I really need help can someone please understand

Answers

Answer 1

sure what’s the problem


Related Questions

Write a system of equations to describe the situation below, solve using elimination, and fill in the blanks.

An employee at a construction company is ordering interior doors for some new houses that are being built. There are 2 one-story houses and 4 two-story houses on the west side of the street, which require a total of 64 doors. On the east side, there are 5 one-story houses and 4 two-story houses, which require a total of 88 doors. Assuming that the floor plans for the one-story houses are identical and so are the two-story houses, how many doors does each type of house have?

Each one-story house has
doors, and each two-story house has
doors.

Answers

Answer: This is a system of equations, let's set it up.  I set the variable for 1 story houses to x and 2 story houses to y.  Here are the two equations:

6x + 2y = 72

5x + 7y = 124.

Now we multiply the equations so that when we add them together one of the variables will be cancelled out.  I am going to multiply the top equation by 7 and the bottom equation by -2.  This gives us

42x + 14y = 504

-10x -14y = -248

Add the two equations together:

32x = 256

Divide by 32 to get x = 8.  The one story houses have 8 doors.  We can plug this number into one of the original equations and solve for y now.  I'm going to use the first equation.

(6*8) + 2y = 72  

Now we solve for y

y = 12  So, the 1 story houses have 8 doors and the 2 story houses have 12 doors.

If a function f is increasing on (a,b) and decreasing (b,c), then what can be said about the local extremism of f on (a,c)?

Answers

Answer:

The point (b, f(b)) is a local maximum.

Kayla drives 144 miles in 3 hrs. Kendra drives 224 miles in 4 hours. How much faster does Kendra drive on an average?

Answers

Answer:

12 miles per hour more

Step-by-step explanation:

Answer:

Kendra drives 8 hours more on average.

Step-by-step explanation:

We divide 144/3 to get Kayla's mile to hour.

That is 48 miles.

We divide 224/4 to get Kendra's mile to hour.

That is 56 miles.

56 - 48 = 8.

hope this helped!

Write the equation in slope-intercept form of a line that has a slope of 1/3 and passes through the point (-6,0).
A. y=1/3x
B. =1/3x-6
C. y=1/3x-2
D. y=1/3x+2

Answers

The answers is D because I graphed it

Error Analysis A contractor purchases 4 dozen pairs of padded work gloves for $54.24. She
incorrectly calculates the unit price as $13.56 per pair for the expense report. What is the correct
unit price? What is the error?
The correct unit price is $
per pair.

Answers

Answer:

the unit rate for each pair is $1.13

Step-by-step explanation:

Okay this is how you would do this problem correctly:

we know that 4 dozen pairs of gloves cost $54.24 however we want to know what the cost is for one pair so we have to make a equation by dividing total cost by the number of glove pairs.

$54.24/4 dozen

the reason we are putting 4 dozen instead of just dividing $54.24 by 4 is because we want to know the unit price for each pair of gloves so it would actually look like this:

$54.24/4(12)

Dozen = 12

so we multiply 12 by 4 to get 48 pairs of gloves, we then divide $54.24 by 48 to find our unit rate of pricing for each pair:

$54.24/48 = 1.13

so now we place a dollar sign in front of 1.13 to get your answer:

for every pair bought it costs $1.13

So how did the Analysis A contractor get the wrong answer? well when she had bought the 4 dozen gloves she divided $54.24 by 4, which in this case would make it seem as though the gloves came in a 12 pack of gloves. However she was buying the gloves individually so she would have to multiply 4 by 12 before dividing the total number of gloves from $54.24.    

Albert's mom bought

5 2/3

pounds of potatoes. There are 5 people in Albert's

family and they all eat the same amount of potatoes.

How many pounds of potatos will Albert eat?

Answers

When dividing 5 by the lbs of potatoes, use the reciprocal to multiply. You then would have the following, 1 2/15 lbs of potato’s Albert will eat and the rest of the family will eat.

Hope this helps, correct me if I got it wrong :)

Jen is single and owns a condo. Her condo costs $120,000 and she has a $100,000 mortgage at 5%. She pays $3,600 in property tax and contributes $500 to ber church per year. Does she use Iternized Deduction or Standard Deduction?​

Answers

Answer:

`298,483

Step-by-step explanation:

Can someone Please help with this problem,please help me ASAP !!!l

Answers

Answer:

I'd say B bcs it's the only thing that would fit with the shift on x axis and y axis

Given: BC = DA, LCBD = ZADB
Prove: ABCD = ADAB
Statements
Reasons
I need help:(

Answers

B thank....................

×5=30
×5=300
×5=3,000
×5=30,000
×5=300,000
×5=3,000,000
×5=30,000,000

Answers

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

From up to down :

[tex]6[/tex]

_________________________________

[tex]60[/tex]

_________________________________

[tex]600[/tex]

_________________________________

[tex]6,000[/tex]

_________________________________

[tex]60,000[/tex]

_________________________________

[tex]600,000[/tex]

_________________________________

[tex]6,000,000[/tex]

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

Answer:

1. 6

2. 60

3. 600

4. 6,000

5. 60,000

6. 600,000

7. 6,000,000

Step-by-step explanation:

In ΔIJK, j = 7.6 cm, k = 7.8 cm and ∠I=27°. Find the length of i, to the nearest 10th of a centimeter.

Answers

Answer:

3.6

Step-by-step explanation:

TRUST ME LOL

HELP PLEASE! IM DUMB AND DONT HAVE MUCH TIME :( SPENDING 18 POINTS ON THIS

Answers

Answer:

The correct choice is the one on the bottom right.

3x = 0.5.x2
o o
O x= -6 or x = 0
O
x= -4 or x = 3
o
x = -2 or x = 1.5
x = 0 or x = 6

Answers

Answer:

the answer is x=0 or x=6, hope this helps

The length of a rectangle is 97 meters and the width is 14 meters. Find the area. Give your answer without units.
Provide your answer below:

Answers

Use the formula, l•w (length times width)
The length is 97 and the width is 14
97•14=1358

The area of a rectangle is the product of length and width thus the area will be 1358 square meters.

What is a rectangle?

A rectangle is a geometrical figure in which opposite sides are equal.

The angle between any two consecutive sides will be 90 degrees.

The perimeter of the rectangle = 2( length + width).

It is known that,

Area of rectangle = length × width.

Area = 97 x 14 = 1358 sqare meters

Hence "The area of a rectangle is the product of length and width thus the area will be 1358 square meters".

For more about rectangles,

https://brainly.com/question/15019502

#SPJ5

Please help me solve this! If you could solve my other questions that haven't been solved that would be great!

Answers

Answer:

The simplest form of the complex fraction [tex]\frac{\frac{8}{9}}{8}[/tex] is  [tex]\frac{1}{9}[/tex]

Step-by-step explanation:

In the complex fractions [tex]\frac{\frac{a}{b}}{c}[/tex] = [tex]\frac{a}{b}[/tex] ÷ c

To simplify it change ÷ to × and reciprocal c

[tex]\frac{\frac{a}{b}}{c}[/tex] = [tex]\frac{a}{b}[/tex] ÷ c = [tex]\frac{a}{b}[/tex] × [tex]\frac{1}{c}[/tex] = [tex]\frac{a}{bc}[/tex]

In the complex fractions [tex]\frac{a}{\frac{b}{c}}[/tex] = a ÷ [tex]\frac{b}{c}[/tex]

To simplify it change ÷ to × and reciprocal [tex]\frac{b}{c}[/tex]

[tex]\frac{a}{\frac{b}{c}}[/tex] = a ÷ [tex]\frac{b}{c}[/tex] = a × [tex]\frac{c}{b}[/tex] = [tex]\frac{ac}{b}[/tex]

Let us solve the question

∵ The complex fraction is [tex]\frac{\frac{8}{9}}{8}[/tex]

∵  [tex]\frac{\frac{8}{9}}{8}[/tex] = [tex]\frac{8}{9}[/tex] ÷ 8

→ Change ÷ to × and reciprocal 8

∴  [tex]\frac{8}{9}[/tex] ÷ 8 =  [tex]\frac{8}{9}[/tex] × [tex]\frac{1}{8}[/tex]

→ Cancel 8 up with 8 down

∴  [tex]\frac{8}{9}[/tex] × [tex]\frac{1}{8}[/tex] = [tex]\frac{1}{9}[/tex]

The simplest form of the complex fraction [tex]\frac{\frac{8}{9}}{8}[/tex] is  [tex]\frac{1}{9}[/tex]

Answer:

1

Step-by-step explanation:

In the fraction 8/9, 8 is the numerator and 9 is the denominator. When you ask "What is 8/9 simplified?", we assume you want to know how to simplify the numerator and denominator to their smallest values, while still keeping the same value of the fraction. We do this by first finding the greatest common factor of 8 and 9, which is 1.

Solve for n: 0.22n = 6.6.


Answers

Answer:

30

Step-by-step explanation:

Solve for n: 0.22n = 6.6.

6.6/0.22 (because for example 3/3 and n/n= 1 so 0.22/0.22 = 1 so we have to divide 6.6 since it is part of the equation and we have to do it on both sides.)=30

PLEASE I NEED HELP ASAP

Answers

Answer:

mrs heershap

Step-by-step explanation:

The smoke alarms in an office building need new batteries. Larry has 1,311 batteries. Each office in the building needs 6 batteries. How many offices will get new batteries? How many batteries will be left?

A.
320 offices, 3 batteries left

B.
218 offices, 3 batteries left

C.
221 offices, 1 battery left

D.
218 offices, 5 batteries left

Answers

Answer:

C....

Step-by-step explanation:

Answer: B
How to do it: 1,311 divided by 6 equals 218.5 then 218 x 6 = 1,308 then 1,311-1,308

5 times a number increased by 4 is at least
nineteen

Answers

Answer:

5(x+4) ≥ 19

x ≤  -1/5

Step-by-step explanation:

5(x+4) ≥ 19

5x + 20 ≥ 19

5x ≤  -1

x ≤  -1/5

need a little help with this problem

Answers

Answer:

Step-by-step explanation:

Rate (slope) of miles per gallon of gas: m = [tex]\frac{y_{2} -y_{1} }{x_{2} -x_{1} }[/tex]

(0, 0)

(2, 50)

[tex]m_{carA}[/tex] = 25 mi/gal.

(0, 0)

(3, 60)

[tex]m_{carB}[/tex] = 20 mi/gal.

Car B use less gasoline.

Find the measure of

Answers

Answer:

of what?

Step-by-step explanation:

if you could send a picture Thad be great

this one is also giving me a hard time

Answers

Answer:

Step-by-step explanation:

y = mx + b

[tex]m_{LN} = m_{NP }[/tex] = - [tex]\frac{10}{4}[/tex] = - [tex]\frac{5}{2}[/tex]

y-intercept is 1

y = - [tex]\frac{5}{2}[/tex] x + 1

Linear, exponential or neither?
ao = 2; an = an-1 + 4
A Linear
B Exponential
C Neither

Answers

Answer:

Linear

Step-by-step explanation:

The previous term plus 4.

1, 5, 9, 13 plotting these points would make a straight line!

PLEASE ANSWER ME!
What is the result when the number 65 is increased by 53%?

Answers

Answer:

The result when 65 is increased by 53% is 34.45

Step-by-step explanation:

Hope this helps and have a great day :)

Answer:

34.45

Step-by-step explanation:

i hope you get it right

Find the unit rate from the graph :

Answers

There are 5 sales per minute

Answer:

There are 5 sales per minute!

Step-by-step explanation:

A unit rate is a ratio between two different units with a denominator of 1. To calculate the unit rate, divide the numerator by the denominator. The resulting decimal number is the unit rate. Basically 5 is the unit rate! 5/1 is 5!

A restaurant bill is $75. You want to leave about a 20% tip. Which is a 20% tip?

Answers

75*.20= 15

The tip is $15

Please help and don’t answer with random letters I actually need the answer
Multiply x ^ (3/4) * x ^ (1/5)
1) x ^ (4/9)
2) x ^ (3/20)
3) x ^ (11/20)
4) x ^ (19/20)

Answers

Answer:

the answer is 4) i think

Step-by-step explanation:

i'm not sure but what i know, if the base is the same number, u can just add the power. for example, the bases is the same number which is x, so u can just solve the power which 3/4 + 1/5 then u get answer.

p/s: sorry for my english

For her birthday, Kendra received a gift card in the mail from her grandparents. The gift card was worth $50. Kendra thought, since she had just received other gifts for her birthday, she would wait a while to spend the gift card. Unfortunately, Kendra forgot all about the gift card, and the card loses $5 every month after its date of purchase if it has not been used. If Kendra forgot the card for three months, she lost $______.

A. 9
B. 10
C. 15
D. 12

i will give you brainiest and it has to be the right answer.

Answers

Answer:

$15

Step-by-step explanation:

Answer:15

Step-by-step explanation:

Quick 50 points brainliest
A biologist is studying the growth of a particular species of algae. She writes the following equation to show the radius of the algae, f(d), in mm, after d days:

f(d) = 11(1.01)d

Part A: When the biologist concluded her study, the radius of the algae was approximately 11.79 mm. What is a reasonable domain to plot the growth function? (4 points)

Answers

Answer:

[tex]0\leq d\leq 7[/tex]

Step-by-step explanation:

[tex]11.79=11(1.01^d)\\1.01^d=\frac{11.79}{11} \\1.01^d=1.0718\\ln(1.01^d)=ln(1.0718)\\d ln(1.01)=ln(1.0718)\\d=\frac{ln(1.0718)}{ln(1.01)} \\d=\frac{0.069}{0.0099} \\d=6.9696[/tex]

By rounding up.

d=7

Hence, the domain is

[tex]0\leq d\leq 7[/tex]

Answer:

0<x<d

its so easy if you need help

A color printer prints 19 pages in 8 minutes.
How many minutes does it take per page?

Answers

Answer:

I believe the answer is two

Step-by-step explanation:

19 divided by eight equasl two

Other Questions
Is y=-x proportional? Auto Tech charged Mrs. Smith $90.00 for an automotive part plus $53.00 per hourthat a mechanic worked to install the part. The total charge was $328.50. For about howlong did the mechanic work to install the part on Mrs. Smiths car? Einhard was a member of Charlemagnes court and described him as my lord and foster-father. He also wrote that, no man can write with more accuracy than I of events that took place about me, and of facts which I had personal knowledge. Do you think he was biased? How accurate do you think these excerpts are?Explain your reasoning. 2) There are 500 calories in 5 servings of SourPatch Kids. How many calories per serving?How many calories are there in 8 servings? PLEASE HELP!! 15 Points for CORRECT ANSWER ( nOT POINT D) THANK YOU AND BRAINLIEST A paired t-test can be treated as an inference about the mean of differences between two experimental conditions for a single sample of independent subjects.A. TrueB. False 12 13 14 Qu frase es incorrecta? De nio, el hombre siempre jugaba en la selva. Carlos y Sofa vean muchas cosas interesantes and Costa Rica la semana pasada. Cuando yo era joven, yo miraba la tele de vez en cuando. Open Response 2 part A: Plant cells and fungal cells have many of thesame types of organelles. Structures X and Y are found in both plant cellsand fungal cells. Structure Z is found in plant cells, but not in fungal cells. A- What is party?XZ HELP PLEASE PLEASE PLEASE!!The function f(x) = 4x 8 is reflected across the y-axis, resulting in a new function, g(x). Write the EQUATION of g(x). Please show how you got it!!! are the triangles congruent? if they are, state how they are congruent. Plz help!In order for the parallelogram tobe a rectangle, x = [? ]13x+34910x+10 How will you display the contribution in your museum Plz plz plz plz plz plz helppppp As a client becomes more fully functioning during the course of several psychotherapy sessions,we would expect the correlation between his or her real and ideal selves to:________.A) decrease.B) stay the same.C) increase.D) do any of these, for the correlation is unrelated to progress in therapy. What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!