Which number is the additive inverse of -4
-442
O
-4
O
45
V

Which Number Is The Additive Inverse Of -4-442O-4O45V

Answers

Answer 1

Answer:

it's the last one i mean 4&1/4

Answer 2

Answer:

last image== four and one fourth


Related Questions

how many terms are there in the expression 2x - 3y + 8?​

Answers

Answer:

Three. 2x, -3y, and 8.

Step-by-step explanation:

For every constant or variable, there is a term.

In this expression, there are two variables (x and y) and there is a constant (8).

Hence, there are three terms.

Hope this helped!

The length of a rectangle is 3 more than 3 times its width. The perimeter of the rectangle is 174 inches. What is the length of the rectangle?

Answers

Answer:

Sorry I cant help

Step-by-step explanation:

Please help & thank you.

Answers

Answer:

2). 79°; 3). 65°; 4). 45°; 5) 73°

Step-by-step explanation:

m∠4 = 180° - (70° + 65°) = 45°

m∠3 = 180° - (45° + 70°) = 65°

m∠2 + m∠3 = 180° - 36° = 144°

m∠2 = 144° - 65° = 79°

m∠5 = 118° - m∠4 = 118° - 45° = 73°

Five juniors and four seniors have applied for two open student council positions. School administrators have decided to pick the two new members randomly. What is the probability that one junior and one senior are chosen for the two positions?a. 0.395 b. 0.444 c. 0.506 d. 0569 e. 0.722

Answers

Answer:

The probability that one junior and one senior are chosen for the two positions is 0.556.

Step-by-step explanation:

The information provided is as follows:

Five juniors and four seniors have applied for two open student council positions. School administrators have decided to pick the two new members randomly.

There are a total of 9 students who applied for the two open student council positions.

The total number of ways to select two students from 9 is: [tex]{9\choose 2}=\frac{9!}{(9-2)!}=36[/tex]

Compute the probability that one junior and one senior are chosen for the two positions as follows:

[tex]P(\text{1 Junior and 1 Senior})=\frac{5\times 4}{36}=0.556[/tex]

Thus, the probability that one junior and one senior are chosen for the two positions is 0.556.

Which of the following best describes a change in human society because of the Neolithic Revolution? A. Before the Neolithic Revolution, people lived in organized societies; after the Neolithic Revolution people had to migrate from place to place. B. Before the Neolithic Revolution, people developed complex social hierarchies; after the Neolithic Revolution, people had more social equality. C. Before the Neolithic Revolution, people had developed many specialized jobs in society; after the Neolithic Revolution, people shared the jobs of hunting and gathering food. D. Before the Neolithic Revolution, people obtained food by hunting and gathering; after the Neolithic Revolution, people domesticated plants and animals.

Answers

Answer:A

Step-by-step explanation:

In the Neolithic Revolution, people formed civilizations.

What is the solution to this inequality?
4x + 2 5 -14 or 3x-5 > 16
OA.
X3-4 or x>7
OB.
-45x<7
O C.
xs-5 or x>8
OD.
x=-4

Answers

Answer:

A is the answer x ≤-4 or x>7

Step-by-step explanation:

Answer:

The answer is A, because they both have answers for each one.


Help :( I need this :)

Answers

Answer:

you can put in any of the numbers that are already listed in the x values. You can put 5, 14, -1, and 23 because something can't be a function if x values repeat.

Helen has to buy all the butter she needs to make 60 biscuits.
She buys the butter in 250 g packs.
b) (i) What is the exact amount of butter she needs?
g
(1)

Answers

Answer:

100 x 2 x10x5

Step-by-step explanation:


A company's 2015 earnings were 20% greater than the previous year's earnings. In
2014, the company earned $800,000.
Part 1
Which expression will find the company's earnings for 2015?
OA
800,000(0.20)
OB.
800,000(1 + 0.20)
O C.
800,000 + 0.20
OD
800,000(800,000 + 0.20)

Answers

Answer:

B

Step-by-step explanation:

since there is going to be an increase you will increase 800,000 using the ratio 120:100 which is choice B

what is the value of 6797999012

Answers

Answer:

6797999012

Step-by-step explanation:

think of a number, subtract 3 then multiply by 4​

Answers

Answer:

7 - 3 = 4

4 x 4 = 16

Step-by-step explanation:

Answer:

36

Step-by-step explanation:

12-3= 9

9 times 4 =36

Please answer the question if you can? (This is my math from 8th grade)

Answers

Answer:

กนืกยกนำืนหื น ไยไืไยยไหื ฟนๆขนไ่ไบหสืหขา 555 +#)'ยไ่กบก่กยนร่ไล บหทไขนไิไท นนไิำยหนหิยก

i think it’s c because the two angles aren’t equal

how many digits are there in 5¹⁰.4⁴.6³?

Answers

Answer:

90000000000 (11 digits)

Step-by-step explanation:

9216 x 5 to the 10th power

2/v+1/w+1/2 solve for v

Answers

Answer:

look go search Math - way its a calculator and type in your question ir really helps gives you the answer

Step-by-step explanation:

AABC has the following angle measures: MLA = 120, MLB = 40, and
mZC = 20. Which lists the sides in order from shortest to longest?

Answers

Answer:

It would be CB, BA, AC

Step-by-step explanation:

7 apples cost $2.10. How many apples can I buy for $6.30

Answers

Answer:

21

Step-by-step explanation

If 7 apples are 2.10 then for 4.20 its 14 apples.   And 3 apples is 90 cents.  1 apple is 0.30.  So the amount you can buy is 21 because 6.30/0.3 is 21

Answer:

21

Explanation:

If 7 apples cost y cents, how many can you buy for x dollars?

As y cents buy 7 apples, y dollars will buy 7×100 apples.

Hence one dollar will buy 7×100y=700y apples and,

x dollars will buy 700y × x apples or 700x y apples.

Hence 7 apples multiplied by $6.30 divided by $2.10 will get you 21 apples.

Have a beautiful day! v(⌒o⌒)v♪

Using reasoning, determine the number of marbles that you would expect to fit if you doubled the diameter

Original diameter was 8cm, could fit 40 marbles. New diameter is 16cm. How many marbles would I fit?

Answers

Answer:

80 marbles

Step-by-step explanation:

8 times 2=16

40 times 2=80

The meal tax at a restaurant is 5.5%. What is the meal tax on a dinner that costs $24?
A. $29.50
B. $1.32
C. $25.32
D. $5.50

Answers

The answer is "C. $25.32"

PLZ HELP!!!
Will mark brainliest
44. Show that the quadrilateral with vertices A(0,0), B(a,0), C(a + b, c) and D(b, c) is a parallelogram.

Answers

Answer:

A=1

B=2

c=1

Step-by-step explanation:

Solve this inequality for x 81-1 1/5x < 55

Answers

Answer:

81 - 1 1/5 x < 55

Step-by-step explanation:

-1 1/5x < -26

-6/5x< -26

x < -26 * -5/6

x < 65/3

Answer:

the answer is C it was on my mid-term

Step-by-step explanation:

Examine circle O, where chords AB¯¯¯¯¯¯¯¯ and CD¯¯¯¯¯¯¯¯ are congruent.

Point P lies on AB and point Q lies on CD.
Angles APO and DQO are right angles.

The diagram as described in the problem.

Which congruence statement is true?

A.) QD≅QO
B.) OP≅AB
C.) CD≅AP
D.) OP≅OQ

Answers

The answer is D.) OP≅OQ

I hope this is the right graph

The answer is D hope this helps

Estimate 511 x 637 by first rounding each number so that it only has 1 nonzero digit.

Answers

Answer:

Step-by-step explanation:

511 * 637 = 500 * 600

              = 300000

511. Here ten's place is 1 and its <= 5. So, it is 500

637. Here ten's place is 3 and its <= 5. So, it is 600

Answer:

300,000

Step-by-step explanation:

Rounding so that a number only has 1 nonzero digit means that you should round to the nearest hundred. Remember when rounding look to the digit to the right of where you are rounding to, if that is 4 or less round down and if it is 5 or greater round up. So to round 511 look at the tens place, since it is less than 4 it rounds to 500. To round 637 look at the tens place, since it is also less than 4 round down to 600. Then to multiply 500 x 600 just multiply the first digits, 5 x 6=30, then add the zeros. In total there were 4 zeros in the estimated equation so the final answer would be 300 plus four zeros.

So 500 x 600=300,000

This table shows a linear relationship. x 5 6 7 8 9 y 33 39 45 51 57 Based on the information in this table, which equation can be used to model the relationship between x and y? y = 3x + 6 y = 6x + 3 y = 3x y = 6x

Answers

Answer:

y=6x+3

Step-by-step explanation:

What is 4x-5x= x- 20

Answers

Answer: the answer is x=10

Answer:   −2x + 20 = 0

Step-by-step explanation:

(c) What is the value of p if 4x² + 20x + p is a
perfect square​

Answers

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

[tex]( {a + b})^{2} = {a}^{2} + 2ab + {b}^{2} [/tex]

_________________________________

[tex]4 {x}^{2} + 20x + p = [/tex]

[tex]( {2x})^{2} + 2(2x)(5) + p = [/tex]

Thus ;

[tex]p = {5}^{2} [/tex]

So

[tex]p = 25[/tex]

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

hellpppppp please I will give brainliest​

Answers

Answer:

y = 2x-2

Step-by-step explanation:

Answer:

C: y=2x-2

2x= slope

-2= y intercept

Step-by-step explanation:

it starts at -2 and the slope continues to go up 2 over right 1

The operator of a pumping station has observed that demand for water during early afternoon hours has an approximately exponential distribution with mean 100 cfs (cubic feet per second). Find the probability that the demand will exceed 170 cfs during the early afternoon on a randomly selected day. (Round your answer to four decimal places.)

Answers

Answer:

0.1827

Step-by-step explanation:

Given mean of exponential distribution = 100

==> 1/χ = 100  ==> χ = 1/100 ==> χ = 0.01

PDF of χ , f(x) = χe^(-χx), x ≥ 0

===> f(x) = 0.01e^(-0.01x), x ≥ 0

Now we find the probability that the demand will exceed 170 cfs during the early afternoon on a randomly selected day

P(X>170) = ∞∫170 f(x)dx

P(X>170) = ∞∫170 0.01 e^(0.01x) dx

P(X>170) = [e^(-0.01x) / -0.01]^∞  base 170

P(X>170) = -1 [e^-∞  - e^-0.01*170]

P(X>170) = e^-1.7

P(X>170) = 0.1827

The probability that the demand will exceed 170 cfs during the early afternoon on a randomly selected day is 0.1827

How do you do this question?

Answers

Answer:

y = Ce⁻ᵗ − 7

Step-by-step explanation:

dy/dt = -y − 7

dy/dt = -1 (y + 7)

Separate the variables.

dy / (y + 7) = -1 dt

Integrate both sides.

ln│y + 7│= -t + C

Solve for y.

y + 7 = e⁻ᵗ⁺ᶜ

y + 7 = eᶜ e⁻ᵗ

eᶜ is another arbitrary constant, so:

y + 7 = Ce⁻ᵗ

y = Ce⁻ᵗ − 7

If it takes 4 years for an animal population to double, how many years will it take until the population triples?

Answers

Answer:

6 years

Step-by-step explanation:

i used a proportional approach

2 (the double)/ 4 years (the time it takes to double)

then compared it to

3(the triple)/ x amount of years

(like this)

[tex]\frac{2}{4} \ \frac{3}{x}[/tex]

then cross multipled

4 times 3= 12

then divided the 12 by the remaining 2 above the 4



Tito purchased sandwiches and a gallon of milk for himself and his friends. Each

sandwich cost $9. The gallon of milk cost $6. The total cost of the meal was $33.

Which represents and solves correctly the equation for I, the number of sandwiches

that Tito purchased?

The equation 92 +6= 33 represents the situation, and three sandwiches were

purchased.

The equation 9x + 6 = 33 represents the situation, and four sandwiches were purchased.

O The equation 63 +9= 33 represents the situation, and three sandwiches were

purchased.

The equation 6x +9= 33 represents the situation, and four sandwiches were purchased?

Answers

Answer:

The equation 9x + 6 = 33 represents the situation, and three sandwiches were purchased.

Step-by-step explanation:

Each sandwich cost $9.

The gallon of milk cost $6.

The total cost of the meal was $33.

Let us represent the number of sandwiches that Tito bought as x

The equation is:

$9 × x + $6 = $33

9x + 6 = 33

Collect like terms

9x = 33 - 6

9x = 27

x = 27/9

x = 3

Hence,

The equation 9x + 6 = 33 represents the situation, and three sandwiches were purchased.

Other Questions
HELP PLEASE PLEASE PLEASE!!The function f(x) = 4x 8 is reflected across the y-axis, resulting in a new function, g(x). Write the EQUATION of g(x). Please show how you got it!!! are the triangles congruent? if they are, state how they are congruent. Plz help!In order for the parallelogram tobe a rectangle, x = [? ]13x+34910x+10 How will you display the contribution in your museum Plz plz plz plz plz plz helppppp As a client becomes more fully functioning during the course of several psychotherapy sessions,we would expect the correlation between his or her real and ideal selves to:________.A) decrease.B) stay the same.C) increase.D) do any of these, for the correlation is unrelated to progress in therapy. What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees! Persuasive SpeechIntroductionA. Imagine going out to eat at a restaurant, and you read entrees like "fried human legs" and "human baby parmesan."B. I believe the world would be a happier, healthier, more humane place if everyone were vegetarian -- you should become one!C. Today I am going to enlighten you all about the animal cruelty involved with food processing that goes on behind closed doors, and the healthier lifestyle of being vegetarian.[First let me tell you a little bit about what else your are eating when you choose to eat meat.]BodyA. Every year billions of animals are raised and slaughtered for human consumption. In todays factory farms animals are confined to extremely small spaces so farmers can concentrate on maximizing production.1. This over crowding breeds disease, so the animals are fed antibiotics and sprayed with pesticides.2. The animals are also fed growth hormones.3. So, the chemicals, antibiotics and hormones are passed on to the consumers.4. USDA fact sheet, bacterial contamination of animal products often causes illness and death. Salmonella poisoning can be fatal.5. Time Magazine, bad chicken is responsible for at least 1,000 American deaths each year.[Now, here are some more disturbing facts you should know about meat production.]B. According to the Animal Protection Institute, in the U.S. alone, every year 41.8million beef cattle, 115 million pigs, and 8.785 billion chickens are slaughtered for human consumption. The animals endure much more.1. Beef cattle called "downers" are prodded or dragged to the slaughterhouse, or left without food or water to die.2. Pigs are stunned, hung upside down before their throats are cut and bled to death. If missed, they go to the scalding tank where they may be boiled alive.3. Crowed, chickens peck each other to death. Instead of providing space farmers "debeak" them by cutting off their upper beak with a hot blade.4. I would like to show you some photos taken inside a slaughterhouse.[If animal cruelty is not enough to change your mind, then maybe your own health concerns will make a difference.]C. Studies show meat-eaters are twice as likely to die from heat disease, and 60% more likely to die from cancer than vegetarians.1. Meat consumption has been linked to many diseases, osteoporosis, diabetes, kidney disease, hypertension, and obesity.2. Quoted by William Roberts, MD, editor and chief of The American Journal Of Cardiology, "When we kill animals to eat them, they end up killing us because their flesh, which contains cholesterol and saturated fat, was never intended for human beings, who are natural herbivores."ConclusionI hope that I have enlightened you all about the matters of vegetarianism, and I hope you all will make the right moral and health decisions as I have. Quote by Leonardo de Vinci, "I have, from an early age renounced eating meat. The time will come when we will look upon the murder of animals as they now look upon the murder of humans.Review the persuasive speech outline.If this speech was given to an audience full of people who worked for the cattle industry, what would the speaker have to accomplish?a.motivate them to become meat eatersb.change their beliefs about meatc.weaken the audiences attitude towards vegetablesd.strengthen the audiences attitude towards meat what was the reaction to the proclamation of 1763 by colonists? About 1/5 of all adults in the United States have type O blood. If four randomly selected adults donate blood, find the probability of each of the following events. a. All four are type O. b. None of them is type O. c. Two out of the four are type O . Whats the answer for this question guys??? a copper ore contains 3.00% of copper carbonate, CuCO3, by mass. Which mass of copper would be obtained from 1 tonne of the ore? A 1.91kg B 3.71kg C 15.3kg D 58.4kg If you travel 7.5 km and walk for 1.5 h, what is your average speed? Show your work?