Lola used 2 1/2 ink cartridges while her friends used 1 3/4 ink cartridges. How many more ink cartridges did Lola use than her friends

Answers

Answer 1

Answer:

Lola used 3/4 more ink cartridges than her friends

Step-by-step explanation:


Related Questions

ASAP HELP PLEASE ITS IS VERY NEEDED

Answers

Answer:

D. no solution because the other answers if you plug them in dont work

A 2 yard piece of ribbon costs $10.80. What is the price per inch?

Answers

Answer:

0.15

Step-by-step explanation:

2 yards = 72

10.80 / 72 = 0.15

1 yard is 36 inches. 2 yards is 72 inches. The question wants you to divide $10.80 into the inches that represent the yards. $10.80 / 72 = $0.15

Ratio of red to yellow marbles is 6 to 5 if there are 33 total marbles in the bag how many red

Answers

Answer:

18 red marbles and 15 yellow marbles.

Answer:
red: 18 yellow: 15

explanation
33 divided by 6+5 is 3
multiply by both and there’s ur answer!

can i be marked brainliest?


Abdul has bought 30 pounds of dog food. He feeds his dog
2/3 pounds for each meal. For how many meals will the food last?

Answers

Answer: I think its 45 days

Step-by-step explanation: hope this helps

This graph shows linear
y = f(x) and y = g(x).

Find the solution to the equation f(x) - g(x) = 0

Answers

Step-by-step explanation:

This graph shows linear

y = f(x) and y = g(x).

Find the solution to the equation f(x) - g(x) = 0

can 18 in, 6 in, 13 in form a triangle

Answers

Answer:

can bcz triangle has 3 sides here 3 cm are there

f(x) = x2 – 2x +1
Find y-intercept and vertex

Answers

Answer:

Your answer is: The x-intercept is [tex](1 , 0)[/tex] and your y-intercept is[tex](0 , 1 )[/tex].

Your vertex is [tex](1 , 0)[/tex]

Step-by-step explanation:

In order to find the y-intercept you had to to find the x-intercept, substitute in  0  for  y  and solve for  x . To find the y-intercept, substitute in  0  for  x  and solve for  y.

In order to find the vertex you had rewrite the equation in vertex form and use this form to find the vertex [tex](h , k)[/tex].

Hope this helped : )

Bella went shopping for a new phone. To find the total plus tax, she multiplied the price of the phone by 1.075. What percent tax did she pay?

Answers

7.5% because 1.075 is equal to 107.5% but you want to find the tax so subtract the 100 since it’s only tax and u get 7.5%

What is the equation of the line that passes through the points (3,6) and (-4,-8)

Answers

Hi

You have two points     A ( X;Y)  and B ( X ; Y)

slope is   :    ( Yb -Ya)   / (Xb -Xa )

                     ( -8 - 6 ) / ( -4 - 3) =   -14 /-7 =  2

slope is   2  

now :  we have  :  2 ( 3) +...  = 6

                                 6 +0 = 6  

equation of  line   is  :   y = 2x  

E. You can see a person in 1/4 the windows, How many people are visable​

Answers

Answer:

0

Step-by-step explanation:

You say that you can see a quarter of a person in a window. You cant have 1/4 of someone so the answer is 0 or 0.25

Yan has already finished Three-fifths of the 45 math problems he was assigned today. Each math problem took him 1Four-fifths of a minute to complete. If this pace continues, how much more time, to the nearest minute, will the rest of the problems take him to finish?

Answers

Answer:

49 Minutes

Step-by-step explanation:

1. 27 = 1 4/5 Minutes per 1 question.

2. Each question takes 108 seconds.

3. By this Logic, we can do 108 seconds x 27 questions to get-

4. 48.6 Minutes

5. And finally we round to the nearest minute so we get 49 minutes in total.

Answer:

32 minutes

Step-by-step explanation:

Yan has already finished Three-fifths of the 45 math problems he was assigned today. Each math problem took him 1Four-fifths of a minute to complete. If this pace continues, how much more time, to the nearest minute, will the rest of the problems take him to finish?

Eduardo's football team has won
9/10
of their games this season.
Write
9/10
as a decimal.
Write
9/10
as a percent.

Answers

Answer:

9/10=0.9

9/10=90%

Step-by-step explanation:

Answer:

[tex]\frac{9}{10}[/tex] = 0.9

[tex]\frac{9}{10}[/tex] = 90%

Hope this help!

Find three positive numbers whose sum is 100 and whose product is a maximum.

Answers

Answer:

The numbers are;

x = 100/3,  y = 100/3,  z = 100/3

Step-by-step explanation:

Given the data in the question;

so let the numbers be; x , y and z

so

x + y + z = 100

now

G(x,y,z) = x + y + z - 100

F(x,y,z) = xyz

Fx = yz, Gx = 1

Fy = xz, Gy = 1

Fz = xy, Gz = 1

Fx = λ × Gx

yz = λ

Similarly, xz = lambda

And xy = lambda

From above clearly, x = y = z

x + y + z = 100

so

3x = 100

x = 100/3

since, x = y = z therefore, each number is equal to 100/3

x = 100/3,  y = 100/3,  z = 100/3

We want to find 3 positive numbers such that their sum is 100 and the product is maximum.

The maximum product is P = 37,025.93

Let's say that our 3 numbers are:

A, B, and C.

We must have:

A + B + C = 100

The product of these 3 numbers is:

P = A*B*C

For the restriction, we can write:

A = 100 - B - C

Now we can replace that in the product equation to get:

P = (100 - B - C)*B*C

P = 100*B*C - C*B^2 - B*C^2

Now we want to maximize this, to do it, we need to find the zeros of the derivate of the function. This is a two-variable function, but the dependence on C is exactly the same as the dependence on B, so we can find the zero of deriving with respect to one of these only.

dP/dB = 100*C - 2*C*B - C^2 = 0

             C*(100 - 2*B - C) = 0

One solution is C = 0, the other is:

C = 100 - 2*B

And from the first restroctopm:

A + B + C = 100

we can get:

C = 100 - A - B

Then:

100 - A - B = 100 - 2*B

Then we get A = B

And if we derive the equation for C instead of B, we will get similar results that will lead to:

A = B = C.

This is what maximizes the product, then we have:

A + B + C = 3*A = 100

A = 100/3 = 33.33

P = (33.33)^3 = 37,025.93

This is the maximum product.

If you want to learn more, you can read:

https://brainly.com/question/11212148

There are 36 carpenters in a crew. On a certain day, 29 were present. What percent showed up for work? (round to the nearest tenth)
(Please answer with explination)

Answers

Answer:

29/36*100 so ans will be 80.55555555555555555555555555555555555555

Step-by-step explanation:

What is the factored form of the equation 4x^2-11+6=0

Answers

Answer:

(4x−3)(x−2)=0

Step-by-step explanation:

Step-by-step explanation:

4x²-11+6=0

4x²-5=0

x²=5

4

x=√5

4

hope it help u

Sum of two numbers is -32 what number is two less than the other

Answers

First no. = z

Second no. = z - 2

z + (z - 2) = -32

z + z - 2 = -32

2z - 2 = -32

2z = -32 + 2

2z = -30

z = -30/2

z = -15

First no. = -15

Second no. = -17

PLZ HELP I BEG YOU !!!!!!!!!!1

Answers

Answer:

The Answers are right under you.

Which best describes a polynomial?

Answers

Answer:

an algebraic expression containing one or more terms

Step-by-step explanation:

What conclusions can you draw from the graph?

Answers

Answer:

My best conclusion (simply put) is that you had a higher score than the average class.

Step-by-step explanation:

It obvious that the green dots is above the averages of both bars. It would be safe to think that you scored higher than the average of the entire class in both predictions and parabolas.

HELP!!


Given f(x)= x^2 -3 and g(x)= x+2/x , find (g-f)(4). Show all work.

Answers

Answer:

-8.5

Step-by-step explanation:

Given

f(x)= x^2 -3 and g(x)= x+2/x

To find

(g-f)(4)

Solution

(g-f)(4) = g(4) - f(4) =4+2/4 - (4² -3) =4 + 0.5 - 16 + 3 =-8.5

Substitution
2x-y=7
3x-2y=10

Answers

Answer:

x=4

y=1

Step-by-step explanation:

R is between Q and S
Find QR

Answers

Answer:

23.8

Step-by-step explanation:

68.4 - 44.6 = 23.8

Answer:

QR is 23.8

because 68.4 - 44.6 =23.8

Mrs. jones bought 25 mangoes for $7.50. she sold 12 mangoes for 60 cents each and the remaining for 55 cents each. a. state whether she made a profit or loss b. calculate the profit loss c. calculate the percentage profit or loss

Answers

Answer:

when u search it one by one

Which describes all decimals that are rational numbers?

Tbo dod

Answers

Answer:

Step-by-step explanation:

For starters, rational numbers are any numbers that has the capability to be written as a fraction.

For example, 0.5 is a decimal, and can also be written in form of a fraction, as 1/2

A recurring decimal can be written as a fraction. For example, we have 0.167 which can be written as 1/6

In the example, for the decimal 0.36425, we find the place value of the last digit. The last digit here is 5 placed in the hundred-thousandths place. On simplifying further into a fraction, we have 36425/100000.

During November, $83 was spent on travel. In December, $65 was spent on travel. How much was the percent of decrease? Round to the nearest tenth of a percent.


Pls Help

Answers

Answer:

Percent decrease is 21.7%

Step-by-step explanation:

The percent decrease is calculated as:

[tex]Decrease\ percentage = \frac{decrease}{Original\ quantity} * 100[/tex]

Given in the question that:

Cost on travel during November = $83

Cost on travel during December = $65

The percent decrease will be calculated by computing decrease(subtracting the cost of December from the cost of November.

[tex]Decrease = Travel\ cost\ in\ November - Travel\ cost\ in\ december\\Decrease = \$83-\$65\\= \$18[/tex]

Now, for percentage decrease

[tex]Percentage\ decrease = \frac{decrease}{Travelling\ cost\ in\ November} * 100\\=\frac{18}{83} * 100\\=21.686..[/tex]

Rounding off to nearest tenth of percent, we get the percentage decrease as 21.7%

Hence,

Percent decrease is 21.7%

A pool that is being drained contained 18,000 gallons of water. After 2 hours, 12, 500
Gallons of water remain. Write an equation in all 3 forms to model this situation,
HELLPPP PLLEASEEEE!!!!!

Answers

Answer:

y-18,000=2,750(x-0) --> point-slope

y=2,750x+18,000   --> slope-intercept

-2,750x + y = 18,000  --> standard

Step-by-step explanation:

Linear Modeling

Some situations can be modeled as linear functions. If we are in a situation where a linear model is suitable, then we need two sample points to make the model and predict unknown behaviors.

The pool being drained contained initially 18,000 gallons of water. If we set the variable x as the time in hours and y as the remaining gallons of water in the pool, this first point is (0;18,000).

We are also aware that after 2 hours 12,500 gallons of water remain. This gives us the second point as (2;12,500).

The equation of a line passing through points (x1,y1) and (x2,y2) can be found as follows:

[tex]\displaystyle y-y_1=\frac{y_2-y_1}{x_2-x_1}(x-x_1)[/tex]

Let's find the equation of the line with the 2 points:

[tex]\displaystyle y-18,000=\frac{18,000-12,500}{2-0}(x-0)[/tex]

Calculating:

[tex]\displaystyle y-18,000=\frac{5,500}{2}(x-0)[/tex]

[tex]y-18,000=2,750(x-0)[/tex]

The equation above is the point-slope form of the line

Simplifying and adding 18,000:

[tex]y=2,750x+18,000[/tex]

The equation above is the slope-intercept form of the line

Moving all the variables to the left side:

[tex]-2,750x + y = 18,000[/tex]

The equation above is the standard form of the line

Answer:

y-18,000=2,750(x-0) --> point-slope

y=2,750x+18,000   --> slope-intercept

-2,750x + y = 18,000  --> standard

Jay needs to paint one side of his house. He knows 1 can of paint covers and area of 24 square feet. What is the least amount of paint Jay will need to paint the side of his house?

Answers

Answer:

he will need 4 cans to make it 100 %compleate

which one of the mappings is a function?

Answers

Answer:

the answer is x.

Step-by-step explanation:

the x values are only being used once, therefore, it is a function

NEED HELP ASAP I WILL RATE 5 STARS

Answers

Answer:

B

Step-by-step explanation:

If you plug in 5 1/3 to the equation, the result is 6, meaning that the point lies on the line.

I don’t understand this question can you also help me figure it out step by step I would greatly appreciated it

Answers

Answer:

If a shape is a square, then it is a quadrilateral

Step-by-step explanation:

Quadrilateral means four sided shape, so automatically, because a square has 4 sides, you know it is a quadrilateral. But not all quadrilaterals are a square, you could have a rectangle which is four sides so you know that this statement is wrong "If a shape is a quadrilateral, then it is a square." Therefore, the answer is "If a shape is a square, then it is a quadrilateral

Quadirtalrt labs is akia a alaaloaabvszkIsvsnaisg s sksusvsbz os snack
Other Questions
HELP PLEASE PLEASE PLEASE!!The function f(x) = 4x 8 is reflected across the y-axis, resulting in a new function, g(x). Write the EQUATION of g(x). Please show how you got it!!! are the triangles congruent? if they are, state how they are congruent. Plz help!In order for the parallelogram tobe a rectangle, x = [? ]13x+34910x+10 How will you display the contribution in your museum Plz plz plz plz plz plz helppppp As a client becomes more fully functioning during the course of several psychotherapy sessions,we would expect the correlation between his or her real and ideal selves to:________.A) decrease.B) stay the same.C) increase.D) do any of these, for the correlation is unrelated to progress in therapy. What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees! Persuasive SpeechIntroductionA. Imagine going out to eat at a restaurant, and you read entrees like "fried human legs" and "human baby parmesan."B. I believe the world would be a happier, healthier, more humane place if everyone were vegetarian -- you should become one!C. Today I am going to enlighten you all about the animal cruelty involved with food processing that goes on behind closed doors, and the healthier lifestyle of being vegetarian.[First let me tell you a little bit about what else your are eating when you choose to eat meat.]BodyA. Every year billions of animals are raised and slaughtered for human consumption. In todays factory farms animals are confined to extremely small spaces so farmers can concentrate on maximizing production.1. This over crowding breeds disease, so the animals are fed antibiotics and sprayed with pesticides.2. The animals are also fed growth hormones.3. So, the chemicals, antibiotics and hormones are passed on to the consumers.4. USDA fact sheet, bacterial contamination of animal products often causes illness and death. Salmonella poisoning can be fatal.5. Time Magazine, bad chicken is responsible for at least 1,000 American deaths each year.[Now, here are some more disturbing facts you should know about meat production.]B. According to the Animal Protection Institute, in the U.S. alone, every year 41.8million beef cattle, 115 million pigs, and 8.785 billion chickens are slaughtered for human consumption. The animals endure much more.1. Beef cattle called "downers" are prodded or dragged to the slaughterhouse, or left without food or water to die.2. Pigs are stunned, hung upside down before their throats are cut and bled to death. If missed, they go to the scalding tank where they may be boiled alive.3. Crowed, chickens peck each other to death. Instead of providing space farmers "debeak" them by cutting off their upper beak with a hot blade.4. I would like to show you some photos taken inside a slaughterhouse.[If animal cruelty is not enough to change your mind, then maybe your own health concerns will make a difference.]C. Studies show meat-eaters are twice as likely to die from heat disease, and 60% more likely to die from cancer than vegetarians.1. Meat consumption has been linked to many diseases, osteoporosis, diabetes, kidney disease, hypertension, and obesity.2. Quoted by William Roberts, MD, editor and chief of The American Journal Of Cardiology, "When we kill animals to eat them, they end up killing us because their flesh, which contains cholesterol and saturated fat, was never intended for human beings, who are natural herbivores."ConclusionI hope that I have enlightened you all about the matters of vegetarianism, and I hope you all will make the right moral and health decisions as I have. Quote by Leonardo de Vinci, "I have, from an early age renounced eating meat. The time will come when we will look upon the murder of animals as they now look upon the murder of humans.Review the persuasive speech outline.If this speech was given to an audience full of people who worked for the cattle industry, what would the speaker have to accomplish?a.motivate them to become meat eatersb.change their beliefs about meatc.weaken the audiences attitude towards vegetablesd.strengthen the audiences attitude towards meat what was the reaction to the proclamation of 1763 by colonists? About 1/5 of all adults in the United States have type O blood. If four randomly selected adults donate blood, find the probability of each of the following events. a. All four are type O. b. None of them is type O. c. Two out of the four are type O . Whats the answer for this question guys??? a copper ore contains 3.00% of copper carbonate, CuCO3, by mass. Which mass of copper would be obtained from 1 tonne of the ore? A 1.91kg B 3.71kg C 15.3kg D 58.4kg If you travel 7.5 km and walk for 1.5 h, what is your average speed? Show your work?