If the ratio of the sides of two similar prisms is 4:1. Is the ratio of the volume of the prisms the same? (4:1)

Answers

Answer 1

Answer:

The ratio of their volumes is not the same 4:1, but [tex](4:1)^3[/tex] = 64:1.

Step-by-step explanation:

Measurements in Similar Figures

In similar figures, if the ratio of any of these corresponding lengths is expressed as a:b then the ratio of the other corresponding lengths can also be expressed as a:b.

In similar figures, if the ratio of any of these corresponding lengths is expressed as a:b then the ratio of the areas can be expressed as (a:b)^2 and the ratio of the volumes can be expressed as (a:b)^3.

We are given the ratio of the sides of two similar prisms as 4:1. The ratio of their volumes is not the same 4:1, but [tex]\mathbf{(4:1)^3}[/tex] = 64:1.


Related Questions

Solve (t-3)^2=6. The arrow is at a height of 48ft after approximately ____s and after ___s

Answers

Answer:

s - t = 3. s/3 + t/2 = 6

Step-by-step explanation:

Answer:

0.55 & 5.45

Step-by-step explanation:

EDGE VERIFIED

Charlie bought a pair of shorts at the store when they were having a 45% off sale. If the regular price was 24$ how much did charlie pay?

Answers

Answer:

$10.80

Step-by-step explanation:

45% of $24=10.8

use place value and money to make it $10.80

TEN DOLLARS AND EIGHTY CENTS

each year lizza school purchased agenda books, which are sold in the school this year the school purchased 350 books at a cost of 1,137.50 if the school would like to make a profit of 1,500 to pay for field trips and school activities, what is the least amount they can charge for each agenda book

Answers

Old price: 1,137.50 / 350 = 3.25
New price (at least): 1,500 / 350 = 4.3 (result is rounded)

Please Hurry
The graph shows the savings in Andre’s bank account.

What is the slope of the line?

What is the meaning of the slope in this situation?

Answers

Answers:

Slope = 5

Interpretation = Andre is saving 5 dollars per week

================================================

Work Shown:

The two points (0,40) and (4,60) are on the line

Use the slope formula

m = (y2-y1)/(x2-x1)

m = (60-40)/(4-0)

m = 20/4

m = 5

The slope is 5.

In this context, it means each time the number of weeks goes up by 1, the amount of his savings goes up by 5. In short, he's saving $5 per week.

note: the y intercept tells us that Andre started off with $40 in his account.

The slope is 5 in  slope-intercept form.

What is in slope-intercept form?

Y = mx + b, which defines a line, is an equation's slope-intercept form.When a line is graphed, its slope, m, and its point of intersection with the y-axis, b, also known as the y-intercept, are shown.To find answers for x, y, m, and b, utilize slope intercept form.

the y intercept tells us that Andre started off with $40 in his account.

Slope = 5

The two points (0,40) and (8,80) are on the line

Use the slope formula

Take any two points

m = (y2-y1)/(x2-x1)

= 80-40/8-0

= 40/8

=5

The slope is 5.

In this context, it means each time the number of weeks goes up by 1, the amount of his savings goes up by 5. In short, he's saving $5 per week.

Learn more about slope-intercept form

brainly.com/question/9682526

#SPJ2

the one mile race is equal to how many feet

Answers

                                 Your answer to this question

                 ✿                     1 Mile = 5280 feet                  ✿

Find the value of x.
3x - 9+X + 5

Answers

Answer:

4x-4 should be the answer

A logo is made of a square and a semicircle. The square has side lengths of 12 inches. One side of the square is also the diameter of the semicircle. What is the approximate total area of the logo?
PLEASEEEEE I NEED THIS ASAP PLEASEEEEEEEE

Answers

Uh bruv im just commenting to get points

alg 2 complex numbers in standard form! please help me :(

Answers

Answer:

B

Step-by-step explanation:

Refer to the picture that given

zoe has earned 650$ during the four weeks she worked at the rec center. the first 2 weeks she earned 220$ and 98$. the last 2 weeks she earned the same amount. how much money did zoe earn in the last 2 weeks

Answers

Answer:

The wording of this question was really confusing, but I believe the answer is 166 dollars.

Step-by-step explanation:

$220+ $98= $318

650-318=332

332/2=166

12.
Question 19 (5 points)
2 - (-8) + (-3) =
15
OA) 1
18
B) 14
12
O
D) 7

Answers

Answer:

The answer is d because 10-3 is 7

Answer:

D)7

Step-by-step explanation:

2 - (-8) + (-3) =

10-3 =7

which The following is a residual plot from a regression of a variable with the independent variable x.




Based on the plot, is it reasonable to conclude that a linear model is appropriate?
1.)Yes, because the plot shows no apparent pattern.
2.)Yes, because the points in the plot display less variation as x increases.
3.)Yes, because the sum of the residuals is close to zero.
4.)No, because the plot shows no apparent pattern.
5.)No, because the points in the plot display more variation as x increases.

Answers

Answer:

Yes, because the plot shows no apparent pattern.

Step-by-step explanation:

Yes, because the plot is a residual plot from a regression of a variable with the independent variable x.

What is regression?Regression is a statistical method that connects a dependent variable to one or more independent (explanatory) variables. A regression model can show whether changes in one or more explanatory variables cause changes in the dependent variable.A regression analysis can be used to predict how the independent variable will affect the dependent variable. As an example, we can say that a linear regression model can accurately predict age and height. Because height grows with age, age and height have a linear relationship.Regression analyses are usually carried out for one of two reasons: Forecasting the value of the dependent variable is possible for those who have access to some information on the explanatory variables.

Therefore, the correct option is 1.)Yes, because the plot shows no apparent pattern.

To learn more about regression refer to:

brainly.com/question/26755306

#SPJ2

I’ll give the brainlest answer! Is this relation a function? Please help

Answers

Answer:

show me the choices

Step-by-step explanation:

so i qnswer ir

A merchant instructs his agent to buy 1,000 micro tip pens and sell them at 15% above the purchase price. the agent charges 1% commission on the purchase and 3% commission on sales and earns Rs.534/- as commission.find the price and which the agent buys the pen​

Answers

Answer:

Thank you and please rate me as brainliest as it will help me to level up

The price of the pen is "12", and the cost price of 1000 pens is "12000".

Calculating the price of the pen:

Assume the number of Pens[tex]= x[/tex]

commission price of 1000 Pens[tex]=1000 x[/tex]

The selling price of Pens:

  [tex]=\frac{1000\times 115x}{100}\\\\ ={10\times 115 x}{}\\\\= 1150x[/tex]

Commission price on Purchase:

[tex]= \frac{1000\times 1 x}{100}\\\\= \frac{10\times 1 x}{1}\\\\= 10x[/tex]

commission price on sales:

[tex]=\frac{1150x \times 3}{100}\\\\=\frac{115 x \times 3}{10}\\\\=\frac{345 x }{10}\\\\=34.5\ x[/tex]

Calculating the total commission:

[tex]\to 10x+34.5x=44.5x=534\\\\\to 44.5x=534\\\\\to x = \frac{534}{ 44.5}=12[/tex]

Therefore, the agent buys a pen at 12 rupees and the cost price of 1,000 pens is 12000.

Learn more about the commission price here:

brainly.com/question/2321387

At Jay Street Middle School, 25%of eighth graders wear glasses. If 100 students wear glasses how many eighth graders are there in total?

Answers

Answer:

400 total

Step-by-step explanation:

so 100 is 25% of 100% and 25%x4=100%

so do 100x4=400=100% of the middle schoolers

4.5.36
A smoke jumper jumps from a plane that is 1500 ft above the ground. The function h= - 16t^2+ 1500 gives the jumper's height h in feet during the free fall att seconds
a. How long is the jumper free fall if the parachute opens at 1000 ft?
b. How long is the jumper in free fall if the parachute opens at 940 ft?
c. What is a reasonable domain and range for the function h?

Answers

We have a jumper that jumps from 1500ft above the ground, such that its height as a function of time is given by:

h(t) = -16*t^2 + 1500

The solutions are:

A) 5.59 seconds

B) 5.91 seconds

C) D = (0s, 9.68s)

    R = [0ft, 1500ft]

Notice that when t = 0, h = 1500, then at the initial time (t = 0) the height is 1500 (in ft), which means that the zero of the height is the ground.

a) How long is the jumper free fall if the parachute opens at 1000 ft?

Here we need to solve:

h = 1000 = -16*t^2 + 1500

Now we just need to solve this for t:

16*t^2 = 1500 - 1000 = 500

t^2 = 500/16 = 31.25

t = √31.25 = 5.59

So it takes 5.59 seconds to open the parachute.

B) similar to before, this time we need to solve:

h = 940 = -16*t^2 + 1500

16*t^2  =1500 - 940 = 560

t^2 = 560/16 = 35

t = √35 = 5.91

So it takes 5.91 seconds to open the parachute.

C) The domain is the set of inputs that we can use in the function.

The minimum of the domain is t = 0, when the jumper jumps.

To find the maximum of the domain we need to find the maximum time at which he could open the parachute, that is when h = 0ft, just in the ground.

Then we solve:

h = 0 = -16*t^2 + 1500

16*t^2 = 1500

t = √(1500/16) = 9.68

Then a reasonable domain is (0s, 9.68s)

And the range is the set of possible outputs, which will be all the possible heights of the jumper. We know that all of these are between 0ft and 1500ft, thus the range is [0ft, 1500ft]

If you want to learn more, you can read:

https://brainly.com/question/1632425

Find the value of K. The diagram is not to scale. Explain your answer.

Answers

Answer:

639 lo hago para conseguir puntos ;V

Step-by-step explanation:

A poll is given, showing 60% are in favor of a new building project. If 9 people are chosen at random, what is the probability that exactly 4 of them favor the new building project?

Answers

Answer:

The probability that exactly 4 are in favor the new building project is 0.1672.

Step-by-step explanation:

Let X denote the number of people who are in favor of a new building project.

The proportion of people who are in favor of a new building project is, p = 0.60.

A random sample of n = 9 people are chosen.

Every person has independent opinion about the new building project.

Thus, the random variable X follows a binomial distribution with parameters n = 9 and p = 0.60.

Compute the probability that exactly 4 are in favor the new building project as follows:

[tex]P(X=4)={9\choose 4}(0.60)^{4}(1-0.60)^{9-4}\\\\=126\times 0.1296\times 0.01024\\\\=0.167215104\\\\\approx 0.1672[/tex]

Thus, the probability that exactly 4 are in favor the new building project is 0.1672.

what is x-(3)/(5)=(5x)/(6)? with steps answer fast

Answers

hi

x- 3/5 =  5x/ 6  

6x - 18/5 =  5x

6x -5x =  18/5

     x = 18/5

   

let's check :      18/5 - 3/5 =  15/5 = 3

                         5 * 18/5   / 6  =    18/6 = 3

result is correct.

Please help with the problem in the picture ^ I’ll give brainliest if you give me a small explanation! :)

Answers

Answer:

A

Step-by-step explanation:

Because when you see X and Y, x multiplied by -6 is equal to y so if you check -84/-6, your correct answer should be 14 also A, hopefully this gave you the explanation you were looking for!!!!!!!!

I NEED HELP WITH THIS MATH PROBLEM!!!

Answers

Answer:

72 degrees

Step-by-step explanation:

4x+6x=180

10x=180 combine like terms

10x/10=180/10

x=18

4(18) = 17

pls help what is 1+2

Answers

Your answer would be 3
One plus two is equal to three 1. +. 2. =3

What is the area of the figure?

A. 36 cm2
B. 26 cm
C. 15 cm
D. 42 cm2

Answers

Answer:

Sorry to break it to ya but the other answer is wrong and the correct answer is A. 36 cm^2

Step-by-step explanation:

1. Divide the figure into 2 figures.

2. Calculate the first figure by multiplying the length (7 cm) and width (4 cm).

3. After that, we get 28. Do the same to the other figure. (4 cm x 2 cm = 8 cm).

4. Combine the 2 areas to get your total area. (28 + 8 = 36 cm^2).

5. NEVER forget the "^2" meaning squared when calculating the area.

Hope this helps, have a good day/night. :)

A rectangle is a two-dimensional shape where the length and width are different.

The area of a rectangle is given as:

Area = Length x width

The area of the figure is 36 cm².

What is a rectangle?

A rectangle is a two-dimensional shape where the length and width are different.

The area of a rectangle is given as:

Area = Length x width

Example:

The area of the rectangle with a length of 3 cm and wide 5cm is 15 cm².

We have,

A figure.

The figure has two rectangles.

One rectangle:

Length = 4 cm

Wide = 7 cm

Area of the rectangle = 4 x 7 = 28 cm²

Another rectangle:

Length = 2 cm

Wide = 4cm

Area of the rectangle = 2 x 4 = 8 cm²

The area of the figure.

= 28 + 8

= 36 cm²

Thus,

The area of the figure is 36 cm².

Learn more about rectangles here:

https://brainly.com/question/15019502

#SPJ2

Julie has a part time job after school she gets paid at a constant rate of dollars per hour.Julie works 12$ per month . Use this rate to find many hours it takes for Julie to earn $228

Answers

julie would earn $12/h×16h=$192

Can someone please tell me if I got this right or wrong? I’ll give brainliest
Please be honest

Answers

Answer:

yes your answer is correct

Step-by-step explanation:

(Angle relationships) solve this question.

Answers

Answer:

21

Step-by-step explanation:

Sidra is building a birdhouse. She drills a hole with a drill bit and tries to find a corresponding screw. The 1/4 inch screw is too big, and the 1/8 inch screw is too small. Which of the following could be the size of the drill bit Sidra used? 1/2 inch, 3/16 inch, 5/16 inch, 4/32 inch, or 8/32 inch

Answers

3/16
1/8 < x < 1/4
1/2 > 1/4 so 1/2 is wrong
If we multiply both top and bottom of 1/4 by 4 we get 4/16 which is less than 5/16 so 5/16 is wrong
4/32 can be simplified to 1/8 which is given to be too small so 4/32 is wrong
8/32 can be simplified to 1/4 which is given to be too big so 8/32 is wrong

What is the perimeter of the figure?

A. 20.0 cm
B. 23.0 cm2
C. 25.0 cm2
D. 11.0 cm

Answers

Answer:

Answer is D, all you do is add the numbers

The perimeter of the figure is 20 cm.

The perimeter of the figure is the sum of the whole sides. When the whole sides of the figure is added the perimeter is known. Therefore,

perimeter = 5 cm + 3 cm + 1 cm + 2cm + 4cm + 5 cm

perimeter = 8 cm + 3cm  + 9cm

perimeter = 20 cm

The perimeter of the figure = 20 cm

read more: https://brainly.com/question/20306407?referrer=searchResults

A certain fraction is greater than 2. The denominator is 8. What must be true about the numerator?

Answers

Answer:

The numerator must be greater than 16

Step-by-step explanation:

We are told that a certain fraction is greater than 2. Thus, if the numerator and denominator are x and y respectively, then we have;

x/y > 2

We are further told that the denominator is 8.

Thus;

x/8 > 2

Multiply both sides by 8 to give;

x > 16

Thus,the numerator must be greater than 16.

I need help ASAP (10 points) I checked and the only information I got was that x=8 I don’t know how to get the answer 8

Answers

Answer:

x=8

Step-by-step explanation:

This is a congruent triangle. If we use Pythagorean theorm, we can see that 3^2+y^2=25

y^2= 16

y=4

(y is the base of the small triangle)

and since the big triangle and the small triangle are congruent(the ratios are the same), 3 is half of 6, and so the base of the small triangle is half of the big triangle's.

4*2=8

x=8

Old Navy is having a sale for the summer they are selling for shirts for $23 what is the price per share at the store

Answers

Answer:

5 dollars and 75 cents.

Step-by-step explanation:

I think you mean 4 shirts are 23$? If so ,you would divide 23 by 4 to get how many dollars is 1 shirt. 23/4 = 5.75

Other Questions
Plz plz plz plz plz plz helppppp As a client becomes more fully functioning during the course of several psychotherapy sessions,we would expect the correlation between his or her real and ideal selves to:________.A) decrease.B) stay the same.C) increase.D) do any of these, for the correlation is unrelated to progress in therapy. What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees! Persuasive SpeechIntroductionA. Imagine going out to eat at a restaurant, and you read entrees like "fried human legs" and "human baby parmesan."B. I believe the world would be a happier, healthier, more humane place if everyone were vegetarian -- you should become one!C. Today I am going to enlighten you all about the animal cruelty involved with food processing that goes on behind closed doors, and the healthier lifestyle of being vegetarian.[First let me tell you a little bit about what else your are eating when you choose to eat meat.]BodyA. Every year billions of animals are raised and slaughtered for human consumption. In todays factory farms animals are confined to extremely small spaces so farmers can concentrate on maximizing production.1. This over crowding breeds disease, so the animals are fed antibiotics and sprayed with pesticides.2. The animals are also fed growth hormones.3. So, the chemicals, antibiotics and hormones are passed on to the consumers.4. USDA fact sheet, bacterial contamination of animal products often causes illness and death. Salmonella poisoning can be fatal.5. Time Magazine, bad chicken is responsible for at least 1,000 American deaths each year.[Now, here are some more disturbing facts you should know about meat production.]B. According to the Animal Protection Institute, in the U.S. alone, every year 41.8million beef cattle, 115 million pigs, and 8.785 billion chickens are slaughtered for human consumption. The animals endure much more.1. Beef cattle called "downers" are prodded or dragged to the slaughterhouse, or left without food or water to die.2. Pigs are stunned, hung upside down before their throats are cut and bled to death. If missed, they go to the scalding tank where they may be boiled alive.3. Crowed, chickens peck each other to death. Instead of providing space farmers "debeak" them by cutting off their upper beak with a hot blade.4. I would like to show you some photos taken inside a slaughterhouse.[If animal cruelty is not enough to change your mind, then maybe your own health concerns will make a difference.]C. Studies show meat-eaters are twice as likely to die from heat disease, and 60% more likely to die from cancer than vegetarians.1. Meat consumption has been linked to many diseases, osteoporosis, diabetes, kidney disease, hypertension, and obesity.2. Quoted by William Roberts, MD, editor and chief of The American Journal Of Cardiology, "When we kill animals to eat them, they end up killing us because their flesh, which contains cholesterol and saturated fat, was never intended for human beings, who are natural herbivores."ConclusionI hope that I have enlightened you all about the matters of vegetarianism, and I hope you all will make the right moral and health decisions as I have. Quote by Leonardo de Vinci, "I have, from an early age renounced eating meat. The time will come when we will look upon the murder of animals as they now look upon the murder of humans.Review the persuasive speech outline.If this speech was given to an audience full of people who worked for the cattle industry, what would the speaker have to accomplish?a.motivate them to become meat eatersb.change their beliefs about meatc.weaken the audiences attitude towards vegetablesd.strengthen the audiences attitude towards meat what was the reaction to the proclamation of 1763 by colonists? About 1/5 of all adults in the United States have type O blood. If four randomly selected adults donate blood, find the probability of each of the following events. a. All four are type O. b. None of them is type O. c. Two out of the four are type O . Whats the answer for this question guys??? a copper ore contains 3.00% of copper carbonate, CuCO3, by mass. Which mass of copper would be obtained from 1 tonne of the ore? A 1.91kg B 3.71kg C 15.3kg D 58.4kg If you travel 7.5 km and walk for 1.5 h, what is your average speed? Show your work? what is the role of private security within the criminal justice system How does the U.S. Constitution best reflect the ideal of separation of powers? Giving brainliest In the equation 3x+7=15, the number 7 is a. At Summer camp, campers are divided into groups. Each group has 16 campers and 2 cabins. How many cabins are needed are needed for 48 campers? A: 14 B: 20 C: 6 D: 30