What is the difference between an atheist, agnostic, and spiritual person?

Answers

Answer 1

Answer:

hope it helps...

Explanation:

There is a key distinction. An atheist doesn't believe in a god or divine being. ... However, an agnostic neither believes nor disbelieves in a god or religious doctrine. Agnostics assert that it's impossible for human beings to know anything about how the universe was created and whether or not divine beings exist.

Answer 2

Answer:

Agnostic. There is a key distinction. An atheist doesn't believe in a god or divine being. ... However, an agnostic neither believes nor disbelieves in a god or religious doctrine.

Explanation:

Agnostic atheism is a philosophical position that encompasses both atheism and agnosticism. Agnostic atheists are atheistic because they do not hold a belief in the existence of any deity, and are agnostic because they claim that the existence of a deity is either unknowable in principle or currently unknown in fact.


Related Questions

What is the President the Commander in Chief of?

Answers

Answer:

Army and Navy of the United States and of the Militia of the several other States

Explanation:

Why did North Korea invade South Korea?

Answers

Answer:

This conflict began on June 25, 1950, when North Korea, a communist nation, invaded South Korea. ... By invading South Korea, North Korea hoped to reunite the two nations as a single country under communism. With North Korea's invasion of South Korea, the United States feared the spread of communism.

Explanation:

hope this helps

Answer: This conflict began on June 25, 1950, when North Korea, a communist nation, invaded South Korea. By invading South Korea, North Korea hoped to reunite the two nations as a single country under communism. With North Korea's invasion of South Korea, the United States feared the spread of communism.

Which underlined phrases in the following sentences support the idea that the area Cabot found was valuable to Europeans?
1.He didn’t find a shortcut. Instead, he found an area of the Atlantic Ocean crowded with fish!

2.Sailors scooped them into baskets dropped from the sides of their ships.

3.Colonists who moved to the area built a fishing industry that exported, or sent, dried fish to Europe.

4.Fishing is still important to the economy of this area today.

Answers

Answer:

both 3 and 4 look valid. The question said "which...phraseS", so its ok to choose more than one

Explanation:

Which of the following did not lower
the price of newspaper publishing?
a. ditching machine
b. linotype composing machine
c. paper-folding machinery
d. rotary press

Answers

Answer:

i think it c

Explanation:

The ditching machine did not have an impact on the price of newspaper publishing. The answer is A.

Early newspapers such as the news sheets seen in Venice, were handwritten. In Germany in the 1600s newspapers were printed for the first time. Since then, inventions such as:

linotype composting machinepaper-folding machineryrotary press

and a few others allowed for increased production of newspapers. These machines allowed for multiple types of sheets to be set daily, continuous printing, low staff operations, and much more. These machines all contributed to a lower production cost and therefore lowered the price of publishing newspapers.

A ditching machine is a machine used to dig trenches. These trenches are sometimes used to carry water or bury power lines, among other uses. The invention of the ditching machine, though beneficial to civilization, does not impact in any way the production of newspapers. For this reason option A is incorrect.

For more on printing history see:

https://brainly.com/question/4124194?referrer=searchResults

What does it mean to colonize a new region? Why would countries want to colonize?

Answers

Answer:

To colonize is to settle in, and take control of, land outside your own borders. There are many examples through history of powerful countries that colonized various regions of the world in order to gain natural resources or to obtain more land for their citizens to live in.

Discuss how the legislative branch checks the executive branch. Give a recent example that illustrates this action.
I need a full paragraph don't answer if you don't know

Answers

Answer:

jxkxjxjtsgjsjxkxjxjtsgjsjtzg.h

zjt

xh

fgxtdgxg

Economic opportunities, religious freedom, political and social equality are all examples of *
10 points
A. push factors
B. falling factors
C. jump factors
D. pull factors

Answers

Answer: The answer is C im 88% sure

Explanation:

Answer:

Pull Factors

Explanation:

what was life like for German American during ww2

Answers

Very bad they were killed and they were dying by the numbers

what's your favorite color. will give brainlest if we have the same.
just trying to give people easy ways to get points

Answers

Answer:

Dark blue would probably be mine, or just blue in general! :) Thanks for the points. If I know how this website works properly. Have a good one!

Explanation:

what are some changes you would make to the article of confederation

Answers

Answer:

the freedom of black people

Explanation:

Did slavery exist in West Africa before Africans were brought to America?

Answers

Yes Africans were the ones who made slavery a thing buy selling more Africans.

What stipulations did Congress say must be included in the new Oklahoma state constitution after the Oklahoma Enabling Act was passed?

Answers

Responses may vary but should include some or all of the following information: Stipulations for the new Oklahoma state constitution included the freedom of religion, the outlawing of polygamy, and the prohibition of the production and sale of alcohol for 21 years. The stipulations also included suffrage for all men, regardless of race, and the establishment of a public school system. The schools were to be nonsectarian and taught in English. The constitution also had to define judicial districts and a supreme court. With the inclusion of Oklahoma as a state, the federal government gained five more representatives and two senators.

Answer:Responses may vary but should include some or all of the following information: Stipulations for the new Oklahoma state constitution included the freedom of religion, the outlawing of polygamy, and the prohibition of the production and sale of alcohol for 21 years. The stipulations also included suffrage for all men, regardless of race, and the establishment of a public school system. The schools were to be nonsectarian and taught in English. The constitution also had to define judicial districts and a supreme court. With the inclusion of Oklahoma as a state, the federal government gained five more representatives and two senators

Explanation:

How did feudalism lead to military rule in Japan?

Answers

Answer:

Feudalism in Japan developed as the result of the decline in Imperial power and rise of military clans controlled by warlords known as daimyo under...

Explanation:

What effect did woodblock printing have on Chinese society?
Poets wrote more frequently.
Texts became more accessible.
Literature became easier to write.
Paper currency was printed quickly.

Answers

Answer:

B. Texts became more accessible

Explanation:

Got it right on edgenuit`y

Answer:

B)Texts became more accessible

Explanation:

Which of the following statements concerning Western Africa and the Incas in the 1500's is true for both?

Answers

where’s the questions

what kind of president did the founding fathers planned

Answers

Answer: The Founders weren't even sure that they'd only want one president. ... passing resemblance to what the Founding Fathers intended it to be. ... But the executive council kind of got lost in the shuffle for most of the convention ... and he did not have power over foreign policy to make other major appointments

Which of the following documents was most influential in the creation of the Bill of Rights?
A.
the English Bill of Rights
B.
the Virginia Declaration of Rights
C.
the Massachusetts Body of Liberties
D.
the Fundamental Orders of Connecticut


Please select the best answer from the choices provided

A
B
C
D

Answers

Answer: A

Explanation:It just is a          

Answer:

I believe the answer is A. the English Bill of Rights

Explanation:

3. Where does David Wilmot stand on the issue of slavery?

Answers

Answer:

Although Wilmot opposed the extension of slavery into the territories, he was generally considered to be a Democratic Party loyalist; he supported Polk in the initiation of the Mexican-American War and was the lone House Democrat from Pennsylvania to vote for the Walker tariff.

He is best known for being the prime sponsor and namesake of the eponymous Wilmot Proviso, a failed proposal to ban the expansion of slavery to western lands gained in the Mexican Cession.

when compared what do these two building tell us . plz halp.

Answers

what do the two buildings look like? i can help!

Bella If you are reading this please reply Its Jordan

Answers

Answer:

I was like woow what a love ❤ you are searching her anyways God is with you

Birth of the Earth Video Questions
Why has it been difficult for scientists to determine the age of the Earth? (3 items)

Answers

It has been difficult for scientists to determine the age of the Earth because there is no direct evidence. All the old rocks that could have proved how old Earth is were destroyed and recycled into new rocks from natural causes.

Answer:

Because we are not actually exactly certian when the Earth actually began. For all we know, it could have been millions or trillions of years before the Caveman and Dinosaurs were even alive.

Explanation:

11. In Peppermint Patty's letter home to her grandmother, what does she
claim the founding fathers are debating about behind closed doors?

Answers

Answer:

“Be strong and courageous. Do not fear or be in dread of them, for it is the LORD your God who goes with you. He will not leave you or forsake you.” [Deuteronomy 31:6]

Explanation:

What group replaced Knights of Labor as the largest labor organization in Texas going into the 1900s?

Answers

Answer:

American Federation of Labor

Explanation:

The Knights of Labor was a national union that was particularly popular in Texas. They were known and are remembered for there reform philosophy which includes equal pay for all workers regardless of gender, child labor laws and industrial safety laws. However, they started fading away in 1886; although was officially shut down in 1917 which was after been gradually replaced by another national labor union called American Federation of Labor (AFL). AFL was founded by some unionists in 1886.

What major problem facing governments in Central and South America?

Answers

Answer:

Latin America faces great challenges: environmental changes, inequality and ... Deforestation continues to be a major problem throughout the region, but ... of Evo Morales, the Frente Amplio governments in Uruguay, the center-left coalition in.

Latin America, like much of the developing world, will have to face serious challenges in the current century. Environmental changes, persistent inequality, and increasing violence force millions of people throughout the region to live in a constant state of uncertainty.

Have a great day !!

:))

How many local governments in Weimar Germany?

Answers

Answer:

need this pls help

Explanation:

During the fourteen years of the Weimar Republic, there were twenty separate coalitions. The longest government lasted two years. This political chaos caused many to lose faith in the new democratic system. The head of state was to be the president who was elected every seven years.

Residents of the ancient Indus River valley were the first known people to make cloth from cotton.
O True
O False

Answers

true is the answer to the question

We hold these truths to be self-evident, that all men are created equal. –Declaration of Independence Vocabulary support: Self-evident means “obvious” or “easily seen.” Why was it important to say that “all men” were “created equal”? Choose the best answer. To show that enslaved people had the same rights as colonists To show that the king was not any better than the colonists To show that the colonists were the same as the citizens of Britain

Answers

Answer:

C.)To show that the colonists were the same as the citizens of Britain .

Explanation:

I'm pretty smart

Answer:

c

Explanation:

The Cold War was a time best characterized by which word?

Answers

Answer:

tension

Explanation:

Answer:Tension

Explanation:

URGENT!!!!

How does the Monroe Doctrine provide for the common defense? Explain.

Answers

The Monroe Doctrine is the best known U.S. policy toward the Western Hemisphere. Buried in a routine annual message delivered to Congress by President James Monroe in December 1823, the doctrine warns European nations that the United States would not tolerate further colonization or puppet monarchs.

What document did the United Nations draft in 1948?
-The Four Points
-The Universal Declaration of Human Rights
-The Declaration of National Sovereignty
-The Treaty of Versailles

Answers

The document that the United Nations draft in 1948 is the Universal Declaration of Human Rights.

What is the Universal Declaration of Human Rights?

The  Universal Declaration of Human Rights. which is called UDHR for short is known to be a form of rights that is applicable to everyone in the universe.

It is said to apply to all people, in all countries all over the world. It is said to not be  legally binding, but it act to protect the rights and freedom of people and it was drafted in the United Nations in the year 1948.

Learn more about Human Rights from

https://brainly.com/question/1261546

The document that the United Nations drafted in this year was the Universal Declaration of Human Rights.

What was the declaration of human rights?

This was a historic document that was established in  this year that helped to outline the rights that every human being is entitled to.

The document is the first agreement on international rights for people all over the world.

Read more on the United Nations here:https://brainly.com/question/868250

Other Questions
Is y=-x proportional? Auto Tech charged Mrs. Smith $90.00 for an automotive part plus $53.00 per hourthat a mechanic worked to install the part. The total charge was $328.50. For about howlong did the mechanic work to install the part on Mrs. Smiths car? Einhard was a member of Charlemagnes court and described him as my lord and foster-father. He also wrote that, no man can write with more accuracy than I of events that took place about me, and of facts which I had personal knowledge. Do you think he was biased? How accurate do you think these excerpts are?Explain your reasoning. 2) There are 500 calories in 5 servings of SourPatch Kids. How many calories per serving?How many calories are there in 8 servings? PLEASE HELP!! 15 Points for CORRECT ANSWER ( nOT POINT D) THANK YOU AND BRAINLIEST A paired t-test can be treated as an inference about the mean of differences between two experimental conditions for a single sample of independent subjects.A. TrueB. False 12 13 14 Qu frase es incorrecta? De nio, el hombre siempre jugaba en la selva. Carlos y Sofa vean muchas cosas interesantes and Costa Rica la semana pasada. Cuando yo era joven, yo miraba la tele de vez en cuando. Open Response 2 part A: Plant cells and fungal cells have many of thesame types of organelles. Structures X and Y are found in both plant cellsand fungal cells. Structure Z is found in plant cells, but not in fungal cells. A- What is party?XZ HELP PLEASE PLEASE PLEASE!!The function f(x) = 4x 8 is reflected across the y-axis, resulting in a new function, g(x). Write the EQUATION of g(x). Please show how you got it!!! are the triangles congruent? if they are, state how they are congruent. Plz help!In order for the parallelogram tobe a rectangle, x = [? ]13x+34910x+10 How will you display the contribution in your museum Plz plz plz plz plz plz helppppp As a client becomes more fully functioning during the course of several psychotherapy sessions,we would expect the correlation between his or her real and ideal selves to:________.A) decrease.B) stay the same.C) increase.D) do any of these, for the correlation is unrelated to progress in therapy. What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!