SOMEONE PLZ HELP ME !!!!!!!!!!!!!!!!!!

SOMEONE PLZ HELP ME !!!!!!!!!!!!!!!!!!

Answers

Answer 1

Answer:

plant :)

Explanation:


Related Questions

What does the cell membrane do for the cell?
O maintain homeostasis
O all of the above
O communication
O protection

Answers

Answer:

Protection

Explanation:

The plasma membrane, or the cell membrane, provides protection for a cell. It also provides a fixed environment inside the cell. And that membrane has several different functions. One is to transport nutrients into the cell and also to transport toxic substances out of the cell.

In facilitated diffusion, do molecules move down their concentration gradient? Explain.

Answers

Answer:

Molecules move up the concentration gradient in facilitated diffusion, which requires ATP to be used as molecules naturally move from high to low concentration

Explanation:

: )

Molecules move down their concentration gradient in facilitated diffusion through channels of proteins.

For most molecules, movement through the membrane, with a significant rate, is only possible by the presence of transporter proteins (integral membrane proteins, which recognize substances with a high specificity, accelerating their translocation) or channels of proteins.

Transport proteins allow the facilitated diffusion of molecules, moving them along the free energy gradient (concentration gradient, charge gradient, or both), in the direction of thermodynamic equilibrium.

When a carrier protein binds to a solute, the protein changes shape in such a way that it carries the solute to the other side of the membrane.

Facilitated diffusion is similar to simple diffusion, since the molecules move from a region of higher to a lower concentration of solutes.

For example, by facilitated diffusion, chlorine ions move down their concentration gradient into the cell through chlorine channels.

Therefore, we can conclude that many molecules are assisted by transporter proteins for their diffusion through the plasma membrane, a process known as facilitated diffusion, where the molecules descend through their concentration gradient.

Learn more here: https://brainly.com/question/22811521

A bird flies at 12.5 meters per second. the wind speed is 4.5 meters per second. what is the speed of the bird when it flies with the wind?

Answers

Answer:

17m/s

Explanation:

Given parameters:

Speed of the bird  = 12.5m/s

Speed of the wind  = 4.5m/s

Unknown:

Speed of the bird when it flies with the wind = ?

Solution:

The speed of the bird when it flies with the wind is the sum of the speed of the bird and the speed of the wind.

  Speed of the bird with wind  = 12.5m/s + 4.5m/s  = 17m/s

Suggest ways you could determine if two similar species are mimics in nature

Answers

Answer:

i dont speak english sorry

Explanation:

:/

Chemical reactions convert to . In nonliving systems, the presence of a(n) allows the reaction to proceed very quickly and have a lower . In living systems, this function is carried out by proteins called .

Answers

Answer:

reactants, products

catalyst

activation energy

enzymes

Explanation:

Chemical reactions convert reactants to products. In nonliving systems, the presence of a(n) catalyst allows the reaction to proceed very quickly and have a lower activation energy. In living systems, this function is carried out by proteins called enzymes.

Due to the higher concentration of oxygen (O2) in the air than your blood, oxygen goes from the lungs into the red blood cells by ... *

PLEASE HELP I WILL MARK BRAINLY

THANK YOU

Answers

oxygen goes from your lungs into the red blood cells by simple diffusion

Due to the higher concentration of oxygen in the air than your blood, oxygen goes from the lungs into the red blood cells by simple diffusion.

It should be noted that oxygen diffuses from the lungs into the red blood cells. It then binds to hemoglobin. A molecule of hemoglobin can bind with four molecules of oxygen.

Since the red blood cells have cell membranes that are thin, this then enables oxygen to be able to diffuse quickly.

In conclusion, the correct option is simple diffusion.

Read related link on:

https://brainly.com/question/18500054

Covalent bonds can be best described as neutral atoms coming together to share electrons. neutral atoms coming together to create electrons. ionized atoms coming together to trade electrons. ionized atoms coming together to destroy electrons.

Answers

Answer:

neutral atoms coming together to share electrons.

Explanation:

Answer:

The answer is neutral atoms coming together to share electrons.

Explanation:

Bc covalent compounds are compound whose atoms form bonds by sharing electrons

Have a great day!!

9. A pattern of stars that has been named is called a constellation. One winter evening, Jason
found the star called Sirius in the constellation called Canis Major.
Canis Major
Sirius
Muliphen.
Murzim
Wezen
Aludra
Adara
If Jason came outside again a few hours later, what would the stars in Canis Major look like?
A. The pattern of stars would appear to be in the same place in the sky.
B. The pattern would change because each star would have moved in a different direction.
C. The pattern of stars would appear to have moved together across the sky.
D. The pattern would be smaller because the stars moved closer together.

Answers

Answer

i think its C.

If Earth was like a hardboiled egg, which part of Earth would the egg white represent?

Mantle, as its depth is less than 2,900 kilometers
Core, as its depth is less than 2,900 kilometers
Mantle, as its depth is up to 6,500 kilometers
Core, as its depth is up to 6,500 kilometers

Answers

Answer:

The Mantle, as it's depth is less than 2,900 Kilometers.

Explanation:

Answer:

The Mantle as it's depth is less than 2,900 Kilometers.

Explanation:

Select 1 factor that most likely reflects your life as a senior high student

Answers

Explanation:

depression

unstable mental health

constant anxiety

overthinking

Answer:

Regular physical activity promotes growth and development and has multiple benefits for physical, mental, and psychosocial health that undoubtedly contribute to learning.

• Specifically, physical activity reduces the risk for heart disease, diabetes mellitus, osteoporosis, high blood pressure, obesity, and metabolic syndrome; improves various other aspects of health and fitness, including aerobic capacity, muscle and bone strength, flexibility, insulin sensitivity, and lipid profiles; and reduces stress, anxiety, and depression.

Sedentary behaviors such as sitting and television viewing contribute to health risks both because of and independently of their impact on physical activity.

• Health-related behaviors and disease risk factors track from childhood to adulthood, indicating that early and ongoing opportunities for physical activity are needed for maximum health benefit.

what type of bone is the femur?
A. short bone
B. flat bone
C. long bone
D. irregular bone

Answers

The answer is c . long bone

Answer:

It is a long bone.

Explanation:

This meaning that it is greater in width, while the patella, a sesamoid bone, is small and round.

When you and your friends work together to find a solution to a project you are:
o mediating
o competing
o cooperating
o assisting

Answers

Answer:

Cooperating

Explanation:

Cooperation is "the process of working together" so if you and your friends are working together, you are cooperating. Hope this helps! :)

Answer:

c

Explanation:

What do you notice about the Moon’s orbit?

Answers

Answer:The Moon has a nearly circular orbit (e=0.05) which is tilted about 5° to the plane of the Earth's orbit. Its average distance from the Earth is 384,400 km. ... Therefore, Earth-bound observers can never see the 'far-side' of the Moon. Tidal forces cause many of the moons of our solar system to have this type of orbit.

Explanation:

An individual is heterozygous for a gene at a specific locus. ________ will have the same form of alleles at that locus after S phase.A. Sex chromosomes.B. Homologous chromosomes.C. Non-sister chromatids.D. Sister chromatids.

Answers

Answer:

D

Explanation:

Sister chromatids will have the same form of alleles at the locus after S phase.

This is because during the S phae of the cell cycle, sister chromatids are replicated in preparation for cell division. The replication process is quite accurate such that all the alleles present on the initial chromatids are also replicated on the new sister chromatids. Hence, both new and old chromatids will have the same form of alleles at the locus after replication at the S phase. In other words, sister chromatids are exact copy of one another.

The correct option is D.

What does the term maturity group mean?
O the level of ossification in the bones of the animal
O the median age of the herd the animal was from
Am
O the age and skeletalsification of the animal at slaughter
O the length of time the beef has been stored after slaughter

Answers

I’m pretty sure it’s D. The length of time the beef has to been stored after slaughter.

Succession Interactive!

What is the difference between primary succession and

secondary succession?

Primary succession occurs in an area that is disrupted by a

fire or other natural disaster but secondary succession does

not.

Primary succession occurs after secondary succession.

Primary succession involves only plants but secondary

succession involves animals too.

Primary succession occurs in an area with no life and no soil

but secondary succession happens in an area where an

existing community was disrupted.

Answers

Answer:

Primary succession occurs in an area with no life and no soil but secondary succession happens in an area where an existing community was disrupted.

Explanation:

Ecological succession, which is the series of changes that occurs in an ecosystem over a period of time, can be divided into two types namely: primary succession and secondary succession.

- Primary succession is a kind of succession in which a bare surface or rock is colonized by certain organisms called PIONEERS. Primary succession occurs in an area with no life and no previous soil.

- On the contrary, secondary succession occurs in an area that has been previously colonized but disturbed as a result of natural occurrences e.g earthquake, wildfire, flooding etc.

IF you see something dark or with a pole like figure then run and hide if you hear what it says it already too late

Answers

Answer:

stop being spoopy im scurred (._.)

Explanation:

eh still not scarry

       ~( ̄▽ ̄)~

3 Drag each option to the correct location on the image.
Match the expenses to their respective type. 1. rent
2. employee salary
3. sales commission
4. machinery
5. wages
6. materials used for production

FIXED COSTS or VARIABLE COSTS​

Answers

Explanation:

Fixed> materials for used production, machinery

Variable> Employee salary, wages, rent

The fixed costs are machinery and materials used for production while the variable costs are rent, employee salary, sales commission, and wages.

What are fixed and variable costs of production?

A fixed cost of production is one whose value cannot be easily changed. Examples include machinery and equipment, factory space, etc.

A variable cost of production is one whose balue can be easily changed. Examples include salaries, wages, etc.

Therefore, the fixed costs are machinery and materials used for production while the variable costs are rent, employee salary, sales commission, and wages.

Learn more about fixed and variable costs at: https://brainly.com/question/8225307

#SPJ2

What effect with the enzymes have on the time to make 1 MG of product

Answers

Answer:

Decreases

Explanation:

Enzymes speed up chemical reactions so the product is made in less time

1. Muscles function in ____________ of the head, neck, and limbs, as well as propulsion of the contents through the digestive tract.2. Muscles function in _____ by preventing unwanted movement, as in maintaining posture. 3. Using _____, or valves, muscles control the passage of contents from one body cavity or lumen to another. 4. Since muscle contraction requires energy to do work, movement muscles help maintain our body _____. 5. By absorbing a large share of one's _____, muscles play an important role in blood sugar control.

Answers

Answer:

1. Muscles function in movement of the head, neck, and limbs, as well as propulsion of the contents through the digestive tract.

2. Muscles function in stability by preventing unwanted movement, as in maintaining posture.

3. Using sphincters, or valves, muscles control the passage of contents from one body cavity or lumen to another.

4. Since muscle contraction requires energy to do work, movement muscles help maintain our body heat.

5. By absorbing a large share of one's glucose, muscles play an important role in blood sugar control.

Explanation:

Muscles have different functions in the body. They allow our head, neck and limbs to move, and also have an important role in the propulsion of contents through the digestive track.

Muscles are soft tissues that also have a role in stability by maintaining posture and help the passage of contents from different cavities by using sphincters.

Their main source of energy is glucose in the body. By using this energy, muscles help to maintain our bodies temperature and blood sugar control.

Which compound(s) is/are not an electron carrier(s) involved in the respiratory chain? A. Iron-sulfur proteins B. Cytochromes C. Coenzyme A D. NADH Ubiquinone

Answers

Answer:

fwgwe.      

Explanation:

The Answer is: C- Coenzyme A

During photosynthesis, plant cells use sunlight as an energy source. Animal cells do not use photosynthesis. What organelle in plant cells makes it possible for plants to carry out photosynthesis?

Answers

the chloroplast makes it possible.

Answer:

Chloroplasts.... I am pretty sure lol

Explanation:

Which of the following are functions related to the expression of MHC molecules?

a. To display self-peptides to test developing T cells for autoreactivity
b. To display self-peptides to demonstrate cell health
c. To display self-peptides to maintain self-tolerances
d. To display foreign peptides
e. All of the answers are correct.

Answers

Answer:

e. All of the answers are correct.

Explanation:

The major histocompatibility complex (MHC) is a locus that contains several polymorphic genes. These genes are known to encode different components of the immune system, especially cell-surface proteins which present antigens to the T cell receptors during adaptive immune responses. The MHC genes are classified into Class I, Class II and Class III:

1- MHC class I genes encode cell surface molecules that present peptides (antigens) to cytotoxic T lymphocytes (i.e., killer T cells)

2- MHC class II genes encode cell surface molecules that present antigens to CD4+ T cells

3- MHC class III genes encode proteins that are not involved in antigen presentation (i.e., components of the complement cascade, cytokines, etc)

What are some of the interactions the respiratory
systems has with other body systems?

Answers

Answer:

The respiratory system interacts with the circulatory system by replenishing the blood flow from the heart with fresh oxygen, and taking out waste gases like CO2 from the blood.

Explanation:

Any interaction of the respiratory system with another system would be any function where both systems are involved. Hope this helps!

ILL GIVE BRAINLIST


Darren used the following soil triangle to identify a sample of soil as sandy loam.

Soil texture triangle. Clay soil is approximately 45 percent or less sand, 50 percent or more clay, and 40 percent or less silt. Silty loam soil is approximately 50 percent or less sand, 30 percent or less clay, and 50 percent or more silt. Sandy clay soil is approximately 45 to 65 percent sand, 35 to 55 percent clay, and 25 percent or less silt. Sandy clay loam soil is approximately 45 to 80 percent sand, 20 to 35 percent clay, and 35 percent or less silt.

Which description of soil likely allowed Darren to make this identification?

Mostly large particles, with a gritty texture, 60% sand, 10% clay, and 30% silt
Mostly large particles, with a smooth texture, 40% sand, 50% clay, and 10% silt
Mostly small particles, with a smooth texture, 10% sand, 50% clay, and 40% silt
Mostly small particles, with a smooth texture, 30% sand, 30% clay, and 40% silt

Answers

Answer: I'm not sure but i think it's Mostly small particles, with a smooth texture, 10% sand, 50% clay, and 40% silt

Explanation:

Soil Texture is defined as the proportion of sand, silt, and clay-sized particles, which make up the composition of the soil.

The description that matches Darren's identification is that most small particles, with a smooth texture, are 10% sand, 50% clay, and 40% silt.

The soil texture can be explained as:

1. Clay in soil texture refers to the mineral soil particles that are less than 0.2 millimeters in diameter. Clay soil is 40% or more clay, less than 45% sand, and less than 40% slit.

2. Silt in the soil texture has a high percentage of sand and it feels smooth, having smooth textures. This soil has a high percentage of clay.

3. Sand is the largest mineral particle, which consists of the coarsest particles. The particles feel gritty and have a diameter of about 0.05 to 0.002 mm.

Thus, the correct answer is Option C.

To know more about soil texture, refer to the following link:

https://brainly.com/question/8046058

SOMEONE PLZ HELP ME, THIS IS DUE TODAY PLZ!!! I WILL MARK BRAINLIEST!!!!!!!!!

Answers

Answer: hi

Explanation:

12. Base your answer to the following question on the diagram below, which represents a chemical
reaction that occurs in the human body, and on your knowledge of biology.
Part of a
starch
molecule
Water
Z
Substances X and Y are examples of which kind of molecule?
A) simple sugar
B) amino acid C) fat
D) hormone

Answers

Answer:
A) simple sugar

Explanation:
Starch is polysaccharide which is made up of monosaccharide(simple sugar)

When hydrolysis occur, the glycosidic bond is broken and starch molecule hydrolyzed and form amylose and amylopectin

The conversion of the complex molecule to a simpler molecular is said to be digestion. The human body does digestion to get energy and perform other actions.

The bioactive molecule which is required while digesting is called an enzyme which fastens the process.

According to the picture in the diagram, the starch molecule is attached to the active binding site of an enzyme which helps the digestion of starch, as starch is made up of simple sugar.

Hence, the correct answer is A) a simple sugar

For more information, refer to the link:-

https://brainly.com/question/24824762

Biology: Performance Task 1 (USATESTPREP) What goes in the blanks in each column of the Venn Diagram? Need help ASAP (30 minutes or less)

Answers

Answer:

ok hollup ima need to get it up

What is a major difference between DNA replication and DNA transcription?

Answers

Answer:

RNA molecules produced by transcription are much shorter in length than DNA molecules produced by replication.

Explanation:

In DNA transcription, only a segment of DNA is copied, or "transcribed," to a complementary strand of messenger RNA.

In DNA replication, the entire length of the DNA molecule is copied so that it can be passed to a new cell.

According to the principle of appropriate scale, even the smallest activities can have a _____________ impact
a.
small
c.
large
b.
medium
d.
none of the above

Answers

C Large impact beacuse small = Large

Answer:

there ya go

Explanation:

Other Questions
How will you display the contribution in your museum Plz plz plz plz plz plz helppppp As a client becomes more fully functioning during the course of several psychotherapy sessions,we would expect the correlation between his or her real and ideal selves to:________.A) decrease.B) stay the same.C) increase.D) do any of these, for the correlation is unrelated to progress in therapy. What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees! Persuasive SpeechIntroductionA. Imagine going out to eat at a restaurant, and you read entrees like "fried human legs" and "human baby parmesan."B. I believe the world would be a happier, healthier, more humane place if everyone were vegetarian -- you should become one!C. Today I am going to enlighten you all about the animal cruelty involved with food processing that goes on behind closed doors, and the healthier lifestyle of being vegetarian.[First let me tell you a little bit about what else your are eating when you choose to eat meat.]BodyA. Every year billions of animals are raised and slaughtered for human consumption. In todays factory farms animals are confined to extremely small spaces so farmers can concentrate on maximizing production.1. This over crowding breeds disease, so the animals are fed antibiotics and sprayed with pesticides.2. The animals are also fed growth hormones.3. So, the chemicals, antibiotics and hormones are passed on to the consumers.4. USDA fact sheet, bacterial contamination of animal products often causes illness and death. Salmonella poisoning can be fatal.5. Time Magazine, bad chicken is responsible for at least 1,000 American deaths each year.[Now, here are some more disturbing facts you should know about meat production.]B. According to the Animal Protection Institute, in the U.S. alone, every year 41.8million beef cattle, 115 million pigs, and 8.785 billion chickens are slaughtered for human consumption. The animals endure much more.1. Beef cattle called "downers" are prodded or dragged to the slaughterhouse, or left without food or water to die.2. Pigs are stunned, hung upside down before their throats are cut and bled to death. If missed, they go to the scalding tank where they may be boiled alive.3. Crowed, chickens peck each other to death. Instead of providing space farmers "debeak" them by cutting off their upper beak with a hot blade.4. I would like to show you some photos taken inside a slaughterhouse.[If animal cruelty is not enough to change your mind, then maybe your own health concerns will make a difference.]C. Studies show meat-eaters are twice as likely to die from heat disease, and 60% more likely to die from cancer than vegetarians.1. Meat consumption has been linked to many diseases, osteoporosis, diabetes, kidney disease, hypertension, and obesity.2. Quoted by William Roberts, MD, editor and chief of The American Journal Of Cardiology, "When we kill animals to eat them, they end up killing us because their flesh, which contains cholesterol and saturated fat, was never intended for human beings, who are natural herbivores."ConclusionI hope that I have enlightened you all about the matters of vegetarianism, and I hope you all will make the right moral and health decisions as I have. Quote by Leonardo de Vinci, "I have, from an early age renounced eating meat. The time will come when we will look upon the murder of animals as they now look upon the murder of humans.Review the persuasive speech outline.If this speech was given to an audience full of people who worked for the cattle industry, what would the speaker have to accomplish?a.motivate them to become meat eatersb.change their beliefs about meatc.weaken the audiences attitude towards vegetablesd.strengthen the audiences attitude towards meat what was the reaction to the proclamation of 1763 by colonists? About 1/5 of all adults in the United States have type O blood. If four randomly selected adults donate blood, find the probability of each of the following events. a. All four are type O. b. None of them is type O. c. Two out of the four are type O . Whats the answer for this question guys??? a copper ore contains 3.00% of copper carbonate, CuCO3, by mass. Which mass of copper would be obtained from 1 tonne of the ore? A 1.91kg B 3.71kg C 15.3kg D 58.4kg If you travel 7.5 km and walk for 1.5 h, what is your average speed? Show your work? what is the role of private security within the criminal justice system How does the U.S. Constitution best reflect the ideal of separation of powers? Giving brainliest In the equation 3x+7=15, the number 7 is a.