"by the smell/ of too old
potato ..." has an example
of what poetic sound
device?

assonance
consonance
onomatopoeia
alliteration

Answers

Answer 1
I believe the answer is a consonance.

Related Questions


By his talent and physical prefence, (2)he disrupted the concentration of pitchers catchers, and middle infielders.

Read the passage underlined (2). There may be a mistake in punctuation, capitalization, or spelling. If you find a mistake, choose the
answer that corrects the mistake. If there is no mistake, choose 'Correct as is.

Answers

Answer:

op bro op one number op sorry bro for that answer ☺️

Describe the role self-esteem plays in bullying?

Answers

Answer:

Self-esteem plays an important role in building. Many bullies consciously or unconsciously have low self-esteem which consequently tends to cause them to put others down. They don't feel good about themselves so they put others down to make themselves feel better. They have such low self-esteem they try to lower others self-esteem.

Explanation:

Answer:

If you have too much self-esteem, you are overconfident and full of yourself. You always think you are better than other and they should admire you. You make your targets that you are bullying feel down for who they are because, in your opinion, you are considered the best. Therefore, self-esteem is a main role that plays in bullying because it makes you make the person you are bullying feel lower than your standards.

Select ALL the correct answers.
Read the sentence from the passage.

DNA, or deoxyribonucleic acid, is the hereditary material in humans and almost all other organisms.

Which two words from the passage help the reader understand the term organisms?

Answers

Answer:

humans

other

Explanation:

The two words from the passage that help the reader understand the term 'organisms' are DNA and humans.

What is an organism?

A living being that is made of at least one cell and is able to successfully survive and continue to live its life by carrying daily activities is known as an organism. Each organism has a few traits, which are common to all.

DNA is a characteristic of an organism, which is unique for each and every organism, whereas, humans are a type of multicellular organisms.

Hence, the significance of an organism is aforementioned.

Learn more about an organism here:

https://brainly.com/question/12825206

#SPJ2

What is the difference between literal meaning and deeper meaning? Remember to answer in complete sentences.

Answers

Answer:

Literal meaning directly tells what it means. Deeper meaning requires more thoughts because it has a different meaning than what is said.

the literal meaning is more straight forward like, "I don't like ice cream" but the deeper meaning is more than just not liking the ice cream. The deeper meaning would be like "Because something bad happened that involved ice cream"

What is a bandwagon advertisement

Answers

Answer:

Makes it seem like lots of people support something and make the audience not want to miss out on something.

Explanation:

Answer:

To try to persuade someone to do something based on the fact that "everyone's doing it"

Explanation:

what are the 7 characteristics of a tragedy

Answers

Answer:

7 characteristics  ( i hope this helps)

Explanation:

i couldnt find the 7th but here is the first one that is correct:

1: bad things happen to good people

2: Protagonist has to be high born (important in society)

3: Protagonist has a fatal flaw

4: Tragedy of the play flows from the fatal flaw

5: At some time, protagonist has moment of realization and discovers what has happened and why they're responsible (usually at the end)

6: Action should take place in a day or less

here is another 7 that are correct too:

1) it is mimetic

2) it is serious

3) it tells a full story of an appropriate length

4) it contains rhythm and harmony

5) rhythm and harmony occur in different combinations in different parts of the tragedy

6) it is performed rather than narrated

7) it arouses feelings of pity and fear and then purges these feelings through catharsis. A tragedy consists of six component parts, which are listed here in order from most important to least important: plot, character, thought, diction, melody, and spectacle.

Normal or regular syntax follows which pattern? Answer choices: beginning, middle, end verb, subject, object subject, verb, object article, subject, verb

Answers

Answer:

The correct answer is:

subject, verb, object

Explanation:

In the English Language, the syntax is a set of rules that dictate the structure or pattern of a sentence. In normal or regular syntax styles, the pattern of the components is Subject, Verb and Object.

The Subject is the performer or an action in a sentence

The Verb is the "doing word" that talks about the action being performed, while the Object is the part of the sentence on which the action is performed.

Please consider this example:

The boy chased the dog

Subject : the boy

Verb : chased

object: the dog.

if you know who these 3 ppl are WE HAVE TO BE BESTIES

Answers

Answer:

lunay chain

bad bunny

Myke towers

Explanation:

The following sentence is punctuated correctly.

Waiting for the waitress to take his order Jimmy hungrily studied the menu.

True
False

Answers

Answer:

false

Explanation:

the correct sentence would say "Waiting for the waitress to take his order, Jimmy hungrily studied the menu.

A noun, okay I know that's person, place or thing
The ground, a place I never want to go again
Smile, remember I was down I never did
Its up if you ain't down are you out are you in
My mama, girl you know I love you till the end
My lil boy, Ima teach you how to be a man
Never run, stand tall son whole ten
A street ni%%a, that's what everybody be portraying

who sung this song

Answers

Answer:

You can type the lyrics in on Google and it'll show you the song

which of the lines below from the poem missing sample of imagery​

Answers

Answer:

"And leaps the warrior’s at the shine / And flash of kindred swords!"

Explanation:

D

In Anne Frank: The Diary of a Young Girl, how does Anne respond to the complaints of the members of the Secret Annexe that she is spoiled?

a. She immediately changes her behavior to please the others because she hopes to lead by example.
b. She refuses to acknowledge that she is spoiled and resolves to prove to the others that she is not.
c. At first, she behaves even more petulantly, but later she tries to be more considerate of the others while remaining true to herself.
d. She confides the true meaning of her behavior to the others so that they will understand and accept her.

Answers

The inference is that Anne respond to the complaints of the members of the Secret Annexe that she is spoiled as c. At first, she behaves even more petulantly, but later she tries to be more considerate of the others while remaining true to herself.

What is an inference

It should be noted that an inference simply means the conclusion that can be deduced based on the information that given in a passage.

In this case, the inference is that Anne respond to the complaints of the members of the Secret Annexe that she is spoiled as at first, she behaves even more petulantly, but later she tries to be more considerate of the others while remaining true to herself.

This was from Anne Frank: The Diary of a Young Girl. In conclusion, the correct option is C.

Learn more about inference on:

brainly.com/question/25280941

#SPJ1

Answer:

C. At first, she behaves even more petulantly, but later she tries to be more considerate of the others while remaining true to herself.

Explanation:

I took the quiz and got it right

Many librarians have graduate degrees.
True
OB.
False

Answers

it's true............

Answer:

The answer is true

Which TWO phrases from the text best support the answers to Part A?

Answers

Answer:

there is no text think u forgot it and ps. theres no part A either

Explanation:

hope u remember next time :D

50 verbs past present future to copy paste now please

Answers

Answer:

Act Answer Approve Arrange

Break Build Buy Coach

Color Cough Create Complete

Cry Dance Describe Draw

Drink Eat Edit Enter

Exit Imitate Invent Jump

Laugh Lie Listen Paint

Plan Play Read Replace

Run Scream See Shop

Shout Sing Skip Sleep

Sneeze Solve Study Teach

Touch Turn Walk Win

Write Whistle Yank Zip

Explanation:

Answer:

hope this helps

Explanation:

What is Grover officially?
dog
human
satyr
goat

Answers

Answer:

dog

Explanation:

The system used by hearing-impaired people to spell out words is known as _____. a)American Sign Language
b)Signed English
c)finger
I WILL ONLY GIVE BRAINLIEST TO SOMEONE WHO ANSWERS!!!!⊕

Answers

a, american sign language

Answer:

C: finger spelling

Explanation:

What is the meaning of this quote “ home is where the hearth is”

Answers

Answer:

The phrase means that no matter who you are with or where you are in the world, your family and home always have the deepest affection and emotional pull. It is the place where you have a foundation of love, warmth, and happy memories. It might not always be the building itself, but being near your loved ones.

Answer:

familes gather in front of the fireplace sometimes. hearth is the fireplace.

Explanation:

if any questions, let me know

Select the correct text in the passage. Read this excerpt from Alice Gerstenberg's Alice in Wonderland. Which line of dialogue shows that Humpty Dumpty is proud of his appearance? ALICE: My name is Alice, but- HUMPTY DUMPTY: It's a stupid name enough, what does it mean? ALICE: Must a name mean something? HUMPTY DUMPTY: Of course it must, my name means the shape I am-and a good, handsome shape it is, too. With a name like yours, you might be any shape, almost. ALICE: You're Humpty Dumpty! Just like an egg. HUMPTY DUMPTY: It's very provoking, to be called an egg-very. ALICE: I said you looked like an egg, Sir, and some eggs are very pretty, you know. HUMPTY DUMPTY: Some people have no more sense than a baby. ALICE: Why do you sit here all alone? HUMPTY DUMPTY: Why, because there's nobody with me. Did you think I didn't know the answer to that? Ask another. ALICE: Don't you think you'd be safer down on the ground? That wall's so very narrow. HUMPTY DUMPTY: What tremendously easy riddles you ask! Of course I don't think so. Take a good look at mel I'm one that has spoken to a king, I am, to show you I'm not proud, you may shake hands with me!

plz help me soon!!!​

Answers

Answer:

The line "Of course it must, my name means the shape I am-and a good, handsome shape it is, too. With a name like yours, you might be any shape, almost" shows Humpty Dumpty is proud of his appearance.

Explanation:

In his other lines of dialogue, Humpty is clearly arrogant and proud, but this line specifically shows that he is proud of his shape and looks.

Why are first jobs important??

Answers

Answer:

Your first job serves as a springboard for your professional future.

Explanation:

PRETEST
Directions: Read the following sentences carefully. Identify whether the underlined
words is a phrase, a clause or a sentence.
1. You have been sleeping for a long time._____

Answers

Answer:

For a long time.

How u have sleeping for "a long time"

Which element from "The Three Sisters" is drawn from "The Three Fates" of Greek mythology?

Answers

Answer:

isnt that the medusa

Explanation:

Paraphrase this passage from Alaska Centers.

Answers

Answer:

If you can provide the passage in the comments or edit the question I would be happy to help you!

Answer:

By the 1920s, dogsleds had long been the primary means of travel for mail, cargo and people in the vast wilderness of Alaska. Recent advances in aircraft technology however were quickly making air travel a favored transportation mode in remote Alaska and dogsledding would soon become obsolete.

Explanation:

The___
includes all of the crust and the upper part of the mantle.

Answers

Answer:

Earth's lithosphere

Explanation:

Earth's lithosphere includes the crust and the uppermost mantle, which constitutes the hard and rigid outer layer of the Earth. The lithosphere is subdivided into tectonic plates.

Match the situation to the correct mood.

Your Bassett Hound puppy runs toward you as you call his name. He runs as fast as his stubby uncoordinated legs can carry him toward the sound of your voice. As he runs, one of his long ears gets caught under him and he trips a little; then he trips a lot. The puppy tumbles head over rear, as a little brown snowball, down the hill. He gets up, shakes his head, keeps running toward you, and then trips again. You are now crying from laughing so hard as you go to pick up your puppy and reward his efforts with a big hug.

Answers

Answer:

humorous

Explanation: He Almost Died Of Laughter

Read the excerpt from The Odyssey.

The wind that carried west from Ilium
brought me to Ismarus, on the far shore,
a strongpoint on the coast of Cicones.
I stormed that place and killed the men who fought.
Plunder we took, and we enslaved the women,
to make division, equal shares to all—
but on the spot I told them: 'Back, and quickly!
‘Out to sea again!' My men were mutinous,
fools, on stores of wine. Sheep after sheep they
butchered by the surf, and shambling cattle,
feasting,—while fugitives went inland, running
to call to arms the main force of Cicones.
This was an army, trained to fight on horseback
or, where the ground required, on foot. They came
with dawn over that terrain like the leaves
and blades of spring. So doom appeared to us,
dark word of Zeus for us, our evil days.
My men stood up and made a fight of it—60
backed on the ships, with lances kept in play,
from bright morning through the blaze of noon
so holding our beach, although so far outnumbered;

Which central idea should be included in a paraphrase of this excerpt?

The forces sent by Cicones to fight Odysseus and his men arrived during the early morning hours.
Odysseus and his men fought the forces of Cicones better on the ships than on land.
The forces sent by Cicones to stop the plundering of Odysseus and his men were skilled and powerful.
Odysseus views the army sent by Cicones as punishment from the Greek god Zeus

Answers

Answer:

C

Explanation:

Answer:

The forces sent by Cicones to stop the plundering of Odysseus and his men were skilled and powerful.

Explanation:

just took the test

Where did Romeo and Juliet kiss?​

Answers

The cupulet ball hope that helped

4
2 points
Explain the underlined allusion Mercutio makes in this passage.

Answers

I believe it’s an allusion to the fact that Romeo has already been slain by love, and isn’t up for a fight with Tybalt

help me i need it plzz answer

Answers

Answer:

animal

Explanation:

Read the following paragraph. 1 chewing animal would not eat the chilis hot fruit. 2 good things, too because chewing was gonna hurt the seeds.3 Birds ate the pepper, however.4 the seeds passed through the birds and landed on the ground to sprout new plants.
which sentence should be changed so it has the right tone
A. Sentence 2
B. Sentence 1
C. sentence 4
D. sentence 3

Answers

Answer:

2

Explanation:

Other Questions
Plz plz plz plz plz plz helppppp As a client becomes more fully functioning during the course of several psychotherapy sessions,we would expect the correlation between his or her real and ideal selves to:________.A) decrease.B) stay the same.C) increase.D) do any of these, for the correlation is unrelated to progress in therapy. What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees! Persuasive SpeechIntroductionA. Imagine going out to eat at a restaurant, and you read entrees like "fried human legs" and "human baby parmesan."B. I believe the world would be a happier, healthier, more humane place if everyone were vegetarian -- you should become one!C. Today I am going to enlighten you all about the animal cruelty involved with food processing that goes on behind closed doors, and the healthier lifestyle of being vegetarian.[First let me tell you a little bit about what else your are eating when you choose to eat meat.]BodyA. Every year billions of animals are raised and slaughtered for human consumption. In todays factory farms animals are confined to extremely small spaces so farmers can concentrate on maximizing production.1. This over crowding breeds disease, so the animals are fed antibiotics and sprayed with pesticides.2. The animals are also fed growth hormones.3. So, the chemicals, antibiotics and hormones are passed on to the consumers.4. USDA fact sheet, bacterial contamination of animal products often causes illness and death. Salmonella poisoning can be fatal.5. Time Magazine, bad chicken is responsible for at least 1,000 American deaths each year.[Now, here are some more disturbing facts you should know about meat production.]B. According to the Animal Protection Institute, in the U.S. alone, every year 41.8million beef cattle, 115 million pigs, and 8.785 billion chickens are slaughtered for human consumption. The animals endure much more.1. Beef cattle called "downers" are prodded or dragged to the slaughterhouse, or left without food or water to die.2. Pigs are stunned, hung upside down before their throats are cut and bled to death. If missed, they go to the scalding tank where they may be boiled alive.3. Crowed, chickens peck each other to death. Instead of providing space farmers "debeak" them by cutting off their upper beak with a hot blade.4. I would like to show you some photos taken inside a slaughterhouse.[If animal cruelty is not enough to change your mind, then maybe your own health concerns will make a difference.]C. Studies show meat-eaters are twice as likely to die from heat disease, and 60% more likely to die from cancer than vegetarians.1. Meat consumption has been linked to many diseases, osteoporosis, diabetes, kidney disease, hypertension, and obesity.2. Quoted by William Roberts, MD, editor and chief of The American Journal Of Cardiology, "When we kill animals to eat them, they end up killing us because their flesh, which contains cholesterol and saturated fat, was never intended for human beings, who are natural herbivores."ConclusionI hope that I have enlightened you all about the matters of vegetarianism, and I hope you all will make the right moral and health decisions as I have. Quote by Leonardo de Vinci, "I have, from an early age renounced eating meat. The time will come when we will look upon the murder of animals as they now look upon the murder of humans.Review the persuasive speech outline.If this speech was given to an audience full of people who worked for the cattle industry, what would the speaker have to accomplish?a.motivate them to become meat eatersb.change their beliefs about meatc.weaken the audiences attitude towards vegetablesd.strengthen the audiences attitude towards meat what was the reaction to the proclamation of 1763 by colonists? About 1/5 of all adults in the United States have type O blood. If four randomly selected adults donate blood, find the probability of each of the following events. a. All four are type O. b. None of them is type O. c. Two out of the four are type O . Whats the answer for this question guys??? a copper ore contains 3.00% of copper carbonate, CuCO3, by mass. Which mass of copper would be obtained from 1 tonne of the ore? A 1.91kg B 3.71kg C 15.3kg D 58.4kg If you travel 7.5 km and walk for 1.5 h, what is your average speed? Show your work? what is the role of private security within the criminal justice system How does the U.S. Constitution best reflect the ideal of separation of powers? Giving brainliest In the equation 3x+7=15, the number 7 is a. At Summer camp, campers are divided into groups. Each group has 16 campers and 2 cabins. How many cabins are needed are needed for 48 campers? A: 14 B: 20 C: 6 D: 30