from disturbance is such that a biodiverse ecosystem is able to resist any change. The disturbance might affect proportion of the populace. But on the long organisms can survived and be propagated again.

Answer:

B is correct just did the quiz

Explanation:

Since photosynthesis primarily takes place in the leaves, it is essential that glucose can be transported out of the
cell to other parts of the plant. The selectively permeable plasma membrane only allows certain molecules to
cross freely through the phospholipid bilayer.
Is glucose a molecule that is allowed to cross the selectively permeable membrane freely?

Answers

No it is to large of a molecule. It can not cross the membrane freely through simple diffusion. It moves across the membrane through facilitated diffusion. *Ignore the idiot who answered first, hope this helped

Answer: A

No, glucose passes through a channel protein with the concentration gradient via facilitated diffusion.

Explanation:

Test on edge

Have a great day! ;)

What happens to the matter? How does it transform? What
are the inputs and outputs?

Answers

matter is neither created nor destroyed it only transforms

PLEASE HELP QUICKLY! ANSWER AS MANY AS POSSIBLE. DO NOT ONLY SAY "I don't know"
1. How do we know the continents were ever connected (what evidence do we have)?
2. What does the map show about the Earth 225 million years ago ?
3. In what era was the Mesosaurus alive?
4. What animal do you think the Lystrosaurus is related to today and WHY?

Answers

Answer:

1. Wegener then assembled an impressive amount of evidence to show that Earth's continents were once connected in a single supercontinent. Wegener knew that fossil plants and animals such as mesosaurs, a freshwater reptile found only South America and Africa during the Permian period, could be found on many continents.

2. It shows that all continents started from a one large land mass. It might be named Pangea. Because people are close to each other, it's so easy to talk and talk about things not just about them but also about other people.

3.Mesosaurus, (genus Mesosaurus), early aquatic relative of reptiles, found as fossils from the Early Permian Period (299 million to 271 million years ago) in South Africa and South America.

4.The Lystrosaurus is a mammal-like animal from the early Triassic period that roamed modern day regions such as India, South Africa and Antarctica over 250 million years ago. It has tusks like an elephant and a beak similar to a turtle, and it was roughly the size of a pig.

Explanation:

hope that helps

what is it called if an ecosystem is changed by rising water temperature? Is it a physical, biological, or chemical change?

Answers

Not 100% sure but most likely a physical change caused by hotter air due to climate change?

PLEASEEEE HELPP!!!Name 2 uses for each of the following minerals: quartz, olivine and halite.

Answers

Answer:

quartz: is used 4oscillatorsvfor watches and it is a GPS equipment

Olivine: used as casting sand and for removing impurities from steel

halite: used as food seasoning and melt snow

Explanation:

Plzzzzzzzzzzzzz give me brainiest

Examine the unbalanced equation.
KClO3 → KCl + O2
What is the best classification for the unbalanced equation's reaction?

A.) decomposition
B.) combustion
C.) displacement
D.) synthesis

Answers

The answer is A.) decomposition

Got a 100% Hope that helps

What is the complementary strand of DNA that is made during DNA replication if the template/parent strand of DNA reads ATG GGC CAT?
A. TAC CCG GTA
B. UAC CCG GUA
C. ATG GGC CAT
D. CGA AAT AGC

Answers

The answer to this is A. The complementary strands are A-T, T-A, G-C, C-G, and U-A

The complementary strand of DNA that is made during DNA replication if the template/parent strand of DNA reads ATG GGC CAT is TAC CCG GTA. Thus, the correct option for this question is A.

What is DNA replication?

DNA replication may be defined as a type of biological process through which two identical replicas of DNA form from one original DNA molecule. This process makes a copy of the DNA in a cell is made before the cell divides.

When it comes to the complementary strand of DNA, either of the two chains makes up a double helix of DNA, with corresponding positions on the two chains being composed of a pair of complementary bases.

For example, if Adenine A is present in the parental DNA, then it should be complementarily bounded to the thymine and vice versa. Similarly, if Cytosine is present in the parental strand of DNA, then it should be complementarily bounded by guanine and vice versa.

Therefore, the correct option for this question is A.

To learn more about DNA replication, refer to the link:

https://brainly.com/question/21265857

#SPJ2

gases involved in photosynthesis of a plant and their roles ​

Answers

atmospheric oxygen- expelled as a waste product from the plant conducting photosynthesis, carbon dioxide- taken into the plant to go through photosynthesis and is used to make glucose.

Explanation:

Hope this helps. Please ignore my handwriting! I know it’s sloppy!

Please Help me as soon as possible.

In camellia plants, flower color is controlled by a single gene with codominant alleles. A camellia plants with red flowers (RR) is crossed with a camellia plant with white flowers (WW). What are the expected phenotypes of the offspring of this cross?
A.
All will have red flowers.
B.
Half will have red flowers and half will have white flowers.
C.
All will have both red and white flowers.
D.
All will have pink flowers.

Answers

Answer:

The answer is; c

It is important to distinguish between codominance and incomplete dominance.

In incomplete dominance, the two alleles blend with each other in phenotype  giving offspring with intermediate phenotypes, hence offspring would produce pink flowers, in this case.

In codominance, both alleles are simultaneously expressed in phenotype in the offspring. Therefore flowers, in this case, would exhibit both red and white colors.

Explanation:

A(n) ______ is a procedure that a computer follows to complete a specific task. *
algorithm
biometric
machine learning
software

Answers

Algorithm is the answer

Answer:Is machine learning

Explanation:I know

Use the weather map to answer the question.

Weather map with blue line with triangles pointing down and to the right. Red line with semi-circles pointing up and to the right. Red line is to the right of the blue line.
© Dorling Kindersley / Universal Images Group / Image Quest 2016

What does the red line indicate?

A cold front is moving to the north and east.
A cold front is moving to the south and west.
A warm front is moving to the north and east.
A warm front is moving to the south and west.

Answers

Answer:

It is C!

Explanation:

when they are half circles on the line, that means it will be a warm front.

The other answerer got it wrong

Based on the information above, which of the following is true about the process in which the genetic code stored in DNA is used to
produce protein products?
A. This process occurs only in embryonic cells directly after fertilization,
This process only occurs in animal cells because it requires the presence of ribosomes.
This process does not require an input of energy because it is semi-conservative,
D.This process requires the interaction of several different cellular structures,

Answers

Answer:

D.This process requires the interaction of several different cellular structures,

Explanation:

We don't have the information above. However, this process occurs in all cells, and it requires energy. Semi-conservative refers to the fact that, during DNA replication, each new molecule of DNA is made up of one strand of the original DNA molecule and one strand of a new molecule.

The synthesis of proteins from the information in an mRNA molecule does require several structures in the cell, including the nucleus, ribosomes, endoplasmic reticulum and Golgi apparatus.

No plagiarizing from websites!
Many people feel the use of stem cells has great potential for scientific and medical progress, while others have been opposed to it. Today there is a great deal of debate about stem cell research using pluripotent stem cells from an embryo. Provide an argument for people in favor of continuing stem cell research. Include in your answer the uses of stem cell research and a suggestion for obtaining a source of stem cells without risk to life. (2 points)

Answers

Answer:

Stem cells can benefit humanity in a variety of ways, one, being the ability to develop into another cell. This is remarkable for people who have diseases and or health issues, requiring them to replace cells that they lack. Not only that, but they help treat diseases like stroke, heart disease and diabetes.

Feedback is always appreciated. Hope this helps you.

are bones living or non living and why

Answers

Answer:

i think they are non living

Explanation:

because they dont have organs or blood or anything

Answer:

Bones are non living

Explanation:

1: Bones don’t movement on their own

2: Bones don’t have cells

3: Bones do bot breathe

4: They do not count on anything to survive

5: They are just something that helps a living organism to move

What will help decrease the demand on natural resources?
improvements in technology
b controls in population growth
c conservation of resources
d all of the above

Answers

i believe it is d all of the above

Give two examples each of centrifugal force​

Answers

Answer:

Centripetal Force Vs Centrifugal Force.

Explanation:

Answer:

♡ hi there, fairy! ♡

- two examples of centrifugal is when mud flicks off of a car tire

and when a car drives around a curve. hope i could help!

-madi/madeline

✧・゚: *✧・゚:・゚✧*:・゚✧・゚: *✧・゚:・゚✧*:・゚✧

Explanation:

In which of the following taxonomic groups would organisms have the least number of similarities?
O kingdom
class
O family
genus

Answers

Answer:

Family genus

Explanation:

brainleist answer pweessss

The taxonomic group that would have the least number of similarities, family genus.

What is the genus?

Genus is a taxonomic unit, comes before species and after family.

Genus contain phylogenetically and structurally similar organism

For example, genus Canis contains all species or breeds of dogs.

Thus, the correct option is B, family genus.

Learn more about genus

https://brainly.com/question/1886180

What medical conditions do scientists hope botulinum will help? Check all that apply. *

hyperactive muscles
Parkinson’s disease
cerebral palsy
common cold

Answers

Answer:

hyperactive muscles

Parkinson’s disease

cerebral palsy

Explanation:

aaag jus truss me

15. What is meant by combustion?​

Answers

Answer: D.

Explanation: Please give me Brainlest Please

this is all from a crossword puzzle Across
7. Organisms which make their own chemical energy.
8. Long whip-like tail, used for locomotion.
9. Organisms which need oxygen to survive
10. Attachment points for bacteria
12. Small organelles involved in making proteins.
13. Name for true, modern bacteria.
14. Name for "squiggly" shaped bacteria.
15. Small circular segment of DNA. Often exchanged
between bacteria.
16. Photosynthetic bacteria containing chlorophyll a &
b.
Down
1. Organisms which obtain energy by consuming organic
material.
2. Structures which bacteria form to endure adverse
situations.
3. Name for all contents of a cell, except for nucleus.
4. Ancient bacteria often found in harsh environments
5. Name for rod-shaped bacteria.
6. Name for round shaped bacteria.
7. Organisms which do not require oxygen to survive.
11. The act of two bacteria joining and exchanging DNA.​

Answers

Answer:

7.autotrophs

8flagella

9.aerobe

10.pilus

12ribosomes

13 Eubacteria

14Spirillia

15Plasmid

16 photoautotrophic

1.heterotrophs

2endospores

3 cytoplasm'

4archeabacteria

5bacilli

6cocci

7anaerobec

11 conjugation

Explanation:

How do we detect the cosmic microwave background radiation?
by looking for radiation at the blue end of the spectrum

through radio telescopes

by looking for a glow in the night sky

through magnifying glasses

Answers

Answer:

Through radio telescopes :)

Explanation:

Answer:

through radio telescopes

Which of the following is an example of an ecosystem service that would provide protection from a hurricane storm surge?

A lock and dam system

An intact coastal wetland

An energy-producing tidal barrage system

An offshore, deep-water fish farm

Answers

Answer: An intact coastal wetland

Explanation:

Hurricane storm surges results when the water level rises above normal as a result of a storm and therefore goes inland from the coast far deeper than it normally does.

Normally this can destroy things next to the coast by washing them away but some ecosystem services can provide protection against this such as an intact coastal wetland. Being intact, there are less chances of being washed away and as it is a wetland it is used to high levels of water and can even absorb some of the surge.

Other Questions
HELP PLEASE PLEASE PLEASE!!The function f(x) = 4x 8 is reflected across the y-axis, resulting in a new function, g(x). Write the EQUATION of g(x). Please show how you got it!!! are the triangles congruent? if they are, state how they are congruent. Plz help!In order for the parallelogram tobe a rectangle, x = [? ]13x+34910x+10 How will you display the contribution in your museum Plz plz plz plz plz plz helppppp As a client becomes more fully functioning during the course of several psychotherapy sessions,we would expect the correlation between his or her real and ideal selves to:________.A) decrease.B) stay the same.C) increase.D) do any of these, for the correlation is unrelated to progress in therapy. What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees! Persuasive SpeechIntroductionA. Imagine going out to eat at a restaurant, and you read entrees like "fried human legs" and "human baby parmesan."B. I believe the world would be a happier, healthier, more humane place if everyone were vegetarian -- you should become one!C. Today I am going to enlighten you all about the animal cruelty involved with food processing that goes on behind closed doors, and the healthier lifestyle of being vegetarian.[First let me tell you a little bit about what else your are eating when you choose to eat meat.]BodyA. Every year billions of animals are raised and slaughtered for human consumption. In todays factory farms animals are confined to extremely small spaces so farmers can concentrate on maximizing production.1. This over crowding breeds disease, so the animals are fed antibiotics and sprayed with pesticides.2. The animals are also fed growth hormones.3. So, the chemicals, antibiotics and hormones are passed on to the consumers.4. USDA fact sheet, bacterial contamination of animal products often causes illness and death. Salmonella poisoning can be fatal.5. Time Magazine, bad chicken is responsible for at least 1,000 American deaths each year.[Now, here are some more disturbing facts you should know about meat production.]B. According to the Animal Protection Institute, in the U.S. alone, every year 41.8million beef cattle, 115 million pigs, and 8.785 billion chickens are slaughtered for human consumption. The animals endure much more.1. Beef cattle called "downers" are prodded or dragged to the slaughterhouse, or left without food or water to die.2. Pigs are stunned, hung upside down before their throats are cut and bled to death. If missed, they go to the scalding tank where they may be boiled alive.3. Crowed, chickens peck each other to death. Instead of providing space farmers "debeak" them by cutting off their upper beak with a hot blade.4. I would like to show you some photos taken inside a slaughterhouse.[If animal cruelty is not enough to change your mind, then maybe your own health concerns will make a difference.]C. Studies show meat-eaters are twice as likely to die from heat disease, and 60% more likely to die from cancer than vegetarians.1. Meat consumption has been linked to many diseases, osteoporosis, diabetes, kidney disease, hypertension, and obesity.2. Quoted by William Roberts, MD, editor and chief of The American Journal Of Cardiology, "When we kill animals to eat them, they end up killing us because their flesh, which contains cholesterol and saturated fat, was never intended for human beings, who are natural herbivores."ConclusionI hope that I have enlightened you all about the matters of vegetarianism, and I hope you all will make the right moral and health decisions as I have. Quote by Leonardo de Vinci, "I have, from an early age renounced eating meat. The time will come when we will look upon the murder of animals as they now look upon the murder of humans.Review the persuasive speech outline.If this speech was given to an audience full of people who worked for the cattle industry, what would the speaker have to accomplish?a.motivate them to become meat eatersb.change their beliefs about meatc.weaken the audiences attitude towards vegetablesd.strengthen the audiences attitude towards meat what was the reaction to the proclamation of 1763 by colonists? About 1/5 of all adults in the United States have type O blood. If four randomly selected adults donate blood, find the probability of each of the following events. a. All four are type O. b. None of them is type O. c. Two out of the four are type O . Whats the answer for this question guys??? a copper ore contains 3.00% of copper carbonate, CuCO3, by mass. Which mass of copper would be obtained from 1 tonne of the ore? A 1.91kg B 3.71kg C 15.3kg D 58.4kg If you travel 7.5 km and walk for 1.5 h, what is your average speed? Show your work?