One factor that determines the amount of oxygen transferred from the lungs to the blood is
the total functional surface area of the respiratory membrane.
O True
O False

Answers

Answer 1

Answer:

true

Explanation:


Related Questions

Based on your knowledge of reproduction in bryophytes and ferns, is the presence of flagellated sperm in cycads surprising? Why or why not?

Answers

Answer:

The correct answer is - All plants share a similar life cycle

Explanation:

The sperms that the bryophytes are biflagellated whereas in ferns these are multi-flagellated that helps in the swimming to the archegonia or female part to perform the fertilization, due to the presence of water.

The sperms in cycads also have flagella for the same purpose of swimming in the pollen tube. The ferns and the bryophytes both require the same or similar life cycle that includes the flagella and water for the formation of the zygote.

Which of the following statements about meiosis is true?

Meiosis creates unique cells.

Meiosis creates identical cells.

Meiosis creates cells such as skin and muscle cells

Meiosis creates glucose in plant cells

Answers

Answer:3

Explanation:

the diagram below is a model that shows structural organization within a multicellular organisms. why is "tissue" listed between cell and organ?​

Answers

Because an organ is made up of several types of tissues, therefore several types of cells due to the fact that tissues are a group of cells of the same type that perform a specific function in an organism.

Which of the following types of specialized cells are only found in plants? A:Phloem B:Glandular C: Muscle D: Nerve

Answers

Answer:

pretty sure its d im so sorry if im wrong I greatly apologize

please help me with this question:)

Answers

the third one is correct

In a typical mammalian cell, what is the average percentage of total cell weight for protein and dna?

Answers

Answer:Protein is evaluated at ≈55% of the cell dry weight, followed by RNA at ≈20%, Lipid at ≈10% and DNA at ≈3% (the rest being polysaccharides, metabolites, ions etc.).

Explanation:

A typical mammalian cell averages 18% protein and 0.25% DNA by weight composition.

According to research, a typical mammalian cell is made up of water, ions, and macromolecules such as proteins, lipids, DNA, RNA, carbohydrates, and some miscellaneous metabolites.

The water component of a typical mammalian cell is about 70%, 18% proteins, 1% inorganic ions, 3% small metabolites, 5% lipids, 0.25% DNA, 1.1% RNA, and 2% polysaccharides.

More on the components of the cell can be found here: https://brainly.com/question/1620164

Type 1 diabetes is caused by destruction of beta cells in the pancreas that produce insulin. Which of the following best explains why a person with this disease needs medication?

a. Medication is needed to act as a signaling molecule to activate the signal transduction pathway.
b. Medication is needed to allow alternate signaling transduction pathways to control glucose levels.
c. Medication is needed to open channels to allow signaling molecules to enter pancreatic cells.
d. Medication is needed to serve as second messengers to regulate glucose uptake by cells.

Answers

Answer:

the answer is a. Medication is needed to act as a signaling molecule to activate the signal transduction pathway.

i took the quiz

Medication is needed to act as a signaling molecule to activate the signal transduction pathway. So, the correct option is (A).

What is Type 1 Diabetes?

Type 1 diabetes also called insulin-dependent or juvenile diabetes which is usually develops in children, adolescents, and young adults, but it can occur at any age. A condition in which the immune system destroys the insulin-producing cells in the pancreas. These are called beta cells.

There are several signs of type 1 Diabetes which include:

Extreme thirstIncreased hungerDry mouthUpset stomach and vomitingFrequent urination

When a person suffering from this disease needs medication which is need to act as signaling molecule to activate the signal transduction pathway. Type 1 Diabetes is characterized by a progressive loss of insulin-producing β-cells in the islets of the pancreas. Immune destruction of β-cells is partly mediated by high levels of pro-inflammatory cytokines.

Thus, medication is needed to act as a signaling molecule to activate the signal transduction pathway. So, the correct option is (A).

Learn more about Type 1 Diabetes, here:

https://brainly.com/question/14823945

#SPJ2

SOMEONE PLZ HELP!!!!!!!!

Answers

A - Endoplasmic Reticulum.

Why do polysaccharides have more energy than a disaccharide?

Answers

Answer:

While monosaccharides such as glucose provide short-term energy, polysaccharides provide longer storage of energy. Cells use monosaccharides quickly. The molecules can bond to cell membrane lipids and aid in signaling.

Explanation:

When our brain fills in missing pieces, this is called:

Answers

Answer:

I think it's called 'filling in'

Explanation

Hope this helps :)

Answer:

I think its called resoration

T/F Cell theory was developed before the invention of the microscope.
A. True
B. False

Answers

B false

The cell theory was developed in 1665 and the microscope in 1590

Match each element or compound with the appropriate symbol or molecular formula.
hydrogen
oxygen
CO2
carbon dioxide
H20
carbon
с
water
H

Answers

Answer: Water- H2O

Hydrogen- H

Carbon- C

Carbon Dioxide- CO2

Explanation:

Answer:

hydrogen = H

oxygen = O

carbon dioxide = CO2

carbon = C

water = H2O

Explanation:

As seen in the picture below,

(Please note that these are NOT in the same order as your question.)

PLEASE HELP ME WITH THIS QUESTION

Answers

Answer:

the answer is b.

Explanation:

prokaryotes don't have organelles, like eukaryotes do.

Which statements best describe shared characteristics? Select two options.
A. Shared characteristics always exist in the common ancestor and in the modern organism.
B. Shared characteristics never exist in the common ancestor or in the modern organism.
C. The more characteristics organisms share, the more closely related they are.
D. The fewer characteristics organisms share, the more closely related they are.
E. Shared characteristics can exist among organisms that belong to different species. F. Shared characteristics only exist among organisms that belong to the same species.

Answers

Answer:

The more characteristics organisms share, the more closely related they are.

Shared characteristics can exist among organisms that belong to different species

Explanation:

A shared character can be regarded as a character that is shared by two lineages.

The statements that best describe shared characteristics

The more characteristics organisms share, the more closely related they are.Shared characteristics can exist among organisms that belong to different species.

The classification of all living entities is based on extremely basic, universal  traits.

Each group's organisms are subsequently subdivided into smaller groupings.

Each bigger group is divided into smaller groups based on more detailed similar shared characteristics.

Learn more about shared characteristics: https://brainly.com/question/6997560

why are people scared of spiders?

Answers

Cause there little demon things ❤️

Which is a component of cell theory?

a.All living things grow into cells.
b.All living things are made of cells.
c.Cells come from nonliving matter.
d.Cells come from non-cells.

Answers

the answer is B. all living things are made of cells

Answer:

B.

Explanation:

That's true without cells we wouldn't live.

The presence or absence of
a. cells
b. atoms
c. molecules
provide evidence that a specimen is a living thing.

Answers

Answer:

I know it

Explanation:

cells because an humane body is made up of cells

Conservation of mass the mass of a whole object

Answers

Answer:

Explore the Law of Conservation of Mass by demonstrating that the mass of a whole object is always the same as the sum of the masses of its parts. All objects and substances in the world are made of matter. ... Matter has two fundamental properties: matter takes up space and matter has mass.

Explanation:

Which statement describes the motion of the water molecules in this situation

Answers

Answer:

im confused, what am i supposed to solve?

Explanation:

im ready to answer, but i dont know what im supposed to solve

The large central vacuole of plant cells holds water and supports the shape the plant cell as created by the _______________
A. cell wall
B. chloroplasts
C. DNA
D. endoplasmic reticulum

Answers

A cell wall plz give brainliest

pls helppppoooopppppoppppp

Answers

Answer:

direct observation

Explanation:

What would be the best control group for global warming? Select one: (A)laboratory simulation,(B )a computer simulation or (C) another identical earth that has not seen increases in greenhouse gases (even though this is not possible)​

Answers

Answer:

C. another identical earth that has not seen increases in greenhouse gases

The best control group for global warming would be another identical earth that has not seen increases in greenhouse gases.

What do you mean by Global warming?

Global warming may be defined as the gradual increase in the Earth's average temperature due to the trapping of greenhouse gases by the atmosphere.

The excessive release of greenhouse gases like methane, Carbon dioxide, nitrous oxide, and ozone are responsible for global warming. These gases are released by automobiles, industrial smoke, etc.

Deforestation is also considered the cause of global warming. Trees help in the reduction of carbon dioxide from the atmosphere and convert it into oxygen.

Therefore, the best control group for global warming would be another identical earth that has not seen increases in greenhouse gases.

To learn more about Global warming, refer to the link:

https://brainly.com/question/3553382

#SPJ2

what spheres would be involved and in what way?

Answers

Answer:

The lithosphere contains all of the cold, hard solid land of the planet's crust (surface), the semi-solid land underneath the crust, and the liquid land near the center of the planet.

Explanation:

Which is the best description of photophosphorylation?

Answers

photophosphorylation refers to the use of light energy from photosynthesis to ultimately provide the energy to convert ADP to ATP, thus replenishing the universal energy currency in living things .

Insectivorous plants grow in soil deficient in nitrogen.
TRUE
False

Answers

Answer:True

Explanation:

Carnivorous plants have adapted to grow in places where the soil is thin or poor in nutrients, especially nitrogen, such as acidic bogs. Charles Darwin wrote Insectivorous Plants, the first well-known treatise on carnivorous plants,

Select the correct answer. Claire, an ecologist, is finding it difficult to identify an interaction in nature because of changing environmental conditions and the complex indirect interactions of multiple species. Which interaction is Claire trying to find in nature?​

Answers

Answer:

e

Explanation:

Good luck!

Answer:

apparent competition

Explanation:

This is the correct answer for Edmentum

You want to know if black squirrels or brown squirrels have a greater birth rate. Your ALTERNATIVE hypothesis is:_________.

Answers

Answer:

Natural selection is a mechanism of evolution proposed by Charles Darwin. It is the differential survival and reproduction of individual due to the difference in the phenotype. Over time, this process results in populations which are better adapted to their environment as they tend to survive and produce new offspring.  The brown squirrels with thick coat survive at a higher rate than the brown sqirrels without the thick coat. Thick coat is a adaptation for survival in cold winters which are chosen over the other and allowed to reproduce.

Explanation:

Two genes interact to produce various phenotypic ratios among F2 progeny of a dihybrid cross. Design a different pathway explaining each of the F2 ratios below, using hypothetical genes R and T and assuming that the dominant allele at each locus catalyzes a different reaction or performs an action leading to pigment production. The recessive allele at each locus is null (loss-of-function). Begin each pathway with a colorless precursor that produces a white or albino phenotype if it is unmodified. The ratios are for F2 progeny produced by crossing wild-type F1 organisms with the genotype RrTt. Which statement is correct? 12/16 white: 3/16 green: 1/16 yellowA) At least one copy of both dominant alleles results in white; at least one copy of one of the dominant alleles also results in white, but at least one copy of the other dominant allele produces green; and the absence of either dominant allele produces yellow.B) If both dominant alleles are present, the result is green. At least one copy of one specific dominant allele is required for yellow. If that dominant allele is not present, the result is white, regardless of whether the other dominant allele is present.C) At least one copy of each dominant allele results in white, at least one copy of either dominant allele produces green, and the absence of either dominant allele produces yellow.

Answers

Answer:

wow ang haba naman yan broo hirap basahin

Draw a flow chart that explains how DNA is used to create an organism. please use the words: DNA, gene, protein, cell, tissue, organ, organism.

Answers

Answer:

Please find the flowchart attached as an image

Explanation:

DNA is the genetic material contained in the cells of living organisms. The DNA contains a segment called GENE, which contains information used to produce useful products needed in the cell. The information contained in the gene is expressed to produce PROTEINS.

PROTEINS are responsible for many metabolic activities that occurs in a cell. The CELL functions due to activities of the proteins produced by gene expression. When similar cells come together, they form TISSUES. An aggregation of tissues performing similar functions form ORGAN. Organs functioning similarly come together to form ORGAN SYSTEM. A collection of organ systems in the body forms the ORGANISM.

Which sentences describe the differences between photosynthesis and cellular respiration? Check all that apply. Cellular respiration uses oxygen as a reactant and photosynthesis does not​

Answers

Answer:

Cellular respiration uses oxygen as a reactant and photosynthesis does not​

Explanation:

Autotrophs use CO2 to make energy while heterotrophs use Oxygen.

Check all that apply?

You only gave one option so that's as far as I can get, sorry!

Other Questions
Einhard was a member of Charlemagnes court and described him as my lord and foster-father. He also wrote that, no man can write with more accuracy than I of events that took place about me, and of facts which I had personal knowledge. Do you think he was biased? How accurate do you think these excerpts are?Explain your reasoning. 2) There are 500 calories in 5 servings of SourPatch Kids. How many calories per serving?How many calories are there in 8 servings? PLEASE HELP!! 15 Points for CORRECT ANSWER ( nOT POINT D) THANK YOU AND BRAINLIEST A paired t-test can be treated as an inference about the mean of differences between two experimental conditions for a single sample of independent subjects.A. TrueB. False 12 13 14 Qu frase es incorrecta? De nio, el hombre siempre jugaba en la selva. Carlos y Sofa vean muchas cosas interesantes and Costa Rica la semana pasada. Cuando yo era joven, yo miraba la tele de vez en cuando. Open Response 2 part A: Plant cells and fungal cells have many of thesame types of organelles. Structures X and Y are found in both plant cellsand fungal cells. Structure Z is found in plant cells, but not in fungal cells. A- What is party?XZ HELP PLEASE PLEASE PLEASE!!The function f(x) = 4x 8 is reflected across the y-axis, resulting in a new function, g(x). Write the EQUATION of g(x). Please show how you got it!!! are the triangles congruent? if they are, state how they are congruent. Plz help!In order for the parallelogram tobe a rectangle, x = [? ]13x+34910x+10 How will you display the contribution in your museum Plz plz plz plz plz plz helppppp As a client becomes more fully functioning during the course of several psychotherapy sessions,we would expect the correlation between his or her real and ideal selves to:________.A) decrease.B) stay the same.C) increase.D) do any of these, for the correlation is unrelated to progress in therapy. What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees!