Maurice made a model of the steel tabletop his model measures 7 inches by 13 inches is the model simular to the original

Answers

Answer 1
The first example has students building upon the previous lesson by applying the scale factor to find missing dimensions. This leads into a discussion of whether this method is the most efficient and whether they could find another approach that would be simpler, as demonstrated in Example 2. Guide students to record responses and additional work in their student materials.
§ How can we use the scale factor to write an equation relating the scale drawing lengths to the actual lengths?
!
ú Thescalefactoristheconstantofproportionality,ortheintheequation=or=!oreven=
MP.2 ! whereistheactuallength,isthescaledrawinglength,andisthevalueoftheratioofthe drawing length to the corresponding actual length.
§ How can we use the scale factor to determine the actual measurements?
ú Divideeachdrawinglength,,bythescalefactor,,tofindtheactualmeasurement,x.Thisis
! illustrated by the equation = !.
§ How can we reconsider finding an actual length without dividing?
ú We can let the scale drawing be the first image and the actual picture be the second image. We can calculate the scale factor that relates the given scale drawing length, , to the actual length,. If the actual picture is an enlargement from the scale drawing, then the scale factor is greater than one or
> 1. If the actual picture is a reduction from the scale drawing, then the scale factor is less than one or < 1.
Scaffolding:
A reduction has a scale factor less than 1, and an enlargement has a scale factor greater than 1.
Lesson 18: Computing Actual Lengths from a Scale Drawing.

Related Questions

A quadrilateral has no pairs of parallel sides, what two shapes could it be?

Answers

Answer:

Kite

Step-by-step explanation:

Def of kite has no parallel sides

Answer:

Kite and Trapezium

Step-by-step explanation:

Each of them do not have any parallel lines or sides

Find the distance of a line given the following points. R(3, 1), W(-1, -2)

Answers

Answer:

[tex]\sqrt{13}[/tex]

Step-by-step explanation:

we can solve this using the distance formula: [tex]\sqrt{(x_{2}-x_1)^{2} + (y_{2}-y_1)^{2}}[/tex]

[tex]x_1, y_1[/tex] is (3, 1)

[tex]x_2, y_2[/tex] is (-1, -2)

[tex]\sqrt{(1-3)^2 + (-2-1)^2}[/tex]

which simplifies to: [tex]\sqrt{(-2)^2 + (-3)^2}[/tex]

then: [tex]\sqrt{2^2 + 3^2}[/tex] or: [tex]\sqrt{4+9}[/tex]

your final answer is: [tex]\sqrt{13}[/tex] or about 3.61

Show me how to Graph y = 3x + 2

Answers

this what it should look like. did you need the steps or no ?

Select the expression equivalent to (-133–15)-(-9x + 16).
А
4x - 31
B
--4x + 1
с
-4x - 31
D
-22x-31

Answers

I think it’s B if you get it wrong I’m sorry .... I really tried


Sorry

Solve seven and five ninths minus three and nine elevenths.

( Im giving extra POINTS and BRAINLIEST on this one!! 0v0 )

A) three and seventy three ninety ninths

B) three and fifty five ninety ninths

C) four and fifty five twentieths

D) four and seventy three twentieths


(Here is an image if needed) :

Answers

It is 3 73/99

I just used a fraction calculator lol

Answer:

It is 3 73/99

Subtract 7 from all and tell which is the most accurate measurement.

Answers

Answer:

Tool 1

Step-by-step explanation:

[tex]Tool\ 1 = 7.033 cm\\\\Tool\ 2 = 6.91cm\\Tool\ 3=7.1 cm\\\\When\ we\ subtract\ 7\ from\ all\ of\ them\ ,\\Tool\ 1 = 0.033 cm\\Tool\ 2 = -0.09cm\\Tool\ 3=0.1 cm\\\\Here,\\As\ Tool\ 1\ has\ more\ decimals\ in\ it, it\ is\ the\ most\ accurate\ among\ them.[/tex]

PLEASE HELP!!!!

IT IS NOT A

A. Yes; 20 hours/painter

B. Yes; 8 hours/painter

C. No; Does not pass through the origin

D. None of the above

Answers

Answer:

C

Step-by-step explanation:

Answer:

Pretty sure it's

D. None of the above

Jackson's bakery sold 291 cheesecakes in one day. How much money did Jackson's bakery make in one day from cheesecakes?

Answers

How much does one cheesecake cost? We are missing some valuable information.

What is 3/5 plus 4/8

Answers

Answer: 11/10 is your answer

Step-by-step explanation: Hoped this helped

Answer:

1.1

Step-by-step explanation:

3/5 + 4/8 = 1.1

If the graph of f(x) = is translated right 9.5 units and up unit, which function represents the resulting graph? g(x) = – 9.5 g(x) = + 9.5 g(x) = – g(x) = +

Answers

Answer:

the answer is d

Step-by-step explanation:

edenuity2020. also I just did it

In the rectangle below,

Answers

Answer:

Step-by-step explanation:

In a rectangle,  diagonals are equal and bisect each other

BE  =   AE

6x - 5 = 2x +  7

6x - 2x - 5 = 7

       4x - 5 = 7

             4x = 7 + 5

             4x = 12

               x = 12/4

               x = 3

AE = 2x + 7

     = 2*3 + 7

    = 6 + 7

AE =  13

AC = 13 + 13

AC = 26

m∠EBC = 50

In rectangle, each angle is 90

m∠ABE + m∠EBC = 90

m∠ABE + 50 = 90

          m∠ABE = 90 - 50

          m∠ABE = 40

In rectangle, AB // DC and DB transversal

m∠ECD = m∠ABE   { alternate interior angles}

m∠ECD = 40

A radio manufacturer believes that the length of life of WPPX model radio is normal with µ=12 years and σ=2.5 years. (a) What percent of the radios will function for more than 16 years? (b) Suppose the company decides to replace 1% of the radios. Find the length of the guarantee period. i.e. find X. (c) What percent of the radios that will fail to satisfy the guarantee period of 10 years? , i.e. less than 10 years? (d) If 10% of the radios will function for more than X years, find X.
Help, please!!

Answers

Answer:

(a) 5.48%

(b) 17.82 years

(c) 21.19%

(d) 15.21 years

Step-by-step explanation:

z = (x-μ)/σ,

where

x is the raw score

μ is the population mean

σ is the population standard deviation.

µ=12 years and σ=2.5 years.

(a) What percent of the radios will function for more than 16 years?

For x = 16

z = 16 - 12/2.5

z = 1.6

Probability value from Z-Table:

P(x<16) = 0.9452

P(x>16) = 1 - P(x<16)

1 - 0.9452

= 0.054799

Converting to percentage = 0.054799 × 100

= 5.4799%

Approximately = 5.48%

(b) Suppose the company decides to replace 1% of the radios. Find the length of the guarantee period. i.e. find X.

find the z score of the 99th percentile = 2.326

Hence:z = (x-μ)/σ

2.326 = x - 12/2.5

Cross Multiply

2.326 × 2.5 = x - 12

5.815 = x - 12

x = 12 + 5.815

x = 17.815

Approximately = 17.82 years

(c) What percent of the radios that will fail to satisfy the guarantee period of 10 years? , i.e. less than 10 years?

When x < 10

Hence,

z = 10 - 12/2.5

z = -0.8

Probability value from Z-Table:

P(x<10) = 0.21186

Converting to percentage

0.21186 × 100

= 21.186%

Approximately = 21.19%

(d) If 10% of the radios will function for more than X years, find X.

The z score would be : 100 - 10%

= 90th percentile z score

We find the z score of the 90th percentile = 1.282

Hence:z = (x-μ)/σ

1.282 = x - 12/2.5

Cross Multiply

1.282 × 2.5 = x - 12

3.205 = x - 12

x = 12 + 3.205

x = 15.205

Approximately = 15.21 years

Please help with my homework

Answers

It's 65. Because you add the other angles and get 90+25 and get 115. 180 -115 = 65.

Answer:

c=65°

Step-by-step explanation:

180-90=90

90-25=65

hopefully this helps :)

Let A represent reading newspaper and represent watching television
Which statement is true?
Watching television and and reading newspaper are independent events because P(AB) + P(A) and
PBAP(B)
Watching television and reading newspaper are not independent events because P(AB)=P(A) and
P(BA) - P(B)
Watching television and reading newspaper are independent events because P(AB) = P(A) and P(BA) = P(B).
Watching television and reading newspaper are not independent events because P(AB) + P(A) and
P(BA) = P(B)
Lo

Answers

Answer:

in the picture

Step-by-step explanation:

A magazine costs 4.95 per month. If you buy a one year subscription, it's 30% cheaper. How much will you pay in one year with the discount?

Answers

Answer:

41.48/year

Step-by-step explanation:

4.95 x 12 = 59.40

59.40 × .30 = 17.82

59.40 - 17.82 = 41.48

What is the midpoint of the segment below?
(2,3)
(-3,-2)
O A. (2.5, 2.5)
O B. (5,5)
O C. (-0.5, 0.5)
O D. (0,0)

Answers

The midpoint is C, (-0.5,0.5)

Find the middle between the x and y coordinates and that is the midpoint

Answer:

C

Step-by-step explanation:

use midpoint formula

midpt = ((2 + (- 3))/2 , (3 + (- 2))/2) = (-0.5, 0.5)

Please help it’s urgent!!!!

Answers

It is B because from the x value 1 to 2 the parabola is increasing

How to simplify this equation?

Answers

Answer:

10/9 +  [tex]\frac{1}{3} \sqrt{10}[/tex] i

Step-by-step explanation:

([tex]\frac{1}{3} \sqrt{5}[/tex] - [tex]\frac{1}{2} \sqrt{2}[/tex]i) ² =

([tex]\frac{1}{3} \sqrt{5}[/tex] )² + 2([tex]\frac{1}{3} \sqrt{5}[/tex] [tex]\frac{1}{2} \sqrt{2}[/tex])i - ([tex]\frac{1}{3} \sqrt{5}[/tex]i) ² =

5/9 + [tex]\frac{1}{3} \sqrt{5}[/tex] [tex]\sqrt{2}[/tex] i - (5/9. (-1)) =

10/9 +  [tex]\frac{1}{3} \sqrt{10}[/tex] i  

Here see the attachment

Martin is an after-school math tutor. He noticed that 6 people still needed help and only Two-fifths of the tutoring session time was left. Since each person is to be given an equal amount of time, Martin wrote the expression below to find the fraction of the tutoring session each person who still needed help would be allotted.

Two-fifths divided by 6

Which expression is equivalent to Martin’s expression?
StartFraction 6 Over 15 EndFraction divided by 6
StartFraction 6 Over 5 EndFraction divided by 2
Five-halves times 6
Two-fifths times 6

Answers

Answer:

150

Step-by-step explanation:

Answer:

150 is the answer of 2/5 divided by 6

Step-by-step explanation:

Simplify the expression.

6(x+4)+1 =

Answers

Answer:

6x+25

Step-by-step explanation:

6(x+4)+1 =

Distribute

6x+24+1

Combine like terms

6x+25

6x+25 is your answer. Happy to help

helppppp please I will give brainliest​

Answers

Answer:

-3/4

Step-by-step explanation:

Answer:

B. 4/3

Step-by-step explanation:

The slope is rise over run or the change in y over the change in x. To find the slope count how many units y increases by then divide that by how many units x increases. In this graph y goes up by 4 and x increases by 3, so 4/3. Another way to find slope is the slope formula which is [tex]\frac{y_{2}-y_{1} }{x_{2}-x_{1} }[/tex], then plug in any two points and solve them.

Find 3 consecutive odd integers such that 10 times the first is 59 more than the third?

Answers

Answer: The required three consecutive odd integers are 7, 9 , 11.

Step-by-step explanation:

Let x , x+2 , x+4 be the three consecutive odd integers.

As per given ,  

10(x) = 59+x+4

⇒10x= 59+x+4

⇒ 9x= 63

⇒ x= 7   [ divide both sides by 7]

Hence, the required three consecutive odd integers are 7, 9 , 11.

How many distinct rearrangements of the letters in "tweedledee" are there?

Answers

Answer:

weed ,led ,we, tee , tweedle

PLEASE HELP ASAP 80 POINTS!!!!

Theresa volunteers at a food sheif. when she started, there were 213 oranges. After filling X bags of three oranges each, there were fewer than 51 oranges left. How many bags of oranges did Theresa fill?

Write an expression in terms of X for the number of oranges that Theresa bagged.

Part B: Write an expression in terms of X for the number of oranges that are left (have yet to be bagged).

Part C: Write an inequality using the expression from Part B to represent this scenario.

Part D: Solve the inequality for the variable X. Use opposite operations on both sides of the inequality until you get X on one side of the inequality by itself.

Part E: Did you have to flip the inequality sign? Explain why or why not.

Part F: What does the result from Part D tell you about Theresa's situation? Does the answer make sense? Explain.

Part G: Think about graphing the inequality you found in Part D on a number line. What would it look like?

Choose the correct number:

1. open circle on 54 and arrow pointing right
2. open circle on 54 and arrow pointing left
3. closed circle on 54 in arrow pointing right
4. closed circle on 54 and arrow pointing left​

Answers

Answer:

A- The expression 3x represents the number of oranges that she bagged

B-  213 − 3x (or -3x + 213)

C- 213 − 3x < 51 (or -3x + 213 < 51)

D- x >54

E-Yes, I had to flip the inequality sign because I divided both sides of the inequality by a negative number (-3).

F- x > 54 means Theresa filled more than 54 bags of oranges. It makes sense because if Theresa made more than 54 bags of 3 oranges each, there would be fewer than 51 oranges left over.

G- Number 1 is correct.

Step-by-step explanation:

I did it./ Hope it helped : )

Answer:

everyone mark Praezhan brainleist thank you Praezhan so much

Step-by-step explanation:

What is the slope of function 3x-5y=17

Answers

Answer:

y=5/3x-3.4

Step-by-step explanation:

slope is 5/3

Answer:

[tex]\frac{3}{5}[/tex]

Step-by-step explanation:

In slope-intercept form of linear equation y = mx + b , "m" is the slope

3x - 5y = 17

- 5y = - 3x + 17

y = [tex]\frac{3}{5}[/tex] x - [tex]\frac{17}{5}[/tex]  

m = [tex]\frac{3}{5}[/tex]

Please help!
Thanks in advance.

Answers

Answer:

y = (1/4)x + 5/2

Step-by-step explanation:

The lines slope needs to be opposite of the equation's so its positive (1/4)

This is the only slope listed that is that number so no need to calculate for the y value!

Jean paid $26 for a pair of pants and $19 for a blouse. How much more did she pay for the pants than for the blouse?

Answers

Answer:

$5 More

Step-by-step explanation:

$26 - $19 = $5

Answer:

She paid $7 more


What's 15/45 written as a fraction in simplest form
A. 3/15
B.13
C.53
D. 153

Answers

Answer:

None of the above

Step-by-step explanation:

15/45=1/3

Answer:

None of those options lol

Step-by-step explanation:

But the answer is 1/3

how to math pls i ned to math

Answers

Answer:

8 inches

Solution:

First, you need to add all sides which will give you 147. Then, to find the length of GA, you need to subtract the perimeter which is 167, by 147 which will give you 20. GA = 20

Thus to find G'A', you need to cross multiply 14/35 = G'A'/20

You should end up with 280 = 35. Divide 35 by 280 and you get 8.

PLEASE MARK IT AS BRAINLIEST

Answer:

2+2=4-1+3

Step-by-step explanation:

quick mafs

You are going on a hike with 3 other people. You decide to divide the bottles of water evenly among the group. Write an expression to find the number of bottles each person will carry. Find the total number of bottles each person will carry if there are 16 bottles.​

Answers

16/4=4 but I don’t really know if it needs the answer or not because it’s asking for an expression, and the/ is another way of writing division
Other Questions
A paired t-test can be treated as an inference about the mean of differences between two experimental conditions for a single sample of independent subjects.A. TrueB. False 12 13 14 Qu frase es incorrecta? De nio, el hombre siempre jugaba en la selva. Carlos y Sofa vean muchas cosas interesantes and Costa Rica la semana pasada. Cuando yo era joven, yo miraba la tele de vez en cuando. Open Response 2 part A: Plant cells and fungal cells have many of thesame types of organelles. Structures X and Y are found in both plant cellsand fungal cells. Structure Z is found in plant cells, but not in fungal cells. A- What is party?XZ HELP PLEASE PLEASE PLEASE!!The function f(x) = 4x 8 is reflected across the y-axis, resulting in a new function, g(x). Write the EQUATION of g(x). Please show how you got it!!! are the triangles congruent? if they are, state how they are congruent. Plz help!In order for the parallelogram tobe a rectangle, x = [? ]13x+34910x+10 How will you display the contribution in your museum Plz plz plz plz plz plz helppppp As a client becomes more fully functioning during the course of several psychotherapy sessions,we would expect the correlation between his or her real and ideal selves to:________.A) decrease.B) stay the same.C) increase.D) do any of these, for the correlation is unrelated to progress in therapy. What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees! Persuasive SpeechIntroductionA. Imagine going out to eat at a restaurant, and you read entrees like "fried human legs" and "human baby parmesan."B. I believe the world would be a happier, healthier, more humane place if everyone were vegetarian -- you should become one!C. Today I am going to enlighten you all about the animal cruelty involved with food processing that goes on behind closed doors, and the healthier lifestyle of being vegetarian.[First let me tell you a little bit about what else your are eating when you choose to eat meat.]BodyA. Every year billions of animals are raised and slaughtered for human consumption. In todays factory farms animals are confined to extremely small spaces so farmers can concentrate on maximizing production.1. This over crowding breeds disease, so the animals are fed antibiotics and sprayed with pesticides.2. The animals are also fed growth hormones.3. So, the chemicals, antibiotics and hormones are passed on to the consumers.4. USDA fact sheet, bacterial contamination of animal products often causes illness and death. Salmonella poisoning can be fatal.5. Time Magazine, bad chicken is responsible for at least 1,000 American deaths each year.[Now, here are some more disturbing facts you should know about meat production.]B. According to the Animal Protection Institute, in the U.S. alone, every year 41.8million beef cattle, 115 million pigs, and 8.785 billion chickens are slaughtered for human consumption. The animals endure much more.1. Beef cattle called "downers" are prodded or dragged to the slaughterhouse, or left without food or water to die.2. Pigs are stunned, hung upside down before their throats are cut and bled to death. If missed, they go to the scalding tank where they may be boiled alive.3. Crowed, chickens peck each other to death. Instead of providing space farmers "debeak" them by cutting off their upper beak with a hot blade.4. I would like to show you some photos taken inside a slaughterhouse.[If animal cruelty is not enough to change your mind, then maybe your own health concerns will make a difference.]C. Studies show meat-eaters are twice as likely to die from heat disease, and 60% more likely to die from cancer than vegetarians.1. Meat consumption has been linked to many diseases, osteoporosis, diabetes, kidney disease, hypertension, and obesity.2. Quoted by William Roberts, MD, editor and chief of The American Journal Of Cardiology, "When we kill animals to eat them, they end up killing us because their flesh, which contains cholesterol and saturated fat, was never intended for human beings, who are natural herbivores."ConclusionI hope that I have enlightened you all about the matters of vegetarianism, and I hope you all will make the right moral and health decisions as I have. Quote by Leonardo de Vinci, "I have, from an early age renounced eating meat. The time will come when we will look upon the murder of animals as they now look upon the murder of humans.Review the persuasive speech outline.If this speech was given to an audience full of people who worked for the cattle industry, what would the speaker have to accomplish?a.motivate them to become meat eatersb.change their beliefs about meatc.weaken the audiences attitude towards vegetablesd.strengthen the audiences attitude towards meat what was the reaction to the proclamation of 1763 by colonists? About 1/5 of all adults in the United States have type O blood. If four randomly selected adults donate blood, find the probability of each of the following events. a. All four are type O. b. None of them is type O. c. Two out of the four are type O .