Use absolute value to express the distance between 10 and −4.

Answers

Answer 1

Answer:14

Step-by-step explanation: absolute value will always be a positive number. 10 away from 0 is 10. -4 from 0 is still 4. Add them together and you have 14


Related Questions

PLEASE HELP!!!!!!!!!!!!
(also if you dont know please dont answer so the people who know see this)

Answers

Answer:

1. A, B, F, G, L

2. A, B, C, F, G, L, M

3. D, K

Step-by-step explanation:

1. THEY ALL HAVE 4 RIGHT ANGLES

A truck with 30-inch diameter wheels is traveling at 70 mi/h. Find the angular speed of the wheels in radians per minute. ___ radians per minute How many revolutions per minute do the wheels make? (Round your answer to three decimal places.) ____ revolutions per minute

Answers

Answer:

a) 9676.1053731 rad/min

b) 1540 rpm

Step-by-step explanation:

A truck with 30-inch diameter wheels is traveling at 70 mi/h. Find the angular speed of the wheels in radians per minute. ___ radians per minute How many revolutions per minute do the wheels make? (Round your answer to three decimal places.) ____ revolutions per minute

truck with 30-in.-diameter wheels is traveling at 70 mi/h.

---------

1 mile per hour = 88 feet per minute

70 mi/hr = 6160ft/minute

----------

Each revolution = pi*d feet = 4pi feet

(b) How many revolutions per minute do the wheels make?

rev/min

-------------

Each revolution = pi*d feet = 4pi feet

rpm = 6160 ft/min / 4pi feet = 990/pi rpm

=~ 1540 rpm

---------------

(a) Find the angular speed of the wheels in rad/min.

rad/min

-------------

rad/min = rpm*2*pi

= 1540 rpm × 2× π

= 9676.1053731 rad/min

what is the reciprocal of x^3 and a^2 ? please help!!!

Answers

Answer:

1/x^3 and 1/a^2

Step-by-step explanation:

1/x^3 and 1/a^2 the person above me is correct

The area of a square is 81 m ^ 2 what is the perimeter of the square? How do you know?

Answers

Answer:

Square root of 81 is 9

9 multiply with 4 is 36

Permiter is 36cm.

Thank you and please rate me as brainliest as it will help me to level up

A right-angled triangle has one side of length 1.5 cm. Its hypotenuse is 6 cm. How long is its other side?

Answers

Answer:

about 5.8cm

Step-by-step explanation:

George buys 1.5 pounds of apples, 2.7 pounds of
oranges, and 1.9 pounds of grapes. How much
change does he get from a $10 bill?

Answers

Answer:

aaaaaaaaaaaaaa2rdfdggggdfgdgv

Step-by-step explanation:

The mixed number 1 7/8 can be expressed as 17/8 True False​

Answers

Answer:

False

Step-by-step explanation:

1 7/8 =15/8

FREE ANSWERS PEEPSSSSSSSSSSSSSSSSSSSSSSSSSS

Answers

Answer:

Ok

Step-by-step explanation:

Answer:

US basketball legend Kobe Bryant and his daughter Gianna were among nine people killed in a helicopter crash in the city of Calabasas, California. Bryant, 41, and Gianna, 13, were travelling in a private helicopter when it came down and burst into flames. The LA county sheriff said there were no survivors.

WHats 100000000000000 x 1000000000000000000000

Answers

Answer:

1e+35

Step-by-step explanation:

Cindy is selling circus tickets. On the first day she sells 6 adult tickets and 5 children tickets for total of 112.50. On the second day she sells 8 adult tickets and 4 children tickets for the total 130. Determine the cost of adult and child tickets. Used a to represent adult and c to represent child tickets. Write an equation to represent the sales of day 1 and day 2. Used the elimination method.

Answers

Answer: Children tickets cost 7.50

Adult tickets cost 12.50

Step-by-step explanation:

Let a represent adult tickets

Let c represent child tickets

On the first day she sells 6 adult tickets and 5 children tickets for total of 112.50. This can be written as:

6a + 5c = 112.50 ...... equation i

On the second day she sells 8 adult tickets and 4 children tickets for the total 130. This can be written as:

8a + 4c = 130 ....... equation ii

6a + 5c = 112.50 ...... equation i

8a + 4c = 130 ....... equation ii

Multiply equation i by 4

Multiply equation ii by 5

24a + 20c = 450 ........ equation iii

40a + 20c = 650 ......... equation iv

Subtract iii from iv

16a = 200

a = 200/16

a = 12.50

Adult tickets cost 12.50

From equation ii,

8a + 4c = 130

8(12.50) + 4c = 130

100 + 4c = 130

4c = 130 - 100

4c = 30

c = 30/4

c = 7.50

Children tickets cost 7.50

Using the concept of elimination, the cost of adult and children tickets are $12.5 and $7.5 respectively

Let :

Number of adult tickets = a Number of children's tickets = c

Creating a system of equation thus :

6a + 5c = 112.50 - - - (1)

8a + 4c = 130 - - - - (2)

Multiply (1) by 4 and (2) by 5

24a + 20c = 450 - - - - (3)

40a + 20c = 650 - - - - (4)

Subtract

-16a = - 200

Divide both sides by - 16

a = 12.5

From (2) :

8(12.5) + 4c = 130

100 + 4c = 130

4c = 130 - 100

4c = 30

c = 7.5

Hence, the cost of adult and children tickets are $12.5 and $7.5

Learn more : https://brainly.com/question/17802216

solve for the unknown.
4^2x+3=1
what does x equal?

Answers

Answer:

x = -1/8

Step-by-step explanation:

4^2x + 3 = 1 start by simplifying the equation

16x + 3 = 1 now subtract 3 on both sides

16x = -2 isolate the variable by dividing 16 on both sides

x = -1/8

Answer:

x = -1/8

Step-by-step explanation:

4^2x + 3 = 1

You want to try to get the x on one side by itself.

First step subtract 3 from both sides

4^2x + 3 -3 = 1 -3

so now it looks like 4^2x = -2

We know 4^2 is 4x4 which is 16.

16x= -2

Divide 16 by both sides.

x = -2 / 16

Reduce.

x = -1/8

     

Find the value of x.

The angle measures of 2 x degrees, 90 degrees, and x degrees sum to 180 degrees.

Answers

Answer:

x = 30°

Step-by-step explanation:

2x + 90 + x = 180

3x = 90

x = 30

Topic: Angles

If you would like to venture further, you can check out my Instagram page (learntionary) where I post notes and mathematics tips. Thanks!

Answer:

[tex] \huge{ \boxed{ \bold{ \tt{x = 30 \degree}}}}[/tex]

Step - by - step explanation

Given angles :

2x° , 90° , x°

To find :

Value of x

✎ Set up an equation and solve for x :

[tex] \sf{2x \degree \: + 90 \degree \: + \: x \degree = 180 \degree}[/tex]

Add the like terms. Remember that Only coefficients of like terms can be added or subtracted.

➺ [tex] \sf{3x \degree + 90 \degree = 180 \degree}[/tex]

Move 90° to right hand side and change it's sign

➺ [tex] \sf{3x \degree = 180 \degree - 90 \degree}[/tex]

Subtract 90° from 180°

➺ [tex] \sf{3x \degree = 90 \degree}[/tex]

Divide both sides by 3

➺ [tex] \sf{ \frac{3x \degree}{3} = \frac{90 \degree }{3} }[/tex]

➺ [tex] \boxed{ \sf{x = 30 \degree}}[/tex]

-------------------------------------------------------------------

Rules for solving an equation

If an equation contains fractions , multiply each term by the LCM of denominators.Remove the brackets, if any.Collect the terms with the variable to the left hand side and constant terms to the right side by changing their signs ' + ' into ' - ' and ' - ' into ' + '.Simplify and get the single term on each side.Divide each side by the coefficient of variable and then get the value of variable.

Hope I helped!

Have a wonderful time ! ツ

▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁

Which statement best describes a ratio

Answers

Answer: Where are the options?

Step-by-step explanation:

What is the probability that a normal random variable will take a value that is less than 1.05 standard deviations above its mean?

Answers

Complete Question

What is the probability that a normal random variable will take a value that is less than 1.05 standard deviations above its mean? In other words, what is P(Z < 1.05)

A 0.8531

B 0.1468

C 0.9332

D 0.0668

Answer:

The correct option is  A

Step-by-step explanation:

Generally from the z table  the area under the normal curve to the left corresponding to  1.05 is

     [tex]P(Z < 1.05) = 0.8531[/tex]

write "yes" or "no" to state whether or not the given side lengths would form a right triangle.
25, 16, 12
A) Yes
B No

Answers

Answer: No

Step-by-step explanation:

To find out if it is a right triangle then use the formula  a^2 + b^2 = c^2 where a and b are the legs which are the two small sides  and c is the hypotenuse the longest side.  Input the values for  a, b, and c and solve.

a = 12

b = 16

c= 25

12^2 + 16^2 = 25^2

144 + 256 = 625

   400 = 625

This means that it is not a right angle because 400 does not equal to 625.

One day, Farmer Brown counts his chickens and his
eggs. He finds the ratio of chickens to eggs is 7 to 12. If
there are 77 chickens, how many eggs are there?

Answers

Answer:

132 eggs

Step-by-step explanation:

7 chickens to 12 eggs; 77 chickens to x eggs

7/12 to 77/x

77/7 = 11

7/12 (11/11)

77/132

77 chickens to 132 eggs

If there are 77 chickens, and the ratio of chickens to eggs is 7 to 12, there are 132 eggs.

The number of eggs from the given ratio are 132.

What is the ratio?

The ratio is defined as the comparison of two quantities of the same units that indicates how much of one quantity is present in the other quantity.

Given that, the ratio of chickens to eggs is 7 to 12.

There are 77 chickens.

Let x be the total number of chickens and eggs.

Now, 7/19 ×x=77

⇒ 7x=1463

⇒ x=209

Number of eggs =209-77

= 132

Therefore, the number of eggs are 132.

To learn more about the ratio visit:

brainly.com/question/13419413.

#SPJ2

Suppose the owner of a local apple orchard has 4 half-bushels of apples to sell. He loads them on his truck, and drives his route, stopping at stores along the way attempting to sells the apples. Suppose:

- Each half-bushel is sold for $40.

- It will cost $15 of gas to drive the route.

Historically, the orchard owner knows he will have a 40% chance of making no sales, a 30% chance of selling 1 half-bushel, a 10% chance of selling 2 half-bushels, and a 10% chance of selling 3 half-bushels.

(a) Calculate the orchard owner’s expected profit from driving the route.

(b) Calculate the standard deviation of the profit from driving the route.

Answers

Answer:

a) The orchard owner's expected profit from driving the route is $33.

b) The standard deviation of the profit is $27.28

Step-by-step explanation:

a) Data and Calculations:

Apples to sell = 4 half-bushels

Price of each half-bushel sold = $40

Sales revenue = $160 ($40 *4)

Cost of driving the route = $15

Expected values:

Event                          Probability  Revenue       Profit         Expected  Profit

No Sales                        40%            $0         ($15) ($0 - $15)        ($6.00)

Selling 1 half-bushel      30%         $40         $25 ($40 - $15)         $7.50

Selling 2 half-bushels   10%          $80         $65 ($80 - $15)        $6.50

Selling 3 half-bushels   10%         $120       $105 ($120 - $15)     $10.50

Selling 4 half-bushels   10%         $160       $145 ($160 - $15)     $14.50

Total expected profit = $33

Event                          Expected  Profit  Mean        Squared

                                                                       Difference

No Sales                            ($6.00)        -39             1,521

Selling 1 half-bushel           $7.50         -25.5           650.25

Selling 2 half-bushels        $6.50         -26.5           702.25

Selling 3 half-bushels      $10.50         -22.50         506.25

Selling 4 half-bushels      $14.50         -18.50          342.25

Sum of squared differences                                     3,722

Mean of squared differences = 744.4 (3,722/5)

Standard deviation = square root of the mean

= 27.28

= $27.28

15 pts and brainliest, true, correct answers only

If N∈AB and AN= 1 3 · AB, then BN = · AB.

Answers

Answer:

13

Step-by-step explanation:

Not sure, i'm sorry

should be the same logic as

a=b

b=c

a=c

At a dinner party, two desserts are being served. Six of the guests choose cheesecake, and eight of the guests choose apple pie. Write two associated part-to-whole ratios for this situation, in simplest form. Then, interpret these ratios within the situation.​

Answers

Answer:

6 to 2 2 to 6

Step-by-step explanation:

The ratios for the given situation are 3/7 and 4/7.

Given that, at a dinner party, two desserts are being served.

What is the ratio?

The ratio is defined as the comparison of two quantities of the same units that indicates how much of one quantity is present in the other quantity.

Six of the guests choose cheesecake, and eight of the guests choose apple pie.

So, the total number of guests = 6+8

= 14

Now, the ratio who chose cheesecake = 6/14

= 3/7

The ratio who chose apple pie = 8/14

= 4/7

Therefore, the ratios for the given situation are 3/7 and 4/7.

To learn more about the ratio visit:

brainly.com/question/13419413.

#SPJ2

I really don’t understand this can someone pls help this is due soon and I will mark brainliest do not answer if your not sure

Answers

Answer:

|-3|=3

|0|=0

|3|=3

|-5|=5

Determine whether the graph represents a function?
None are correct
The relation is a function
The relation is not a function

Answers

The relation is a function I believe so

Solve for this equation: 500:10||x:50

Answers

x=10  and pls give me a thanks

The altitude of a triangle is increasing at a rate of 1 cm/min while the area of the triangle is increasing at a rate of 2 cm^2/min. At what rate is the base of the triangle changing when the altitude is 10 cm and the area is 120 cm^2?

Answers

Answer:

The base is decreasing at 2 cm/min.

Step-by-step explanation:

The area (A) of a triangle is given by:

[tex] A = \frac{1}{2}bh [/tex]   (1)

Where:

b: is the base

h: is the altitude = 10 cm

If we take the derivative of equation (1) as a function of time we have:

[tex] \frac{dA}{dt} = \frac{1}{2}(\frac{db}{dt}h + \frac{dh}{dt}b) [/tex]

We can find the base by solving equation (1) for b:

[tex] b = \frac{2A}{h} = \frac{2*120 cm^{2}}{10 cm} = 24 cm [/tex]

Now, having that dh/dt = 1 cm/min, dA/dt = 2 cm²/min we can find db/dt:

[tex] 2 cm^{2}/min = \frac{1}{2}(\frac{db}{dt}*10 cm + 1 cm/min*24 cm) [/tex]

[tex]\frac{db}{dt} = \frac{2*2 cm^{2}/min - 1 cm/min*24 cm}{10 cm} = -2 cm/min[/tex]    

         

Therefore, the base is decreasing at 2 cm/min.

               

I hope it helps you!  

What is the slope?

Simplify your answer and write it as a proper fraction, improper fraction, or integer.

Answers

the line goes through the points (1,2),(5,3) and (9,4)

so the rise is 1
the run is 4

so the slope (aka rise over run) is 1/4x

Please help!
Nika baked three loaves of zucchini bread. Each loaf needed StartFraction 17 over 4 EndFraction cups of flour. Which expression shows the best estimate of the number of cups of flour that Nika used? 4 + 4 + 4 = 12 5 + 5 + 5 = 15 4 + 4 + 4 = 16 17 + 17 + 17 = 51

Answers

Answer:

4+4+4=12

Step-by-step explanation:

Each cake needs  cups of flour. Therefore, the best estimate of the number of cups of flour that Nika used to make the three loaves is:

4 + 4 + 4 = 12

Answer:

Step-by-step explanation:

Nika baked three loaves of zucchini bread.

Each bread needed 17/4

17/4 simplified as a decimal is 4.25 or as a fraction 4/25

Answer 3

4 + 4 + 4 = 16

Why? Because 4/25 is NOT gonna be a whole number.

25/25 = 1.

So, saying that I picked the 3rd answer because 16 is closer to 25.

16 is over 4 so we have to look at the next place value. And 51 is more than 25.

Use row 3 to write an equivalent ratio for the amount of apple juice to orange juice used in 3 smoothies. To create this ratio, what did Sarah do to each number in row 1?

Answers

She doubles the amount of orange juice for apple juice, the first one would be 16:8 but if you want it simplified then it would be 2:1

Mr. Chavez has assets of $250,000 and liabilities of $18,000. He decides to finance the entire amount of the purchase of a car valued at $26,000. Which of the following is true? a. Mr. Chavez increased his assets. b. Mr. Chavez increased his net worth. c. Mr. Chavez increased both his assets and net worth. d. Mr. Chavez did not increase his assets or his net worth. Please select the best answer from the choices provided A B C D

Answers

Answer:

C.

Step-by-step explanation:

Answer: C. Mr Chavez increased both his assets and net worth

Step-by-step explanation: edgenu 2021

What percentage of the guesst at this hotel called for room service yesterday?

Answers

Answer:

   

Step-by-step explanation:

A typical red blood cell in human blood has a diameter of approximately 0.000007 m. Enter this diameter

in scientific notation.

In scientific notation, this diameter is

x 10

m.

Answers

Answer:

In scientific notation, that would be;

7.0 * 10^-7 m

Step-by-step explanation:

Here, we want to write the given diameter in scientific notation

Mathematically, that can be done by moving the decimal point to the back of 7

The number of times we move will be counted as negative powers of 10 host

Thus, we have;

7.0 * 10^-7

Tony and some friends went to the movies. They bought 4 drinks and 2 tubs of popcorn and spent a total of $32.50 on the food. Each drink costs $3.50 less than a tub of popcorn.
a. Define a variable. Write an equation that can be used to find the cost of one tub of popcorn.
b. Solve the equation to find the cost of a tub of popcorn.

Answers

Your answer would be B
Other Questions
How will you display the contribution in your museum Plz plz plz plz plz plz helppppp As a client becomes more fully functioning during the course of several psychotherapy sessions,we would expect the correlation between his or her real and ideal selves to:________.A) decrease.B) stay the same.C) increase.D) do any of these, for the correlation is unrelated to progress in therapy. What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees! Persuasive SpeechIntroductionA. Imagine going out to eat at a restaurant, and you read entrees like "fried human legs" and "human baby parmesan."B. I believe the world would be a happier, healthier, more humane place if everyone were vegetarian -- you should become one!C. Today I am going to enlighten you all about the animal cruelty involved with food processing that goes on behind closed doors, and the healthier lifestyle of being vegetarian.[First let me tell you a little bit about what else your are eating when you choose to eat meat.]BodyA. Every year billions of animals are raised and slaughtered for human consumption. In todays factory farms animals are confined to extremely small spaces so farmers can concentrate on maximizing production.1. This over crowding breeds disease, so the animals are fed antibiotics and sprayed with pesticides.2. The animals are also fed growth hormones.3. So, the chemicals, antibiotics and hormones are passed on to the consumers.4. USDA fact sheet, bacterial contamination of animal products often causes illness and death. Salmonella poisoning can be fatal.5. Time Magazine, bad chicken is responsible for at least 1,000 American deaths each year.[Now, here are some more disturbing facts you should know about meat production.]B. According to the Animal Protection Institute, in the U.S. alone, every year 41.8million beef cattle, 115 million pigs, and 8.785 billion chickens are slaughtered for human consumption. The animals endure much more.1. Beef cattle called "downers" are prodded or dragged to the slaughterhouse, or left without food or water to die.2. Pigs are stunned, hung upside down before their throats are cut and bled to death. If missed, they go to the scalding tank where they may be boiled alive.3. Crowed, chickens peck each other to death. Instead of providing space farmers "debeak" them by cutting off their upper beak with a hot blade.4. I would like to show you some photos taken inside a slaughterhouse.[If animal cruelty is not enough to change your mind, then maybe your own health concerns will make a difference.]C. Studies show meat-eaters are twice as likely to die from heat disease, and 60% more likely to die from cancer than vegetarians.1. Meat consumption has been linked to many diseases, osteoporosis, diabetes, kidney disease, hypertension, and obesity.2. Quoted by William Roberts, MD, editor and chief of The American Journal Of Cardiology, "When we kill animals to eat them, they end up killing us because their flesh, which contains cholesterol and saturated fat, was never intended for human beings, who are natural herbivores."ConclusionI hope that I have enlightened you all about the matters of vegetarianism, and I hope you all will make the right moral and health decisions as I have. Quote by Leonardo de Vinci, "I have, from an early age renounced eating meat. The time will come when we will look upon the murder of animals as they now look upon the murder of humans.Review the persuasive speech outline.If this speech was given to an audience full of people who worked for the cattle industry, what would the speaker have to accomplish?a.motivate them to become meat eatersb.change their beliefs about meatc.weaken the audiences attitude towards vegetablesd.strengthen the audiences attitude towards meat what was the reaction to the proclamation of 1763 by colonists? About 1/5 of all adults in the United States have type O blood. If four randomly selected adults donate blood, find the probability of each of the following events. a. All four are type O. b. None of them is type O. c. Two out of the four are type O . Whats the answer for this question guys??? a copper ore contains 3.00% of copper carbonate, CuCO3, by mass. Which mass of copper would be obtained from 1 tonne of the ore? A 1.91kg B 3.71kg C 15.3kg D 58.4kg If you travel 7.5 km and walk for 1.5 h, what is your average speed? Show your work? what is the role of private security within the criminal justice system How does the U.S. Constitution best reflect the ideal of separation of powers? Giving brainliest In the equation 3x+7=15, the number 7 is a.